Expression, purification and characterization of a recombinant Tat47-57-Oct4 fusion protein in Pichia pastoris
- Authors:
- Published online on: December 11, 2013 https://doi.org/10.3892/mmr.2013.1857
- Pages: 471-475
Abstract
Introduction
The expression of human Oct4, Sox2, c-Myc and Nanog can turn a variety of differentiated cells into induced pluripotent stem cells with embryonic stem cell-like properties (1–3). Oct4 is a member of the POU transcription factor family, and is significant in the pluripotency and self-renewal of embryonic stem cells (4,5). Induced pluripotent stem cell formation can be caused by Oct4 alone in mouse and human neural stem cells (6,7).
Oct4 only exhibits these functions intracellularly (8), whereas the human immunodeficiency virus (HIV) Tat protein can be taken up by cells where it activates viral genome transcription (9). In the late 1990s, the first use of Tat as a delivery agent to introduce proteins into cells in vitro (10) and in mice in vivo (11) was reported, followed by numerous studies concerning the application of Tat to deliver various proteins into cells in the form of Tat-fusion proteins or Tat-protein conjugates (12–14). In the present study, fusing the Oct4 gene with Tat47–57 allowed Oct4 to penetrate the cell membrane.
Oct4 has been produced using Escherichia coli (15) or mammalian cells (16). However, these expression systems are limited by low yields, complex manipulations or high culture costs. The methylotrophic yeast, Pichia pastoris, has the advantage of eukaryotic and prokaryotic expression systems and has widely been used to express a variety of biologically active proteins in extremely high yields (17–20). In the present study, the Oct4 gene was fused with a human serum albumin (HSA) signal peptide and HIV Tat47–57, and then inserted into the pPICZαC vector. The recombinant Tat47–57-Oct4 fusion protein was expressed with P. pastoris X-33 under the control of aldehyde oxidase 1 (AOX1). Tat47–57-Oct4 was secreted into the growth medium, yielding ~210 mg/l. The transmembrane transport ability of purified Tat47–57-Oct4 fusion protein was confirmed by immunofluorescence analysis.
Materials and methods
Acquisition of the Oct4 gene
To obtain the Oct4 gene, total RNA was extracted from human livers and used as the template for reverse transcription, conducted for 30 min at 42ºC followed by heat treatment for 2 min at 94ºC to inactivate avian myeloblastosis virus reverse transcriptase. The cDNA was then used as the template for polymerase chain reaction (PCR) using the following primers: P1, 5′-CCATGGCGGGACACCTGGCTTC-3′ and P2, 5′-TCAGTTTGAATGCATGGGTG-3′.
The PCR protocol consisted of initial pre-heating at 94ºC for 5 min, followed by 32 cycles of 94ºC for 30 sec, 60ºC for 30 sec and 72ºC for 90 sec and a 5-min final elongation at 72ºC. The PCR product was inserted into the PMD-18 vector to generate the plasmid, pTOct4, which was verified by DNA sequencing.
Construction of expression vector, pPICZαC-Tat-Oct4
Three primers were designed to construct a plasmid containing the human serum albumin (HSA) signal peptide and HIV Tat47–57 fused with Oct4. Partial DNA sequences of the HSA signal peptide, HIV Tat47–57 and a 13-bp homologue of the Oct4 DNA sequence were included in primer P3: Forward, 5′-TTATTCGC GAGGTGTGTTTCGTCGATACGGTAGAAAGAAGCGTCG ACAGCGTCGACGAATGGCGGGACACC-3′. The homologue DNA sequence of Oct4 is shown in bold, the DNA sequence of HIV Tat47–57 is underlined and the partial DNA sequence of the HSA signal peptide is shown in italics. The DNA sequences of the Bspt1041 recognition sites and the HSA signal peptide were included in P4: Forward, 5′-GGTTC GAAACGATGAAGTGGGTAACCTTTATTTCCCTTCTTTTTC TCTTTAGCTCGGCTTATTCGCGAGGTGTG-3′. The DNA sequence of the HSA signal peptide is in italics, and the DNA sequence of the recognition site for Bspt104I is underlined. A total of 17 bp of reverse homologue DNA sequences of Oct4 and the XbaI recognition sites were included in P5: Forward, 5′-CCAGAATTCTCAGTTTGAATGCATGG-3′. The DNA sequence of the recognition site for XbaI is underlined and the stop codon is shown in bold.
Two rounds of PCR were performed. Firstly, the plasmid pTOct4 was used as the template in the first PCR with primers P3 and P2. The PCR reaction mixture was initially heat denatured at 94ºC for 5 min, followed by 16 cycles with 30 sec of denaturation at 94ºC, 30 sec of annealing at 60ºC and 90 sec of extension at 72ºC, 30 sec of denaturation at 94ºC, 30 sec annealing at 53ºC and 90 sec extension at 72ºC. An additional extension for 5 min at 72ºC was performed to ensure the completion of the PCR products. Secondly, the PCR products were used as the template for the second PCR with primers P4 and P5. The cycle program consisted of 33 cycles with 30 sec of denaturation at 94ºC, 30 sec of annealing at 59ºC and 90 sec of extension at 72ºC and a final extension of 5 min at 72ºC. The product was digested with Bspt104I and XbaI and ligated into pPICZαC at the same sites to generate pPICZαC-pHSA-Tat-Oct4. The result was confirmed by DNA sequencing.
Screening for high-level expression colonies
The recombinant expression vector, pPICZαC-pHSA-Tat-Oct4, was linearized by SacI and then introduced into P. pastoris X-33 (Invitrogen Life Technologies, Carlsbad, CA, USA) by electroporation with a Micropulser (Bio-Rad, Hercules, CA, USA) according to the pPICZαC vector manual. The transformants were screened on yeast extract peptone dextrose (YPD) agar plates containing zeocin, and cultured at 28ºC for at least three days. The positive clones were selected and cultured in 5 ml buffered glycerol-complex (BMGY) medium at 28ºC for 24 h with agitation at 250 rpm in an orbital shaker (Thermo Fisher Scientific, Boston, MA, USA). The genomic DNA was extracted and amplified using 5′AOX1 and 3′AOX1 as primers to verify whether the Tat-Oct4 gene was integrated into the genome stably. Non-transformed yeast DNA was extracted as a control group. To achieve a high yield of Tat-Oct4, the positive transformants were cultured in 10 ml BMGY medium [1.0% yeast extract, 2.0% peptone, 1.34% yeast nitrogen base, 0.5 mg/l biotin, 100 mM potassium phosphate (pH 6.0) and 1.0% glycerol] and incubated at 28ºC for 24 h. Next, the cells were cultured in 10 ml buffered methanol-complex medium in which 1.0% glycerol was replaced by 0.5% methanol. Fresh methanol was added every 24 h to maintain the concentration at 0.5% (v/v) for nine days. The expression level of Tat-Oct4 in the supernatant was determined by SDS-PAGE and western blotting.
Pilot-scale fermentation of Tat47–57-Oct4
The clone with the highest level of Tat-Oct4 expression was cultured in 2 liters YPD medium in a 5-liter conical flask in a shaking incubator (Thermo Fisher Scientific), at 28ºC until the optical density (OD) of cultured P patoris at 600 nm reached 10. This culture was then added into a 80-liter NBS Bioflo 5000 fermenter (New Brunswick Scientific, Enfield, CT, USA) containing 40 liters of fermentation basal salt medium FM21, supplemented with PTM1 trace salts (21) and biotin (0.04 ml stock solution). The level of dissolved oxygen (DO) was maintained at 30–40% and the stirring rate was 400 rpm in the 80-liter NBS Bioflo 5000 fermenter (New Brunswick Scientific, Enfield, CT, USA). The medium was maintained at pH 4.0 by automatic addition of 5M NH4OH and 1M phosphoric acid and 5% antifoam was also delivered as required. The temperature was controlled at 28ºC. The fermentation was divided into three phases; the designated glycerol, glycerol-fed and methanol-fed batch phases. The pH of the medium was maintained at 4.0 during the glycerol phase and once the glycerol was consumed at the end of the first phase, there was a sharp increase in DO value, and the second phase was initiated. During this phase, 50% glycerol feed, containing 1.2% (v/v) PTM1 trace salts, was added at an initial speed of 400 ml/h with peristaltic pump (LongerPump, Baoding Hebei, China), with the speed of addition gradually increasing to 720 ml/h. The glycerol was supplied until a cell yield of 180–220 g/l wet weight was achieved. The third phase was initiated by starting a 100% methanol feed containing 1.2% (v/v) PTM1 trace salts. During the methanol induction phase, the pH was adjusted to 8.0. Methanol was initially added at 144 ml/h for 4 h to allow the culture to adapt to growth on methanol, subsequent to which, the addition speed was gradually increased to 440 ml/h. The samples of the culture medium were collected every 4 h to analyze the wet cell weight, the OD600 and the expression level of Tat-Oct4.
Purification of Tat47–57-Oct4
The supernatant was harvested by centrifugation (10,000 × g, 5 min) and the proteins were precipitated by 35% saturated ammonium sulfate. As the molecular weight of Tat47–57-Oct4 is ~40 kDa, all the proteins weighing between 10 and 100 kDa were isolated and concentrated using Vivaflow 200 PES with 50,000 and 10,000 molecular weight cut off (Sartorius, Goettingen, Germany). To purify the sample further, the supernatant was diluted three times with 50 mM NaAc-HAc and loaded onto a SP Sepharose column (Amersham-Pharmacia, Piscataway, NJ, USA), pre-equilibrated with 50 mM NaAc-HAc buffer and set at a flow rate of 30 ml/min. The protein was eluted in a linear salt gradient and monitored by measuring the UV absorbance at 280 nm. The fractions containing Tat-Oct4 (from the SP Sepharose XL column) were desalted and concentrated by ultrafiltration (10,000 molecular weight cut off, Vivaflow 200) and filtered by a 0.22-μm filter. The components were analyzed by SDS-PAGE and western blotting to determine which contained Tat-Oct4. The purified Tat-Oct4 was analyzed on a high-performance liquid chromatography (HPLC) system (Waters, Milford, MA, USA) using a C4 reversed-phase column (Waters, Milford, MA, USA). The protein concentration was determined by the Bradford method using bovine serum albumin (BSA) as the concentration standard (22). The purified Tat-Oct4 was freeze-dried rapidly in a high vacuum freeze dryer, ALPHA-1–4 (Martin Christ Company, Harz, Germany). The concentration of Tat-Oct4 at each step of the procedure was quantified by an enzyme-linked immunosorbent assay and the product was stored under sterile conditions at −80ºC.
SDS-PAGE and western blotting
The purified protein, Tat-Oct4 was analyzed by SDS-PAGE performed with a 12% gel and stained with Coomassie brilliant blue, according to the method of Sambrook and Russel (23).
The proteins in the gel were transferred to a polyvinylidene fluoride (PVDF) membrane for western blotting using a semi-dry electroblotting apparatus (Bio-Rad) at 15 V for 30 min in 25 mM Tris/192 mM glycine. The membrane was blocked by incubating with Tris-buffered saline with Tween 20 (TBST) containing 2% BSA over 12 h at 4ºC, then washed three times with 0.2% BSA in TBST and incubated with rabbit anti-human Oct4 polyclonal antibody (Abcam, Cambridge, UK) for 3 h at room temperature, followed by a final three washes with TBST. The membrane was then incubated with the secondary goat anti-rabbit antibody (Abcam, Boston, MA, USA) for another 3 h, washed three times with TBST and then washed with TBS for 15 min. The Tat-Oct4 fusion protein was detected using 3,3′-diaminobenzidine tetrahydrochloride reagents (Beyotime, Jiangsu, China).
N-terminal amino acid sequence analysis
To determine the N-terminal sequence, the purified Tat-Oct4 was electrophoresed on a 12% SDS-PAGE gel and electroblotted onto a PVDF membrane. Following blotting, the PVDF membrane was stained with Amido black and the Tat-Oct4 band was cut out. The N-terminal amino acid sequence analysis was conducted using a PPSQ-21A protein sequencer (Shimadzu, Kyoto, Japan).
Detection of transmembrane transport ability of Tat-Oct4
Fibroblasts were obtained from human foreskin tissue, obtained from the first hospital of Jilin University and the patient consent was signed by the patient himself. The fibroblasts were inoculated in a 24-well plate at a density of 1×105 cells per well. After 24 h, the cells were treated with serum-free minimum essential medium containing 1 μM Tat-Oct4 or saline water (negative control group), and cultured with serum-free medium for 6 h only. The cells were then washed three times with phosphate-buffered saline (PBS) for 10 min to remove proteins from the outside of the cells, fixed with 4% paraformaldehyde for 30 min, washed three times with PBS for 5 min and then treated with 0.25% Triton X-100 in PBS and 5% BSA (to block non-specific binding) for 30 min. The cells were then incubated overnight at 4ºC with rabbit Oct4 polyclonal antibody (Abcam, Cambridge, UK), then washed three times with PBS for 5 min and incubated further with fluorescein isothiocyanate-conjugated goat anti-rabbit immunoglobulin G antibody for 30 min at 37ºC. The cells were rinsed three times and incubated with propidium iodide solution. Finally, the cells were rinsed another three times and examined using a fluorescence microscope (FA500; Olympus, Tokyo, Japan).
Results and Discussion
Construction and transformation of Tat-Oct4
The 1,086-bp gene fragment encoding human Oct4 was amplified by PCR with primers P1 and P2, and subcloned into the PMD-18 vector to generate the plasmid, pTOct4. The 1,200-bp gene fragment encoding the HSA signal peptide, HIV Tat47–57, Oct4 Bspt1041 and the XbaI recognition site, was amplified by two-step PCR from pTOct4 and subcloned into pPICZαC to generate the recombinant expression vector, pPICZαC-Tat-Oct4. Nucleotide sequencing analysis confirmed that the two vectors contained the correct gene.
Expression of P. pastoris and screening for high-level expression colonies
To integrate the HSA signal peptide, HIV Tat47–57 and Oct4 were incorporated into the genome of P. pastoris by homologous recombination. pPICZαC-Tat-Oct4 was linearized with SacI and transformed into electrocompetent P. pastoris cells. A successful integration was confirmed by screening with zeocin and PCR with AOX1 universal primers. The PCR results revealed that 95% zeocin-positive yeast transformants had one specific band of ~1,471 bp.
The positive clones were inoculated in BMGY medium for 24 h, the cells were collected and the expression of the Tat47–57-Oct4 fusion protein was induced in the buffered methanol-complex medium. Subsequent to a 168-h induction, each strain was analyzed on SDS-PAGE to detect the Tat47–57-Oct4 expression. According to the DNA sequence of Tat-Oct4, the calculated molecular weight of Tat-Oct4 was ~40 kDa (Fig. 1).
Pilot-scale expression, purification and characterization of purified Tat47–57-Oct4
All the details of the batch fermentation are shown in Fig. 2. The glycerol phase lasted 30 h and the methanol induction phase lasted 112 h. At the end of the glycerol phase, the OD600 of the culture reached 168; the wet cell weight reached 221 mg/ml and the DO value sharply increased from 30 to 100 mg/ml. In order to consume all the glycerol, the cells were cultured for an additional 2 h without any additions. Methanol was then added into the culture as the inducer and the carbon source during P. pastoris fermentation. The methanol feed rate was adapted according to the DO value, which was maintained at 30–40%. The weight of wet cells and the corresponding OD600 reached 328 and 218 mg/ml subsequent to a 112-h induction. The expression level of Tat47–57-Oct4 during fermentation was revealed by Coomassie-stained SDS-PAGE (Fig. 3).
Purity and yield of Tat47–57-Oct4
Following the fermentation and purification processes, 601 mg purified Tat47–57-Oct4 was obtained from 60 liters of culture medium. The Tat47–57-Oct4 purity was 95.6%, as revealed by SDS-PAGE (Fig. 4) and HPLC. The protein recovery ratio and purity of Tat47–57-Oct4 at the various purification steps are summarized in Table I.
N-terminal amino acid sequence analysis
The signal peptide and propeptide of HSA, which consists of a signal sequence of 24 amino acids (MKWVTFISLLFLFSSAYSRGVFRR), can be cleaved at the site after amino acid residues SR or RR. The N-terminal sequencing of the purified protein revealed the sequence of the first 15 amino acids as GVFRRYGRKKRRQRR, indicating that the signal peptide was cleaved at the site after amino acid residue SR.
Detection of the Tat-Oct4 transmembrane transport ability
The transmembrane transport ability of Tat-Oct4 was analyzed by indirect immunofluorescence. The results demonstrated that visible green fluorescence signals appeared in the human foreskin fibroblasts treated with serum-free medium containing Tat-Oct4. The green fluorescence signal was absent in the cells treated with saline (the negative control group), indicating that Tat47–57-Oct4 has the ability to pass through the cell membrane (Fig. 5).
Kim et al expressed Tat-SOD in E.coli and tested the protectve effect against ischemic brain injury. They observed that Tat-SOD was able to enter brain neurons and protect them from ischemic insult and cell death (24). Liu et al used EPO and EPO-Tat to treat a rat model of transient focal ischemia and demonstrated that 1,000 U/kg EPO-TAT exhibited a comparable neuroprotection to 5,000 U/kg EPO with no detectable side effects (25). Furthermore Zhou et al used E.coli. to produce human Oct4–11R-His fusion protein and observed the membrane penetrating ability of the fusion protein. They showed that the fusion protein was able to effectively enter the BJ cells and locate around the nuclei, but the authors did not investigate the bioactivity of the fusion protein (26). In the present study, the Tat47–58-Oct4 fusion protein was successfully expressed using the P. pastoris expression system and purified following pilot-scale fermentation by precipitation, ultrafiltration and chromatography. The yield and purity of Tat47 57-Oct4 were 210 mg/l and 95.6%, respectively, and the fusion protein revealed the ability to penetrate human foreskin fibroblasts. Therefore, the yeast expression system described in the present study is a useful tool to produce a large quantity of active Tat47 57-Oct4 fusion protein, which is likely to facilitate the mechanistic and potential clinical application studies of Oct4. In the next step we will investigate the bioactivity of the Tat47 57-Oct4 fusion protein in induced pluripotent stem (iPS) cells.
Acknowledgements
This study was supported by the Jilin Kangrui Regenerative Medicine Co., Ltd. Changchun, P.R. China.
References
Takahashi K and Yamanaka S: Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 126:663–676. 2006. View Article : Google Scholar : PubMed/NCBI | |
Vierbuchen T, Ostermeier A, Pang ZP, Kokubu Y, Südhof TC and Wernig M: Direct conversion of fibroblasts to functional neurons by defined factors. Nature. 463:1035–1041. 2010. View Article : Google Scholar : PubMed/NCBI | |
Jiang B, Dong H, Li Q, Yu Y and Zhang Z, Zhang Y, Wang G and Zhang Z: Differentiation of reprogrammed mouse cardiac fibroblasts into functional cardiomyocytes. Cell Biochem Biophys. 66:309–318. 2013. View Article : Google Scholar : PubMed/NCBI | |
Rosner MH, Vigano MA, Ozato K, Timmons PM, Poirier F, Rigby PW and Staudt LM: A POU-domain transcription factor in early stem cells and germ cells of the mammalian embryo. Nature. 345:686–692. 1990. View Article : Google Scholar : PubMed/NCBI | |
Niwa H, Miyazaki J and Smith AG: Quantitative expression of Oct-3/4 defines differentiation, dedifferentiation or self-renewal of ES cells. Nat Genet. 24:372–376. 2000. View Article : Google Scholar : PubMed/NCBI | |
Marión RM, Strati K, Li H, Murga M, Blanco R, Ortega S, Fernandez-Capetillo O, Serrano M and Blasco MA: A p53-mediated DNA damage response limits reprogramming to ensure iPS cell genomic integrity. Nature. 460:1149–1153. 2009.PubMed/NCBI | |
Kim JB, Sebastiano V, Wu G, Araúzo-Bravo MJ, Sasse P, Gentile L, Ko K, Ruau D, Ehrich M, van den Boom D, et al: Oct4-induced pluripotency in adult neural stem cells. Cell. 136:411–419. 2009. View Article : Google Scholar : PubMed/NCBI | |
Lam CS, Mistri TK, Foo YH, Sudhaharan T, Gan HT, Rodda D, Lim LH, Chou C, Robson P, Wohland T and Ahmed S: DNA-dependent Oct4-Sox2 interaction and diffusion properties characteristic of the pluripotent cell state revealed by fluorescence spectroscopy. Biochem J. 448:21–33. 2012. View Article : Google Scholar : PubMed/NCBI | |
Moy P, Daikh Y, Pepinsky B, Thomas D, Fawell S and Barsoum J: Tat-mediated protein delivery can facilitate MHC class I presentation of antigens. Mol Biotechnol. 6:105–113. 1996. View Article : Google Scholar : PubMed/NCBI | |
Nagahara H, Vocero-Akbani AM, Snyder EL, Ho A, Latham DG, Lissy NA, Becker-Hapak M, Ezhevsky SA and Dowdy SF: Transduction of full-length TAT fusion proteins into mammalian cells: TAT-p27Kip1 induces cell migration. Nat Med. 4:1449–1452. 1998. View Article : Google Scholar : PubMed/NCBI | |
Schwarze SR, Ho A, Vocero-Akbani A and Dowdy SF: In vivo protein transduction: delivery of a biologically active protein into the mouse. Science. 285:1569–1572. 1999. View Article : Google Scholar : PubMed/NCBI | |
Huang Z, Ji M, Peng Z, Huang S, Xiao Q, Li C, Zeng J, Gao M and Feng W: Purification of TAT-CC-HA protein under native condition, and its transduction analysis and biological effects on BCR-ABL positive cells. Biomed Pharmacother. 65:183–192. 2011. View Article : Google Scholar : PubMed/NCBI | |
Park JS, Park SY, Cho HI, Sohn HJ and Kim TG: Enhanced induction of T cell immunity using dendritic cells pulsed with HIV Tat and HCMV-pp65 fusion protein in vitro. Immune Netw. 11:182–189. 2011. View Article : Google Scholar : PubMed/NCBI | |
Zhao B, Wang Y, Zhang Y, Li Y, Zhang X, Xu Y, Chen L, Li C, Ju Y and Meng S: TAT-mediated gp96 transduction to APCs enhances gp96-induced antiviral and antitumor T cell responses. Vaccine. 31:545–552. 2013. View Article : Google Scholar : PubMed/NCBI | |
Zhou H, Wu S, Joo JY, Zhu S, Han DW, Lin T, Trauger S, Bien G, Yao S, Zhu Y, et al: Generation of induced pluripotent stem cells using recombinant proteins. Cell Stem Cell. 4:381–384. 2009. View Article : Google Scholar : PubMed/NCBI | |
Kim D, Kim CH, Moon JI, Chung YG, Chang MY, Han BS, Ko S, Yang E, Cha KY, Lanza R and Kim KS: Generation of human induced pluripotent stem cells by direct delivery of reprogramming proteins. Cell Stem Cell. 4:472–476. 2009. View Article : Google Scholar : PubMed/NCBI | |
Sen Gupta C and Dighe RR: Hyperexpression of biologically active human chorionic gonadotropin using the methylotropic yeast, Pichia pastoris. J Mol Endocrinol. 22:273–283. 1999. | |
Damaso MC, Almeida MS, Kurtenbach E, Martins OB, Pereira N Jr, Andrade CM and Albano RM: Optimized expression of a thermostable xylanase from Thermomyces lanuginosus in Pichia pastoris. Appl Environ Microbiol. 69:6064–6072. 2003. View Article : Google Scholar : PubMed/NCBI | |
Murasugi A, Kido I, Kumai H and Asami Y: Efficient production of recombinant human pleiotrophin in yeast, Pichia pastoris. Biosci Biotechnol Biochem. 67:2288–2290. 2003. View Article : Google Scholar : PubMed/NCBI | |
Laborde C, Chemardin P, Bigey F, Combarnous Y, Moulin G and Boze H: Overexpression of ovine leptin in Pichia pastoris: physiological yeast response to leptin production and characterization of the recombinant hormone. Yeast. 21:249–263. 2004.PubMed/NCBI | |
Sreekrishna K, Brankamp RG, Kropp KE, Blankenship DT, Tsay JT, Smith PL, Wierschke JD, Subramaniam A and Birkenberger LA: Strategies for optimal synthesis and secretion of heterologous proteins in the methylotrophic yeast Pichia pastoris. Gene. 190:55–62. 1997. View Article : Google Scholar : PubMed/NCBI | |
Bradford MM: A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem. 72:248–254. 1976. View Article : Google Scholar : PubMed/NCBI | |
Sambrook J and Russell DW: SDS-polyacrylamide gel electrophoresis of proteins. CSH Protoc. 2006. View Article : Google Scholar | |
Kim DW, Eum WS, Jang SH, Kim SY, Choi HS, Choi SH, An JJ, Lee SH, Lee KS, Han K, Kang TC, Won MH, Kang JH, Kwon OS, Cho SW, Kim TY, Park J and Choi SY: Transduced Tat-SOD fusion protein protects against ischemic brain injury. Mol Cells. 19:88–96. 2005.PubMed/NCBI | |
Liu P, Liu X, Akf Liou EY, Xing J, Jing Z, Ji X, Liu X, Zhao H, Yan F, Chen J, Cao G and Luo Y: The Neuroprotective Mechanism of Erythropoietin-TAT Fusion Protein Against Neurodegeneration from Ischemic Brain Injury. CNS Neurol Disord Drug Targets. Aug 27–2013.(Epub ahead of print). | |
Chengliang Zhou, Fengqing Xu, Chunhong Wang, Tao Liu, Xinrong Peng and Qijun Qian: Expression of human Oct4 and cell penetrating peptide fusion protein. Academic Journal of Second Military Medical University. 31:489–493. 2010.(In Chinese). |