Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
December-2014 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2014 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Insights into the paracrine effects of uterine natural killer cells

  • Authors:
    • Xin Gong
    • Yanxia Liu
    • Zhenzhen Chen
    • Cai Xu
    • Qiudan Lu
    • Zhe Jin
  • View Affiliations / Copyright

    Affiliations: Department of Reproductive Endocrinology, Dongfang Hospital of Beijing University of Chinese Medicine, Beijing 100078, P.R. China, Department of Chinese Materia Medica, Beijing University of Chinese Medicine, Beijing 100102, P.R. China
    Copyright: © Gong et al. This is an open access article distributed under the terms of Creative Commons Attribution License [CC BY_NC 3.0].
  • Pages: 2851-2860
    |
    Published online on: October 13, 2014
       https://doi.org/10.3892/mmr.2014.2626
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Uterine natural killer (uNK) cells are recruited into the uterus during establishment of the implantation and placentation of the embryo, and are hypothesized to regulate uterine spiral artery remodeling and angiogenesis during the initial stages of pregnancy. Failures in uNK cell activation are linked to diseases associated with pregnancy. However, the manner in which these cells interact with the endometrium remain unknown. Therefore, this study investigated the paracrine effects of uNK cells on the gene expression profile of an endometrial epithelial and stromal cell co‑culture system in vitro, using a microarray analysis. Results from reverse transcription‑quantitative polymerase chain reaction and enzyme‑linked immunosorbent assay experiments showed that soluble factors from uNK cells significantly alter endometrial gene expression. In conclusion, this study suggests that paracrine effects of uNK cells guide uNK cell proliferation, trophoblast migration, endometrial decidualization and angiogenesis, and maintain non‑cytotoxicity of uNK cells.

Introduction

In the human endometrium, uterine leukocytes undergo cyclic changes in cell number during the menstrual cycle. Uterine natural killer (uNK) cells comprise 70% of all decidual leukocytes during the secretory phase, when implantation occurs, and during early pregnancy (1,2). At the initiation of embryo implantation and placentation, uNK cells interact with the extravillous trophoblasts and fetal cells that invade the uterus, where they remove and replace the smooth muscle of maternal spiral arteries (3). This ultimately converts small, coiled vessels into wider channels that are able to provide nutrients to the developing fetus (4).

The initial contact between the blastocyst and uterus occurs through adhesion of the embryonic trophectoderm to the uterine epithelium (5). During implantation, the epithelium is said to become ‘receptive’ (6). In addition, the transformation of endometrial stromal cells from small, densely packed cells to large polygonal cells with an open vesicular nucleus is one of the characteristic features of decidualization (7). These findings suggest that endometrial epithelial and stromal cells are important in implantation and decidualization. Furthermore, a previous study demonstrated that epithelial STAT3 controlled stromal function via a paracrine mechanism (8), indicating that there is epithelial-stromal crosstalk during implantation.

Implantation marks a transition stage in pregnancy, in which the blastocyst assumes a fixed position and establishes an altered physiological interaction with the uterus. The paracrine effects of uNK cells stimulate stromal fibroblasts to produce chemokines and cytokines, which support trophoblast migration during implantation. They also upregulate interleukin (IL)-15 and IL-15Rα in stromal fibroblasts that may establish an environment for uNK cells to promote cell proliferation and recruitment into the uterus (9). There is strong evidence that implantation and early pregnancy are not a single event, and do not occur simultaneously (10). Thus, in order to investigate the effects of uNK cell paracrine signaling on these processes as a whole, a co-culture system consisting of epithelial and stromal cells was created. Furthermore, the regulation of trophoblast invasion and modification of the spiral arteries, was investigated (11).

Materials and methods

Ethical approval

All subjects understood and signed the informed consent form prior to participation. Experimental protocols were approved by the Ethics Committee of the Dongfang Hospital Human Ethics Committee, Beijing, China (no. 2011090201).

Tissue collection

Decidual tissues were obtained from ten healthy females undergoing an elective termination of a normal pregnancy at between seven and eight weeks of gestation, as determined by the last menstrual period.

Endometrial tissues were collected from biopsies taken during the proliferative phase of the menstrual cycle of females undergoing laparoscopy for benign disease (Dongfang Hospital of Beijing University of Chinese Medicine, Beijing, China). The exclusion criteria were hormonal stimulation, cancerous lesions and irregular menstrual bleeding. There were six volunteers and two endometrial biopsies per volunteer were obtained. Samples from three of the females (six biopsies) were used for the for microarray experiments and samples from the remaining three females (six biopsies) were used for the reverse transcription-quantitative polymerase chain reaction and enzyme-linked immunosorbent assay experiments. Of the two samples taken from each patient, one sample was used as a control and the other was used in the experimental group.

uNK cell isolation

uNK cells were purified as previously described (2). Briefly, decidual tissues were thoroughly washed with Ca2+- and Mg2+-free Hank’s balanced salt solution (HBSS) containing 100 U/ml penicillin and 100 g/ml streptomycin (Sigma-Aldrich, St. Louis, MO, USA), cut into fragments of 1–2 mm3 using two scalpels and digested for 1 h at 37°C with gentle agitation in HBSS with 0.1% (w/v) collagenase I (Gibco-BRL, Carlsbad, CA, USA). Cell suspensions were layered over Ficoll-Hypaque medium (General Electric, Fairfield, CT, USA) and centrifuged at 800 × g for 25 min. Cells at the interface were washed twice in RPMI-1640 media with 10% fetal calf serum (FCS) and antibiotics. Following incubation for 20 min at 4°C with anti-CD56 micro beads (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany), cells were washed in washing buffer [phosphate-buffered saline (PBS), EDTA 2 mM and 0.5% bovine serum albumin(w/v)] and loaded onto a manual cell separation (MS) column in a MiniMACS magnet (MiniMACSTM Separator System; Miltenyi Biotec GmbH). The MS column was flushed three times and CD56+ cells were flushed according to the manufacturer’s instructions. The purity of the uNK cells was >90% CD56+CD3− according to flow cytometric analysis. The uNK cells were cultured in RPMI-1640 media with 1% FCS and 10 ng/ml IL-15 (R&D Systems Inc., Minneapolis, MN, USA).

uNK cell-secretion medium production

uNK cell-secretion medium was prepared using 200 μl RPMI-1640 media with 1% FCS and IL-15 (10 ng/ml) containing 5×105 of the purified uNK cells and placed into the upper chamber of a 0.4-μm pore hanging cell culture insert (EMD Millipore, Billerica, MA, USA) in a 24-well tissue plate, with 1,300 μl of the same media excluding cells in the lower chamber. Germeyer et al (9) showed that soluble factors from uterine leucocytes had significant effects on endometrial cell gene expression. Thus, a hanging cell culture insert was used so that soluble molecules from the uNK cells were able pass through the filter into the lower chamber, without cells being in direct contact. The control medium comprised 1,500 μl RPMI-1640 media with 1% FCS and 10 ng/ml IL-15. This was used for subsequent experiments. Following incubation for 24 h at 37°C, the uNK cell-secretion medium from the lower chamber and the control media were collected. To reduce interassay variability, the media from several batches was pooled for subsequent experiments and frozen at −80°C. Cells in the upper chamber were collected and the cell viability was measured using a live/dead viability kit (Invitrogen Life Technologies, Carlsbad, CA, USA). Only uNK cell samples containing <35% of dead cells following overnight incubation were used for subsequent experiments.

Endometrial stromal and epithelial cell isolation

Human endometrial tissue was dissociated into single cells using 0.1% (w/v) collagenase I (Life Technologies, Carlsbad, CA, USA) for 50–60 min at 37°C. Cell suspensions were filtered using a 40-μm sieve to separate undigested myometrial tissue and debris. Further dissociation of the filtrate was prevented by Dulbecco’s modified Eagle’s medium (DMEM)/F-12 (no Phenol Red; Gibco-BRL) with 10% FBS (Gibco-BRL). To remove erythrocytes, the cells were resuspended in 4 ml DMEM/F12 with 1% FCS, layered over Ficoll-Paque PLUS (General Electric) and centrifuged for 25 min at 800 × g. Endometrial cells were removed from the Ficoll-Paque PLUS medium interface, washed three times and resuspended in 1 ml DMEM/F12 with 1% FCS. Leukocytes were removed with CD45-coated Dynabeads (Invitrogen Life Technologies). Purified stromal and epithelial cell suspensions were then obtained by a further round of magnetic bead sorting using Collection Epithelial Enrich Dynabeads (Invitrogen Life Technologies). Epithelial and stromal cell preparations were >95% pure.

Stromal cells were cultured in DMEM/F12 with 10% FBS and an antibiotic-antimycotic agent (100 U/ml penicillin, 100 g/ml streptomycin, 10 μg/ml gentamicin 0.25 μg/ml amphotericin B; Life Technologies). Epithelial cells were cultured in serum-free bronchial epithelial cell growth medium (final volumes: 2 ml bovine pituitary extract, 0.5 ml insulin, 0.5 ml HC, 0.5 ml GA-1000, 0.5 ml retinoic acid, 0.5 ml transferrin, 0.5 ml triiodothyronine, 0.5 ml epinephrine and 0.5 ml hEGF; Lonza, Walkersville, MD, USA) and an antibiotic-antimycotic agent. The isolated stromal and epithelial cells were separately seeded into six-well plates with 3 ml culture medium per well. Each well contained stromal or epithelial cells from a single patient. After two weeks, cells were passaged into 25 cm2 cell culture flasks. Following this, stromal cells were passaged every 4–5 days and epithelial cells were passaged every 9–10 days.

Co-culture system

On day 20 following endometrial stromal and epithelial cell generation, cells of each type were seeded onto a Nunc UpCell Surface membrane (Thermo Labsystems, Santa Rosa, CA, USA). The co-culture system was built on these temperature-responsive cell culture surfaces, according to the manufacturer’s instructions. In brief, when cells reached 80% confluence, all medium was aspirated and 500 μl fresh medium was added. The membrane was then placed on top of the stromal cell layer. The Nunc UpCell Surface was maintained at 20°C for 13 min. The membrane and cell layer were then carefully removed from the Nunc UpCell Surface using forceps. The membrane with the attached cell layer was transferred facing downwards onto the epithelial cell surface. Fresh medium was added and samples were incubated at 37°C for 40 min. A further 1 ml of medium was added to the top of the membrane and the membrane was withdrawn from the cell layer. The ratio of stromal to epithelial cells was 1:1, and every co-culture system was built using stromal and epithelial cells from the same participant. Co-cultured cells were maintained in DMEM/F12 with 1% FCS.

Co-culture system treatment

Each group, control and uNK cell, contained six co-culture systems. All the groups were washed twice with PBS and placed in serum-free DMEM for 16 h prior to subsequent experiments. DMEM was replaced by 80% uNK cell-secretion medium and 20% DMEM in the uNK cell group, whilst the control group was treated with 80% control medium and 20% DMEM. Following incubation for 6 h, the cells and media from each group were collected. Three pairs of co-culture systems were used for the microarray studies and three pairs for the RT-qPCR experiments.

Microarray experiments

Total RNA was extracted from the endometrial cells in each co-culture system. RNA was purified with the RNeasy Mini kit (Qiagen, Hilden, Germany), according to the manufacturer’s instructions. The microarray analysis was performed using the GeneChip® 3′ IVT Express kit (Affymetrix Inc., Santa Clara, CA, USA). Briefly, total RNA underwent reverse transcription, first strand cDNA synthesis, double strand DNA, in vitro transcription, cRNA synthesis and fragmentation (12). Samples were hybridized onto GeneChip PrimeView Human Gene Expression Array (Affymetrix Inc.). This array covers >36,000 transcripts and variants. Following 16 h hybridization at 45°C, arrays were washed on Fluidics Station 450 (Affymetrix, Inc.) and were scanned with Scanner 3000 (Affymetrix, Inc.) in order to obtain quantitative gene expression levels. The control and uNK cell groups were processed simultaneously throughout. Three chips were analyzed for each group.

RT-qPCR analysis

A total of four differentially expressed genes were selected for validation of the results from the microarray experiments using RT-qPCR. Cells from the control and uNK cell groups were washed twice with PBS, and total RNA was extracted using TRIzol (Life Technologies). Reverse transcription was performed with 8 μl of total RNA per 20 μl reaction using a standard cDNA Synthesis kit (Takara Bio, Inc., Otsu, Japan). The RT-qPCR primer sequences for target genes were self-designed by this group and ordered from Invitrogen. Primer sequences for target genes are shown in Table I.

Table I

Sequences of primers for reverse transcription-quantitative polymerase chain reaction.

Table I

Sequences of primers for reverse transcription-quantitative polymerase chain reaction.

GenePrimer sequence 5′g3′Length (bases)Amplicon (bp)
CXCL10F: CTTTCTGACTCTAAGTGGCATTC23176
R: CACCCTTCTTTTTCATTGTAGCAA24
CXCL11F: TATTACTATCTGTGGTTACGGTGGAG26269
R: GCACTTTTGCCAGTATCCCAT21
IL-15F: TGGCTGCTGGAAACCC16123
R:CACAAGTAGCACTGGATGGAAAT23
SAMD9LF: GCCTTATCTCCACCTGTTTCTTAG24300
R: TGGGATGGCATTCCTTGAC19
GAPDHF: GAGCCAAAAGGGTCATCATCT21231
R: AGGGGCCATCCACAGTCTTC20

[i] F, forward; R, reverse; CXCL, chemokine (C-X-C) motif ligand; IL-15, interleukin-15; SAMD9L, sterile α motif domain containing 9-like.

For each RT-qPCR experiment, the typical thermal cycling conditions included an initial activation step at 95°C for 5 min, 40 cycles at 95°C each for 30 sec, 56°C for 20 sec and 72°C for 30 sec. PCR reactions were performed on ABI Prism 7700 Sequence Detection system (Applied Biosystems Life Technologies, Foster City, CA, USA). cDNA concentration was normalized to that of GAPDH. The target mRNA expression was analyzed using the 2−ΔΔCt algorithm.

ELISA experiments

IL-15 was analyzed using a commercially available ELISA kit (ELH-IL-15, RayBiotech, China) in the uNK cell-secretion medium prior to its use in the co-culture system experiments and in supernatants of the co-culture systems that had been treated with control media or with uNK cell-secretion medium. The analysis was conducted according to the manufacturer’s instructions. Assays were performed in triplicate and concentrations of IL-15 (pg/ml) were compared with standard curves. To determine the quantities of IL-15 secreted by the co-culture systems, the starting IL-15 content of the uNK cell-secretion medium was subtracted. The sensitivity of the kit was 10 pg/ml.

Statistical analysis

Data were analyzed using analysis of variance using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). In the microarray experiments, median fold change ratios between the control and uNK cell groups were derived for each transcript, and genes that were up- or downregulated with a fold change >1 and P<0.001 were selected. In RT-qPCR and ELISA analysis, data are presented as the median ± standard error of the mean. P<0.01 was considered to indicate a statistically significant difference. Graphs of the data were produced using Microsoft Excel software.

Results

Microarray experiments

Gene expression profiling using a microarray was used to compare transcript expression in the endometrial co-culture systems treated with either control medium or uNK cell-secretion medium.

This analysis identified 155 upregulated genes that exhibited a change of >2-fold in the median expression level in response to uNK cell-secretion medium. No transcript was downregulated >2-fold (Table II). However, certain genes in uNK cell groups were upregulated with a 1.0–2.0-fold change, compared with the control group. Previous studies have shown that these genes have an important functions in uNK cells. For instance, the co-culture system treated with uNK cell-secretion medium showed increased expression of interleukin (IL)15RA (1.6-fold) (13), vascular endothelial growth factor (VEGF)-C (1.35-fold) (14), intercellular adhesion molucule (ICAM) 1 (1.66-fold) (15), superoxide dismutase (SOD)2 (1.09-fold), caspase (CASP)1 (1.85-fold), nuclear factor erythroid 2-related factor 3 (NFE2L3) (1.37-fold), interferon γ receptor 1 (IFNGR1; 1.10-fold) (16), major histocompatibility complex (MHC) class I polypeptide-related sequence A (1.12-fold) and MHC class I polypeptide-related sequence B (1.34-fold) (3,17) and showed decreased expression of IGFBP3 (1.04-fold) (P<0.001).

Table II

Upregulated transcripts altered >2-fold.

Table II

Upregulated transcripts altered >2-fold.

GeneFold changeGene IDDescription
Cytokines/ Chemokines
 CXCL1011.13627Chemokine (C-X-C motif) ligand 10
 CXCL114.26373Chemokine (C-X-C motif) ligand 11
 IL-152.63600Interleukin 15
 IL-72.13574Interleukin 7
Immunological factors
 NLRC53.884166NLR family, CARD domain containing 5
 FAM111A3.463901Family with sequence similarity 111, member A
 ACTR22.610097ARP2 actin-related protein 2 homolog (yeast)
 HSPH12.210808Heat shock protein 1
 IFIT52.224138Interferon-induced protein with tetratricopeptide repeats 5
 UVRAG2.17405UV radiation resistance associated gene
Apoptotic protein
 RASSF62.2166824Ras association (RalGDS/AF-6) domain family member 6
Tryptophan metabolism
 IDO13.63620Indoleamine 2,3-dioxygenase 1
Signaling factors
 GBP23.22634Guanylate binding protein 2, interferon-inducible
 UACA3.155075Uveal autoantigen with coiled-coil domains and ankyrin repeats
 IFIT32.83437Interferon-induced protein with tetratricopeptide repeats 3
 ALCAM2.8214Activated leukocyte cell adhesion molecule
 CGA2.61081Glycoprotein hormones, α polypeptide
 EDNRA2.51909Endothelin receptor type A
 WASF22.210163WAS protein family, member 2
 IL6ST2.13572Interleukin 6 signal transducer
 USP152.19958Ubiquitin specific peptidase 15
 MIER12.157708Mesoderm induction early response 1 homolog
 RGS122.06002Regulator of G-protein signaling 12
Transcription
 STAT13.76772Signal transducer and activator of transcription 1
 IRF13.63659Interferon regulatory factor 1
 IRF93.210379Interferon regulatory factor 9
 IFI163.23428Interferon, γ-inducible protein 16
 ATRX3.1546Alpha thalassemia/mental retardation syndrome X-linked
 TCERG12.510915Transcription elongation regulator 1
 ZNF6442.484146Zinc finger protein 644
 ZEB12.26935Zinc finger E-box binding homeobox 1
 SAFB22.19667Scaffold attachment factor B2
 PRDM22.17799PR domain containing 2
Nucleotide metabolism
 NUFIP23.057532Nuclear fragile X mental retardation protein interacting protein 2
 PAPOLA2.257532Poly(A) polymerase alpha
 EIF4G12.310914Eukaryotic translation initiation factor 4γ, 1
 CRCP2.51981CGRP receptor component
 AGGF12.627297Angiogenic factor with G patch and FHA domains 1
 XRN22.1551095′-3′ exoribonuclease 2
Enzyme activity
 GBP46.8115361Guanylate binding protein 4
 GBP54.8115362Guanylate binding protein 5
 INPP4B4.88821Inositol polyphosphate-4-phosphatase, type II
 GBP74.7388646Guanylate binding protein 7
 SETD24.229072SET domain containing 2
 GBP13.92633Guanylate binding protein 1
 PSMB93.35698Proteasome (prosome, macropain) subunit, β type, 9
 WASL3.38976Wiskott-Aldrich syndrome-like
 PUS7L3.083448Pseudouridylate synthase 7 homolog-like
 C1R2.9715Complement component 1
 TAP12.86890Transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)
 FAF22.723197Fas associated factor family member 2
 UBE2L62.79246 Ubiquitin-conjugating enzyme E2L 6
 PARP142.754625Poly (ADP-ribose) polymerase family, member 14
 PARP92.783666Poly (ADP-ribose) polymerase family, member 9
 PSME42.523198Proteasome (prosome, macropain) activator subunit 4
 OTUD42.554726OTU domain containing 4
 BIRC62.457448Baculoviral IAP repeat containing 6
 ARHGAP212.457584Rho GTPase activating protein 21
 DTX3L2.4151636Deltex 3-like
 RARRES32.35920Retinoic acid receptor responder 3
 MGEA52.310724Meningioma expressed antigen 5
 DCAF82.350717DDB1 and CUL4 associated factor 8
 GPD22.32820 Glycerol-3-phosphate dehydrogenase 2
 UHMK12.3127933U2AF homology motif (UHM) kinase 1
 PDP12.254704Pyruvate dehyrogenase phosphatase catalytic subunit 1
 USP102.29100Ubiquitin specific peptidase 10
 COIL2.28161Coilin
 UFL12.223376UFM1-specific ligase 1
 USP12.17398Ubiquitin specific peptidase 1
 G2E32.155632G2/M-phase specific E3 ubiquitin protein ligase
 NF12.04763Neurofibromin 1
 PHACTR22.09749Phosphatase and actin regulator 2
Transporters
 TPR4.47175Translocated promoter region, nuclear basket protein
 APOL63.280830Apolipoprotein L, 6
 GCC22.89648GRIP and coiled-coil domain containing 2
 APOL32.480833Apolipoprotein L, 3
 CPNE32.48895Copine III
 USO12.28615USO1 vesicle docking protein homolog
 SLC38A12.281539Solute carrier family 38, member 1
 NIPAL12.1152519NIPA-like domain containing 1
 KIAA10332.123325KIAA1033
 NUPL12.19818Nucleoporin like 1
Structural factors
 MIS18BP13.955320MIS18 binding protein 1
 CDC273.3996Cell division cycle 27 homolog
 CALD13.1800Caldesmon 1
 LIMA13.051474LIM domain and actin binding 1
 SLMAP2.77871Sarcolemma associated protein
 TLN12.77094Talin 1
 EZR2.57430Ezrin
 ITGB12.53688Integrin, β1
 APPL12.526060Adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
 RTP42.564108Receptor (chemosensory) transporter protein 4
 WAPAL2.423063Wings apart-like homolog
 PRRC2C2.423215Proline-rich coiled-coil 2C
 CASC52.457082Cancer susceptibility candidate 5
 ENC12.38507Ectodermal-neural cortex 1
 KIF142.29928Kinesin family member 14
 SPTBN12.26711Spectrin, β, non-erythrocytic 1
 MYO62.24646Myosin VI
 ODF2L2.157489Outer dense fiber of sperm tails 2-like
 DYNC1H12.11778Dynein, cytoplasmic 1, heavy chain
 PPP4R22.1151987Protein phosphatase 4, regulatory subunit 2
 SRPR2.06734Signal recognition particle receptor
Kinase
 WNK14.065125WNK lysine deficient protein kinase 1
 PRKDC3.55591Protein kinase, DNA-activated, catalytic polypeptide
 IQGAP13.08826IQ motif containing GTPase activating protein 1
 CMPK22.8129607Cytidine monophosphate (UMP-CMP) kinase 2, mitochondrial
 BAZ1B2.79031Bromodomain adjacent to zinc finger domain, 1B
 CCND22.6894Cyclin D2
 MOB1A2.555233MOB kinase activator 1A
 MAP4K52.511183Mitogen-activated protein kinase kinase kinase kinase 5
Ion binding proteins
 DSC24.51824Desmocollin 2
 EEA14.28411Early endosome antigen 1
 ZC3H11A3.39877Zinc finger CCCH-type containing 11A
 CLSTN12.822883Calsyntenin 1
 C1S2.7716Complement component 1, s subcomponent
 THAP62.6152815THAP domain containing 6
 RSAD22.591543Radical S-adenosyl methionine domain containing 2
 ZNFX12.357169Zinc finger, NFX1-type containing 1
 PLCB42.25332Phospholipase C, β4
 TIPARP2.225976TCDD-inducible poly(ADP-ribose) polymerase
 WDFY12.157590WD repeat and FYVE domain containing 1
 CHURC12.191612Churchill domain containing 1
 ITGA42.13676Integrin, α4
 XAF12.154739XIAP associated factor 1
DNA/RNA proteins
 ZFR4.451663Zinc finger RNA binding protein
 TOP14.27150Topoisomerase (DNA) I
 BOD1L13.4259282Biorientation of chromosomes in cell division 1-like 1
 IFIT23.33433Interferon-induced protein with tetratricopeptide repeats 2
 CENPF3.11063Centromere protein F, 350/400 kDa (mitosin)
 MBNL13.04154Muscleblind-like splicing regulator 1
 DHX92.41660DEAH (Asp-Glu-Ala-His) box polypeptide 9
 FMR12.42332Fragile X mental retardation 1
 DDX582.323586DEAD (Asp-Glu-Ala-Asp) box polypeptide 58
 BCLAF12.39774BCL2-associated transcription factor 1
 DNMT12.21786DNA (cytosine-5-)-methyltransferase 1
 NOL82.255035Nucleolar protein 8
 RNF2132.257674Ring finger protein 213
 BDP12.255814B double prime 1
 RAD212.25885RAD21 homolog
 HP1BP32.150809Heterochromatin protein 1, binding protein 3
 SF3B12.023451Splicing factor 3b, subunit 1
Other
 SAMD9L5.7219285Sterile α motif domain containing 9-like
 C10orf1185.555088Chromosome 10 open reading frame 118
 MTUS12.757509Microtubule associated tumor suppressor 1
 EPSTI12.694240Epithelial stromal interaction 1
 ATXN7L3B2.6552889Ataxin 7-like 3B
 ANKRD322.584250Ankyrin repeat domain 32
 EHBP12.423301EH domain binding protein 1
 PPFIBP12.48496PTPRF interacting protein, binding protein 1 (liprin β1)
 TMTC32.3160418Transmembrane and tetratricopeptide repeat containing 3
 CEP3502.29857Centrosomal protein 350 kDa
 BTBD102.284280BTB (POZ) domain containing 10
 BTN3A32.110384Butyrophilin, subfamily 3, member A3
 KCTD92.154793Potassium channel tetramerisation domain containing 9

[i] Gene transcription in co-culture systems following stimulation with uNK cell-secretion medium using a GeneChip PrimeView Human Gene Expression Array. P<0.001, compared with control group. Upregulated genes: 155 transcripts. uNK, uterine natural killer cells.

RT-qPCR analysis

In order to verify these changes, transcript levels for certain genes were measured by RT-qPCR, including chemokine (C-X-C) motif ligand (CXCL)10, CXCL11, IL-15 and sterile α motif domain containing 9-like (SAMD9L; Fig. 1). The RT-qPCR results confirmed the significant changes in expression that had been indicated by the microarray analysis. The endometrial co-culture system treated with uNK cell-secretion medium showed increased expression of CXCL10 (16.4-fold), CXCL11 (4.3-fold), IL-15 (3.1-fold) and SAMD9L (5.4-fold; P<0.01).

Figure 1

Transcript levels of CXCL10, CXCL11, IL-15 and SAMD9L determined by RT-qPCR. The RT-qPCR results were consistent with those of the microarray analysis. Data are expressed as the mean ± standard error of the mean. *P<0.01, compared with the control group. uNK, uterine natural killer cells; CXCL, chemokine (C-X-C) motif ligand; IL-15, interleukin 15; SAMD9L, sterile α motif domain containing 9-like; RT-qPCR, reverse transcription-quantitative polymerase chain reaction.

ELISA experiments

To confirm the observed changes in the IL-15 protein level, the quantity of IL-15 was analyzed by ELISA in the supernatant of the control and uNK cell-secretion medium-stimulated endometrial co-culture systems. There was a significant increase in IL-15 protein levels in the experimental groups compared with the control group (Fig. 2; P<0.01).

Figure 2

IL-15 levels in control and uNK groups. An enzyme-linked immunosorbent assay was used to measure IL-15 levels in supernatants from co-culture systems treated for 6 h with conditioned medium from decidual uNK cells or with control medium. Data are presented as the mean ±standard error of the mean. Values were corrected for the quantity of IL-15 detected in the control and uNK cell-secretion medium prior to addition to the co-culture systems. *P<0.01, compared with the control group. IL-15, interleukin 15; uNK, uterine natural killer cells.

Discussion

Several observations suggest that uNK cells are involved in reproduction. They increase in number during the luteal period of the menstrual cycle when implantation occurs (1). They are present in the early phases of gestation, when placental cells invade into the maternal arteries (18). In addition, they are particularly abundant in the area surrounding the infiltrating fetally derived extravillous cells (19). During the progesterone-dominated phase of the menstrual cycle, uNK cells show changes in the levels of transcripts for VEGF-C (20). Previous protein array studies have shown that uNK cells are the predominant producers of angiogenic growth factors in early pregnancy (21). In addition, in an ex vivo chorionic plate artery model, uNK cells promoted vessel-like assembly of extravillous cytotrophoblast cell lines (15,22). Insufficient uNK cell activation may reduce these processes and contribute to poor arterial remodeling in decidua, thus increasing the risk of preeclampsia and intrauterine fetal growth restriction (23).

In humans, CD56+ NK cells are associated with the synthesis of immunoregulatory cytokines, particularly IFN-γ (24). IFN-γ significantly upregulates certain chemokines [CXCL9, CXCL10, chemokine (C-C motif) ligand 8 and IL-15Rα], enzymes [guanylate binding protein 5, transporter associated with antigen processing (TAP1), SOD2 and CASP1] and transcription factors (interferon regulatory factor 1, NFE2L3 and transcription factor AP-2 γ). It is also known to downregulate insulin-like growth factor binding proteins (Wnt1 inducible signaling pathway 2 and insulin-like growth factor-binding protein 3) (16). These actions, combined with the uNK cell production of chemokines CXCL10 and CXCR2, direct the migration and invasion of trophoblasts (25) and promote angiogenesis in the placental bed (26,27). The present study found similar changes in gene expression, for example, IFNGR1 transcript levels were significantly increased in co-culture systems stimulated by uNK cell-secretion medium. This concordance strongly suggests that uNK cell paracrine signaling, combined with INF-γ, regulates the expression of genes involved in embryo and trophoblast migration, endometrial decidualization and angiogenesis in human uterine endometrium.

Implantation-associated decidualization in the rat and mouse results in the accumulation of NK cells in the uterine mesometrial decidua (28). uNK cells are hypothesized to be involved in pregnancy-associated uterine vascular development (20). However, it is not clear how uNK cells communicate with the developing endometrial cells in order to facilitate this process. Previous in vitro experimentation has indicated that uNK cells produce factors that directly affect the behavior of trophoblast cells (25). A number of studies have suggested that uNK cell supernatant stimulate trophoblast invasion (29), whereas others have concluded that it is the uNK cell supernatants that stimulate these process (20). The results of the current study indicate that the paracrine effects of uNK cells on endometrial epithelial and stromal cells mediate the development of the vasculature. Levels of ICAM-1, which is involved the migration and network formation of the trophoblast cell line (15), increased significantly in this study. Thus, it is likely that ICAM-1 is involved in this paracrine network.

Although replete with cytotoxic machinery, uNK cells remain tolerant at the maternal-fetal interface (26). A previous indicated that this is facilitated by VEGF-C (30), and in vitro studies have also suggested that the involvement of IL-15 is important in promoting this tolerance (17). In addition, the non-cytotoxic capacity of uNK cells is based on their ability to recognize surface MHC class I molecules on target cells, which deliver signals that suppress NK cell function. A number of studies have suggested that a lack of engagement of MHC-specific receptors leads to NK cell-mediated killing (17,31). The results from this study showed that there was an increased expression of VEGF-C, IL-15 and MHC class I polypeptide-related sequence A/B in the co-culture systems that were treated with uNK cell-secretion medium compared with the control group, indicating similar non-cytotoxic mechanism to those already postulated. Furthermore, there is evidence that endothelial cells exhibit sensitivity to activated peripheral blood NK cells in the absence of the expression of TAP1 (32), as TAP-1 is a key factor essential for peptide loading for MHC class I assembly (33). It is proposed that VEGF-C is the predominant regulator of TAP1 expression in the uterus (30), and the present study showed higher TAP1 expression in the uNK cell group. These findings support a dual function of VEGF-C, in which it acts as an angiogenic factor and also promotes immune tolerance in the uterine microenvironment. To the best of our knowledge, this is the first evidence that noncytotoxicity of uNK cells is directly coupled to their vascular remodeling and angiogenesis functions.

The origins of human uNK cells are not clear, and a number of mechanisms have been postulated (34–36). Several of the molecules that were altered by uNK cell-secretion medium in this study are known to have important functions in NK cell proliferation, including IL-15 and IL-15Rα. IL-15 has a variety of functions, including the induction of T cell proliferation and the activation of cytotoxic effector cells and monocytes (37,38). The reciprocal interactions between uNK cells and the epithelial/stromal cell co-culture system observed in this study are similar to those in bone marrow during NK cell development. NK cells upregulate IL-15 in the bone marrow microenvironment, which is then bound and presented by IL-15Rα to the stromal cell surface, promoting increased NK cell proliferation (39). These results suggest that this mechanism may occur in the endometrium in response to molecules secreted by uNK cells. The results suggest that uNK cells and non-decidualized stromal and epithelial cells may interact to maintain immune cell homeostasis in the endometrial microenvironment.

In conclusion, to the best of our knowledge, this is the first detailed study of the paracrine interaction between uNK cells and endometrial cells (epithelial/stromal cells). It indicates that this paracrine signaling may contribute to uNK cell proliferation and recruitment, embryo and trophoblast migration, endometrial decidualization, angiogenesis and immune tolerance in the uterine microenvironment.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (grant no. 81173292).

References

1 

King A, Wellings V, Gardner L and Loke YW: Immunocytochemical characterization of the unusual large granular lymphocytes in human endometrium throughout the menstrual cycle. Hum Immunol. 24:195–205. 1989. View Article : Google Scholar

2 

Verma S, Hiby SE, Loke YW and King A: Human decidual natural killer cells express the receptor for and respond to the cytokine interleukin 15. Biol Reprod. 62:959–968. 2000. View Article : Google Scholar : PubMed/NCBI

3 

Moffett A and Loke C: Immunology of placentation in eutherian mammals. Nat Rev Immunol. 6:584–594. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Parham P and Guethlein LA: Pregnancy immunogenetics: NK cell education in the womb? J Clin Invest. 120:3801–3804. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Carson DD, Wilson OF and Dutt A: Glycoconjugate expression and interactions at the cell surface of mouse uterineu epithelial cells and periimplantation-stage embryos. Trophoblast Invasion and Endometrial Receptivity. Springer; New York, NY, USA: pp. 211–241. 1990, View Article : Google Scholar

6 

Murphy CR and Shaw TJ: Plasma membrane transformation: a common response of uterine epithelial cells during the peri-implantation period. Cell Biol Int. 18:1115–1128. 1994. View Article : Google Scholar

7 

Inoue T, Kanzaki H, Iwai M, et al: Tumour necrosis factor alpha inhibits in-vitro decidualization of human endometrial stromal cells. Hum Reprod. 9:2411–2417. 1994.

8 

Pawar S, Starosvetsky E, Orvis GD, Behringer RR, Bagchi IC and Bagchi MK: STAT3 regulates uterine epithelial remodeling and epithelial-stromal crosstalk during implantation. Mol Endocrinol. 27:1996–2012. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Germeyer A, Sharkey AM, Prasadajudio M, et al: Paracrine effects of uterine leucocytes on gene expression of human uterine stromal fibroblasts. Mol Hum Reprod. 15:39–48. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Schlafke S and Enders AC: Cellular basis of interaction between trophoblast and uterus at implantation. Biol Reprod. 12:41–65. 1975. View Article : Google Scholar : PubMed/NCBI

11 

Hiby SE, Walker JJ, O’shaughnessy KM, et al: Combinations of maternal KIR and fetal HLA-C genes influence the risk of preeclampsia and reproductive success. J Exp Med. 200:957–965. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Gong X, Chen Z, Liu Y, Lu Q and Jin Z: Gene expression profiling of the paracrine effects of uterine natural killer cells on human endometrial epithelial cells. Int J Endocrinol. 2014:3937072014. View Article : Google Scholar

13 

Grabstein KH, Eisenman J, Shanebeck K, et al: Cloning of a T cell growth factor that interacts with the beta chain of the interleukin-2 receptor. Science. 264:965–968. 1994. View Article : Google Scholar : PubMed/NCBI

14 

Zhou Y, Bellingard V, Feng KT, McMaster M and Fisher SJ: Human cytotrophoblasts promote endothelial survival and vascular remodeling through secretion of Ang2, PlGF, and VEGF-C. Dev Biol. 263:114–125. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Hu Y, Eastabrook G, Tan R, MacCalman C, Dutz JP and von Dadelszen P: Decidual NK cell-derived conditioned medium enhances capillary tube and network organization in an extravillous cytotrophoblast cell line. Placenta. 31:213–221. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Kitaya K, Yasuo T, Yamaguchi T, Fushiki S and Honjo H: Genes regulated by interferon-γ in human uterine microvascular endothelial cells. Int J Mol Med. 20:689–697. 2007.

17 

Cooper MA, Fehniger TA and Caligiuri MA: The biology of human natural killer-cell subsets. Trends Immunol. 22:633–640. 2001. View Article : Google Scholar : PubMed/NCBI

18 

Bulmer J, Johnson P and Bulmer D: Leukocyte populations in human decidua and endometrium. Immunoregulation and Fetal Survival. Oxford University Press; Oxford, UK: pp. 111–134. 1987

19 

Loke Y: Human implantation: Cell Biology and Immunology. Cambridge University Press; Cambridge, UK: 1995

20 

Zhang J, Chen Z, Smith GN and Croy BA: Natural killer cell-triggered vascular transformation: maternal care before birth? Cell Mol Immunol. 8:1–11. 2011. View Article : Google Scholar : PubMed/NCBI

21 

Lash GE, Robson SC and Bulmer JN: Review: Functional role of uterine natural killer (uNK) cells in human early pregnancy decidua. Placenta. 31(Suppl): S87–S92. 2010. View Article : Google Scholar : PubMed/NCBI

22 

Hu Y, Dutz JP, MacCalman CD, Yong P, Tan R and von Dadelszen P: Decidual NK cells alter in vitro first trimester extravillous cytotrophoblast migration: a role for IFN-gamma. J Immunol. 177:8522–8530. 2006. View Article : Google Scholar : PubMed/NCBI

23 

Wegmann TG, Lin H, Guilbert L and Mosmann TR: Bidirectional cytokine interactions in the maternal-fetal relationship: is successful pregnancy a TH2 phenomenon? Immunol Today. 14:353–356. 1993. View Article : Google Scholar : PubMed/NCBI

24 

Ottaviani C, Nasorri F, Bedini C, de Pità O, Girolomoni G and Cavani A: CD56brightCD16(−) NK cells accumulate in psoriatic skin in response to CXCL10 and CCL5 and exacerbate skin inflammation. Eur J Immunol. 36:118–128. 2006.

25 

Hanna J, Goldman-Wohl D, Hamani Y, et al: Decidual NK cells regulate key developmental processes at the human fetal-maternal interface. Nat Med. 12:1065–1074. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Moffett-King A: Natural killer cells and pregnancy. Nat Rev Immunol. 2:656–663. 2002. View Article : Google Scholar

27 

Wang A, Rana S and Karumanchi SA: Preeclampsia: the role of angiogenic factors in its pathogenesis. Physiology (Bethesda). 24:147–158. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Ain R, Canham LN and Soares MJ: Gestation stage-dependent intrauterine trophoblast cell invasion in the rat and mouse: novel endocrine phenotype and regulation. Dev Biol. 260:176–190. 2003. View Article : Google Scholar

29 

Smith SD, Dunk CE, Aplin JD, Harris LK and Jones RL: Evidence for immune cell involvement in decidual spiral arteriole remodeling in early human pregnancy. Am J Pathol. 174:1959–1971. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Kalkunte SS, Mselle TF, Norris WE, Wira CR, Sentman CL and Sharma S: Vascular endothelial growth factor C facilitates immune tolerance and endovascular activity of human uterine NK cells at the maternal-fetal interface. J Immunol. 182:4085–4092. 2009. View Article : Google Scholar

31 

Riley JK and Yokoyama WM: NK cell tolerance and the maternal-fetal interface. Am J Reprod Immunol. 59:371–387. 2008. View Article : Google Scholar : PubMed/NCBI

32 

Ayalon O, Hughes EA, Cresswell P, et al: Induction of transporter associated with antigen processing by interferon gamma confers endothelial cell cytoprotection against natural killer-mediated lysis. Proc Natl Acad Sci USA. 95:2435–2440. 1998. View Article : Google Scholar

33 

Cox JH, Yewdell JW, Eisenlohr LC, Johnson PR and Bennink JR: Antigen presentation requires transport of MHC class I molecules from the endoplasmic reticulum. Science. 247:715–718. 1990. View Article : Google Scholar : PubMed/NCBI

34 

Vosshenrich CA, García-Ojeda ME, Samson-Villéger SI, et al: A thymic pathway of mouse natural killer cell development characterized by expression of GATA-3 and CD127. Nat Immunol. 7:1217–1224. 2006. View Article : Google Scholar : PubMed/NCBI

35 

van den Heuvel M, Peralta C, Bashar S, Taylor S, Horrocks J and Croy BA: Trafficking of peripheral blood CD56(bright) cells to the decidualizing uterus - new tricks for old dogmas? J Reprod Immunol. 67:21–34. 2005.PubMed/NCBI

36 

Gargett CE, Schwab KE, Zillwood RM, Nguyen HP and Wu D: Isolation and culture of epithelial progenitors and mesenchymal stem cells from human endometrium. Biol Reprod. 80:1136–1145. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Carson WE, Giri JG, Lindemann MJ, et al: Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor. J Exp Med. 180:1395–1403. 1994. View Article : Google Scholar : PubMed/NCBI

38 

Waldmann T and Tagaya Y: The multifaceted regulation of interleukin-15 expression and the role of this cytokine in NK cell differentiation and host response to intracellular pathogens. Annu Rev Immunol. 17:19–49. 1999. View Article : Google Scholar

39 

Iizuka K, Chaplin DD, Wang Y, et al: Requirement for membrane lymphotoxin in natural killer cell development. Proc Natl Acad Sci USA. 96:6336–6340. 1999. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gong X, Liu Y, Chen Z, Xu C, Lu Q and Jin Z: Insights into the paracrine effects of uterine natural killer cells. Mol Med Rep 10: 2851-2860, 2014.
APA
Gong, X., Liu, Y., Chen, Z., Xu, C., Lu, Q., & Jin, Z. (2014). Insights into the paracrine effects of uterine natural killer cells. Molecular Medicine Reports, 10, 2851-2860. https://doi.org/10.3892/mmr.2014.2626
MLA
Gong, X., Liu, Y., Chen, Z., Xu, C., Lu, Q., Jin, Z."Insights into the paracrine effects of uterine natural killer cells". Molecular Medicine Reports 10.6 (2014): 2851-2860.
Chicago
Gong, X., Liu, Y., Chen, Z., Xu, C., Lu, Q., Jin, Z."Insights into the paracrine effects of uterine natural killer cells". Molecular Medicine Reports 10, no. 6 (2014): 2851-2860. https://doi.org/10.3892/mmr.2014.2626
Copy and paste a formatted citation
x
Spandidos Publications style
Gong X, Liu Y, Chen Z, Xu C, Lu Q and Jin Z: Insights into the paracrine effects of uterine natural killer cells. Mol Med Rep 10: 2851-2860, 2014.
APA
Gong, X., Liu, Y., Chen, Z., Xu, C., Lu, Q., & Jin, Z. (2014). Insights into the paracrine effects of uterine natural killer cells. Molecular Medicine Reports, 10, 2851-2860. https://doi.org/10.3892/mmr.2014.2626
MLA
Gong, X., Liu, Y., Chen, Z., Xu, C., Lu, Q., Jin, Z."Insights into the paracrine effects of uterine natural killer cells". Molecular Medicine Reports 10.6 (2014): 2851-2860.
Chicago
Gong, X., Liu, Y., Chen, Z., Xu, C., Lu, Q., Jin, Z."Insights into the paracrine effects of uterine natural killer cells". Molecular Medicine Reports 10, no. 6 (2014): 2851-2860. https://doi.org/10.3892/mmr.2014.2626
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team