Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2015 Volume 12 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2015 Volume 12 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer

  • Authors:
    • Weipeng Lu
    • Hong Wei
    • Mei Li
    • Hai Wang
    • Lina Liu
    • Qiuping Zhang
    • Lisha Liu
    • Shen Lu
  • View Affiliations / Copyright

    Affiliations: Laboratory Center, The Second Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116000, P.R. China, Department of Pathology, The Third People's Hospital of Dalian, Dalian, Liaoning 116000, P.R. China, Department of Gastroenterology, The First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116000, P.R. China, Department of Pathology, The First Affiliated Hospital of Dalian Medical University, Dalian, Liaoning 116000, P.R. China
  • Pages: 1219-1224
    |
    Published online on: March 23, 2015
       https://doi.org/10.3892/mmr.2015.3530
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Cetuximab, an immunoglobulin G1 chimeric monoclonal antibody directed against the epidermal growth factor receptor, is currently considered to be the strategy with the most potential for the treatment of gastric cancer due to the low frequency of KRAS mutations in patients with gastric cancer. However, the therapeutic success of cetuximab in colorectal cancer (CRC) has demonstrated that the clinical effect of cetuximab is closely dependent not only on KRAS mutations, but also BRAF and phosphoinositide‑3‑kinase, catalytic, α polypeptide (PIK3CA) mutations. In the present study, the status of KRAS, BRAF and PIK3CA mutations in gastric cancer were investigated concomitantly in order to aid the selection of patients eligible for treatment with cetuximab. Mutations in KRAS (exon 2), BRAF (exon 15) and PIK3CA (exon 9 and exon 20) were retrospectively evaluated by high resolution melting analysis and DNA direct sequencing in samples from 156 patients with gastric cancer. Mutations in either KRAS or PIK3CA were identified in 13 samples (8.3%), 7 samples with KRAS mutations and 6 samples with PIK3CA mutations. No mutations in the BRAF gene were identified. The frequency of mutations in either KRAS or PIK3CA were significantly higher in patients without lymph node metastasis than those with. Furthermore, KRAS and PIK3CA mutations were mutually exclusive. The present study, therefore, suggested that it may be necessary to evaluate KRAS and PIK3CA mutations concomitantly for the selection of patients eligible for treatment with cetuximab.

Introduction

Gastric cancer is one of the most common types of cancer globally, with a particularly high incidence in Northeast Asian countries, including China, Japan and Korea (1). The traditional therapeutic strategies for gastric cancer have failed to effectively treat the condition (2). In previous years, targeted therapies against the molecular variants specific to the carcinogenesis of various types of human cancer have been developed. However, the development of targeted therapies for gastric cancer lags behind other types of cancer. Trastuzumab, a monoclonal antibody against human epidermal growth factor receptor 2 (HER2) widely used for the treatment of breast cancer, has been approved for the treatment of patients with gastric cancer expressing HER2 based on the encouraging results of Trastuzumab for the treatment of gastric cancer (3). Gefitinib, an epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) successfully used for the treatment of non-small cell lung cancer with an EGFR mutation in exon 19 or 21, appears to be effective for certain patients with gastric cancer (4). Furthermore, EGFR mutations in exon 21 have been identified in patients with gastric cancer by a Portuguese research group and in our previous study (5,6). These findings indicate that certain patients with gastric cancer would benefit from TKIs. However, only a specific subpopulation of patients are able to benefit from treatment with trastuzumab or EGFR-TKIs.

Cetuximab, an immunoglobulin G1 chimeric monoclonal antibody directed against EGFR, exhibits anticancer effects by binding to the extracellular domain of EGFR with a higher affinity than the natural ligands of the receptor, inhibiting its dimerization and phosphorylation, and then blocking the downstream signaling transduction pathways, mainly KRAS/BRAF/mitogen activated protein kinase and phosphoinositide 3-kinase (PI3K)/AKT/mammalian target of rapamycin (7). Cetuximab was initially approved for the treatment of patients with colorectal cancer (CRC), particularly those with EGFR-positive tissue samples. Notably, it was reported that over half of all patients with gastric cancer expressed EGFR, suggesting that certain patients with gastric cancer may benefit from cetuximab treatment (8). Furthermore, cetuximab, either alone or in combination with various chemotherapeutic drugs, has been evaluated in clinical trials for the treatment of patients with gastric cancer (9–11). However, the majority of patients, including those with EGFR-positive tissue samples were not sensitive to cetuximab. The previous results appear to be conflicting. Therefore, it is hypothesized that certain factors may impair the sensitivity of patients with gastric cancer to cetuximab. Currently, cetuximab has been well demonstrated to be effective in patients with CRC without KRAS mutations as mutant KRAS with an elevated kinase activity would result in a continuously activated state, leading to a continuous and self-sufficient signaling transduction pathway, thus rendering cetuximab ineffective (12). Furthermore, it has been clearly demonstrated that mutations of other downstream effectors of EGFR, such as BRAF and PIK3CA, are also able to render cetuximab ineffective (13,14). Therefore, the evaluation of KRAS, BRAF and PIK3CA mutations in gastric cancer may aid the selection of patients eligible for treatment with cetuximab.

In previous years, KRAS mutations have been reported in gastric cancer with a frequency, ranging between 0 and 21% (15–18). However, the exact frequency of mutations in the KRAS gene and their association with clinicopatho-logical features of the patients remains to be elucidated. Although previous studies had considered BRAF mutations to be rare in gastric cancer, further studies are required to confirm this hypothesis as no more than ten studies have investigated the status of the BRAF mutation to date, to the best of our knowledge (18–25). In contrast to KRAS and BRAF mutations, a mutation in PIK3CA has been identified in gastric cancer with a relatively higher frequency between 4.3 and 25.0% (18,26–28). However, no definitive conclusion can be drawn regarding whether the PIK3CA mutation coexists with the KRAS mutation in gastric cancer.

Therefore, the previously mentioned data revealed that mutations in KRAS, BRAF and PIK3CA may be involved in gastric cancer. In addition, these variants were usually evaluated by different groups from different countries and data regarding comprehensive analysis of KRAS, BRAF and PIK3CA mutations in gastric cancer were limited. The aim of the present study was to evaluate concomitantly the status of KRAS, BRAF and PIK3CA mutations in 156 gastric cancer samples in order to aid the selection of patients eligible for treatment with cetuximab.

Patients and methods

Study population

A total of 156 gastric cancer samples [53 fresh-frozen and 103 formalin-fixed, paraffin-embedded (FFPE)] were collected from patients who underwent surgical resection at The First Affiliated Hospital of Dalian Medical University and The Third People’s Hospital of Dalian (Dalian, China). The present study was initiated with the approval of the ethics committee of The Second Affiliated Hospital of Dalian Medical University. Informed consent was obtained from patients prior to the collection of the samples. None of patients in the present study had received preoperative radio-or chemotherapy. The clinicopathological features of all patients were verified by two experienced pathologists (Table I).

Table I

Associations between gene mutations and clinicopathological features of patients.

Table I

Associations between gene mutations and clinicopathological features of patients.

Clinicopathological featureNo.KRAS
PIK3CA
KRAS/PIK3CA
MutationP-valueMutationP-valueMutationP-value
Gender110.956
 Male115549
 Female41224
Age (years)0.43910.385
 ≤6578235
 >6578538
Lymph node metastasis0.1310.3590.036
 Present116336
 Absent40437
Differentiation grade0.742a0.53a0.317a
 Well5112
 Moderate42224
 Poor92437
 MAC17000
Depth of invasion0.43310.296
 T14101
 T2–T41526612

a Well and Moderate vs. Poor and MAC. MAC, mucinous adenocarcinoma. PIK3CA, phosphoinositide-3-kinase, catalytic, α polypeptide.

DNA extraction

The DNA extraction of the 53 fresh-frozen samples has been previously completed by our group (17). Therefore, in the present study, DNA was only extracted from the 103 FFPF samples. An ~5-μm thick single section from each sample was selected for hematoxylin and eosin (H&E) staining. An experienced pathologist analyzed the H&E sections and marked the area containing at least 70% tumor cells. Subsequently, according to the marked area in the H&E section, the tumor tissue was dissected from eight sections of each FFPE sample and then genomic DNA was extracted using an FFPE DNA extraction kit (Omega Bio-Tek, Inc., Norcross, GA, USA) according to the manufacturer’s instructions.

Mutation analysis of KRAS (exon 2), BRAF (exon 15) and PIK3CA (exon 9 and 20)

The status of the KRAS (exon 2) mutation in the 53 fresh-frozen samples has been previously analyzed and reported by Liu et al (17). In the present study, the mutation status of KRAS (exon 2) in 103 FFPE tumor samples, and BRAF (exon 15) and PIK3CA (exon 9 and 20) in 156 tumor samples was screened using polymerase chain reaction-high resolution melting (PCR-HRM) analysis. PCR primers for KRAS, BRAF and PIK3CA are shown in Table II. The final PCR reaction mixture (10 μl) contained: i) KRAS exon 2: 1X PCR buffer, 200 μM dNTPs, 2.5 mM MgCl2, 1 μM each primer, 0.25 units HotStart Taq (Takara Bio Inc., Dalian, China), 5 ng genomic DNA and 1X LC Green Plus (Biofire Diagnostics, Salt Lake City, UT, USA); ii) BRAF exon 15 and PIK3CA exon 9: 1X PCR Buffer, 200 μM dNTPs, 2 mM MgCl2, 1 μM each primer, 0.25 units HotStart Taq, 5 ng genomic DNA and 1X LC Green Plus; iii) PIK3CA exon 20: 1X PCR Buffer, 200 μM dNTPs, 2.5 mM MgCl2, 0.5 μM each primer, 0.25 units HotStart Taq, 5 ng genomic DNA and 1X LC Green Plus. The PCR amplification conditions were as follows: i) KRAS exon 2: 95 °C for 10 min; 45 cycles of 95°C for 30 sec, 54°C for 10 sec and 72°C for 1 min; ii) BRAF exon 15 and PIK3CA exon 20: 95°C for 10 min; 45 cycles of 95°C for 30 sec, 56°C for 10 sec and 72°C for 30 sec; and iii) PIK3CA exon 9: 95°C for 10 min; 45 cycles of 95°C for 30 sec, 60°C for 10 sec and 72°C for 30 sec.

Table II

Primers for mutation analysis using polymerase chain reaction-high resolution melting.

Table II

Primers for mutation analysis using polymerase chain reaction-high resolution melting.

PrimerSequence (from 5′ to 3′)
KRAS exon 2Forward: AGGCCTGCTGAAAATGACTG
Reverse: TCAAAGAATGGTCCTGCACC
BRAF exon 15Forward: CTCTTCATAATGCTTGCTCTGATAGG
Reverse: TAGTAACTCAGCAGCATCTCAGG
PIK3CA exon 9Forward: CTAGCTAGAGACAATGAATTAAGGGAAA
Reverse: CATTTTAGCACTTACCTGTGACTCCA
PIK3CA exon 20Forward: TGAGCAAGAGGCTTTGGAGT
Reverse: TCATTTTCTCAGTTATCTTTTCAGTTCAAT

[i] PIK3CA, phosphoinositide-3-kinase, catalytic, α polypeptide.

DNA sequencing

The PCR product was purified using the GeneJET™ gel extraction kit (Thermo Fisher Scientific, Rockford, IL, USA) according to the manufacturer’s instructions and then sequenced on an ABI Prism 3730 sequence detection system (Takara Bio, Inc.). A 173 bp amplicon was generated by sequencing primers of KRAS exon 2 following the same method as the PCR-HRM primers above. A 124 bp amplicon was generated by sequencing primers of PIK3CA exon 9, forward: 5′-GTAACAGACTAGCTAGAG-3′ and reverse: 5′-CTGTGACTCCATAGAAAATC-3′. A 158 bp amplicon was generated by sequencing primers of PIK3CA exon 20, forward: 5′-GAATGCCAGAACTACAATC-3′ and reverse: 5′-TGTGTGGAAGATCCAATC-3′.

The sequencing conditions for KRAS and PIK3CA were as follows: 95°C for 10 min; 45 cycles of 95°C for 30 sec, 54°C for 10 sec and 72°C for 1 min.

Statistical analysis

All statistical analyses were conducted using the χ2 test and Fisher’s exact test with SPSS 13.0 statistical software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

A total of 156 gastric cancer samples were screened for mutations in KRAS (exon 2), BRAF (exon 15) and PIK3CA (exon 9 and 20). As a whole, 8.3% (13/156) of the analyzed samples harbored a mutation in either KRAS or PIK3CA. No mutations in the BRAF gene were identified. Notably, the frequency of mutations in either KRAS or PIK3CA was significantly higher in patients without lymph node metastasis than those with (17.5 vs. 5.2%, P=0.036). No significant association was observed between mutations in either KRAS or PIK3CA and other clinicopathological features (Table I).

KRAS mutations

Mutations in the KRAS gene were identified in 7 out of 156 gastric cancer samples (4.5%). In addition to the five mutations (two G13D, one G12V and two G12D) previously described by Liu et al (17), a further two mutations were found to occur at codon 12, leading to the substitutions of glycine for aspartic acid (G12D) and alanine (G12A), respectively (Fig. 1). In addition, the two mutations occurred exclusively in female patients aged over 65 years whose tumors were histo-logically classified into poorly-differentiated adenocarcinoma without lymph node metastasis. The mutation types and the clinicopathological features of the patients are summarized in Table III. The results demonstrated that no significant association was found between mutations in the KRAS gene and the clinicopathological features of the patients (Table I).

Figure 1

Sequencing chromatograms of (A and B) KRAS exon 2,(C and D) PIK3CA exon 9, and (E, F and G) PIK3CA exon 20 mutations. PIK3CA, phosphoinositide-3-kinase, catalytic, α polypeptide.

Table III

Mutation types and clinicopathological features of the patients.

Table III

Mutation types and clinicopathological features of the patients.

Patient no.KRASPIK3CA
GenderAge (years)Differentiation gradeLymph node metastasis
Exon 9Exon 20
1G13DMale61WellAbsent
9G12DMale72ModeratePresent
27G12VMale64PoorPresent
29G12DMale70PoorPresent
49G13DMale73ModerateAbsent
68G12DFemale69PoorAbsent
152G12AFemale75PoorAbsent
39H1047RFemale81ModerateAbsent
45E545KMale65ModeratePresent
70H1047RFemale73WellAbsent
83M1043IMale45PoorAbsent
108E545KMale61PoorPresent
122E545AH1047LMale67PoorPresent

[i] PIK3CA, phosphoinositide-3-kinase, catalytic, α polypeptide.

BRAF mutations

Mutations in the BRAF gene were not detected in the present study, which is consistent with the results of previous studies.

PIK3CA mutations

Mutations in the PIK3CA gene were identified in 6 out of 156 gastric cancer samples (3.8%), including three mutations in exon 9 (two E545K and one E545A) and four mutations in exon 20 (two H1047R, one M1043I and one H1047L) (Fig. 1). Furthermore, two different types of PIK3CA mutations, namely E545A in exon 9 and H1047L in exon 20, occurred simultaneously in one patient with gastric cancer. By contrast, mutations in the PIK3CA gene were found to occur in a mutually exclusive manner with mutations in the KRAS gene. The mutation types and the clinicopathological features of the patients are summarized in Table III. In addition, no significant association was found between mutations in the PIK3CA gene and the clinicopathological features of the patients (Table I).

Discussion

In the previous decade, molecular targeted therapy has been an important area of investigation for the treatment of human cancer. However, contemporary targeted therapy for gastric cancer is less than satisfactory, with few encouraging therapeutic effects. In addition to trastuzumab, which has been approved for the treatment of patients with gastric cancer, gefitinib appears to be useful clinically. It is worth noting that trastuzumab and gefitinib are applicable to only a small faction of patients with gastric cancer. Cetuximab, which was initially implemented for the treatment of patients with CRC, is currently undergoing clinical trials for the treatment of patients with gastric cancer. However, clinical outcomes from certain trials have been unsuccessful (9,10). In CRC, cetuximab has been well demonstrated to be effective in patients without mutations in the KRAS gene (12). However, certain patients without mutations in the KRAS gene do not respond to cetuximab in clinical practice, suggesting that other molecular variants may be associated with the inefficacy of cetuximab. Various studies have demonstrated that patients with CRC carrying mutations of other downstream effectors of EGFR, such as BRAF and PIK3CA, also exhibit resistance to treatment with cetuximab (13,14). Therefore, a previous study suggested that patients with CRC without KRAS, BRAF and PIK3CA mutations are more likely to respond to cetux-imab (29). Based on the therapeutic success of cetuximab in CRC, it was hypothesized that it is necessary to evaluate the status of KRAS, BRAF and PIK3CA mutations in gastric cancer for selecting patients eligible for treatment with cetuximab.

KRAS, a molecular switch of intracellular signaling transduction pathways, is essential in transferring extracellular growth signals into the nucleus. Mutant KRAS protein exhibits elevated kinase activity and is able to constitutively activate downstream signaling transduction pathways independent of stimuli from activated EGFRs. A review conducted by Kiaris and Spandidos (30) demonstrated that a mutation in the KRAS gene was associated with numerous types of human cancer, including pancreatic cancer, CRC and lung cancer (30). To date, a wide variety of studies have investigated the status of mutations in the KRAS gene in gastric adenocarcinoma with the frequency ranging between 0 and 21% (15–18). The frequency of mutations in the KRAS gene in different studies has varied markedly. In order to improve understanding of the status of mutations in the KRAS gene in gastric cancer, a large international multi-center study, including 712 patients with gastric cancer was conducted in 2013 (31). In the study, which is the largest to date, the overall frequency of mutations in the KRAS gene was 4% and KRAS mutation was not associated with clinicopatho-logical features, including ethnicity, gender and stage of tumor differentiation. The discrepancy between previous studies and the multi-center study may be predominantly due to the small sample size. Thus far, the majority of the studies included ≤100 patients with gastric cancer, rendering the interpretation of any conclusion difficult. In our previous study (17), the frequency of mutations in the KRAS gene was 9.6%. Furthermore, the patients with KRAS mutations were exclusively males although no significant difference was found, due to the small sample size. However, in the current study with a larger sample size, it was identified that the frequency of mutations in the KRAS gene was 4.5%. In addition, the patients with mutations in the KRAS gene were not only males but also females. No significant association was identified between KRAS mutation and the clinicopathological features of the patient, including gender, age, differentiation grade and depth of invasion. Thus, mutations in the KRAS gene may occur in all patients with gastric cancer, rendering its evaluation necessary for the identification of patients suitable for cetuximab therapy.

BRAF, a member of the RAF kinase family, is an essential downstream effector of KRAS. BRAF is commonly activated by somatic mutation and mutated BRAF is able to constitutively activate downstream signaling transduction pathways regardless of stimulus from EGFR or KRAS. To date, BRAF mutations have been identified in numerous types of human cancer, including melanoma, papillary thyroid cancer and CRC (32–34). However, data regarding the BRAF mutation in gastric cancer are limited. To date, a small number of studies involving 943 patients with gastric cancer have investigated the status of the BRAF mutation and found that the average frequency of mutations in the BRAF gene was only 2.5% (ranging between 0 and 11%) (18–25). Therefore, it is not noteworthy that no mutations in the BRAF gene were found in the present study. Mutations in the BRAF gene were absent or occurred only occasionally in Chinese patients with gastric cancer. Therefore, it is not necessary to evaluate the status of the BRAF mutation in order to select patients eligible for treatment with cetuximab.

PI3K, another downstream effector of EGFR, usually interacts with KRAS in the regulation of cellular functions. PIK3CA, encoding the catalytic subunit of PI3K, was initially demonstrated to be mutated in human cancer by Samuels et al (27). Subsequently, PIK3CA mutations have been identified in various types of human cancer, including breast cancer, CRC, liver cancer and ovarian cancer (28,35,36). In gastric cancer, the frequency of PIK3CA mutations varied between 4.3 and 25% (18,26–28). In the present study, the frequency of PIK3CA mutations was 3.8%, slightly lower than that observed in previous studies. The discrepancy among these studies may be due to a number of reasons, including sample size, mutation detection method used and the ethnicity of the patients. In CRC, it has been reported that PIK3CA mutations usually coexist with KRAS mutations (28,37). Notably, the PIK3CA mutation was also observed in a concomitant manner with KRAS mutation in gastric cancer (26,28). However, in the present study, it was identified that PIK3CA and KRAS mutations were mutually exclusive. Therefore, a definitive conclusion regarding the association of the PIK3CA mutation with the KRAS mutation in gastric cancer requires confirmation in further studies. By contrast, it was identified that mutations in either KRAS or PIK3CA were more likely to occur in patients without lymph node metastasis, which indicated that mutations of downstream effectors of EGFR occurred earlier in gastric carcinogenesis. In any case, KRAS and PIK3CA mutations should be evaluated prior to patients receiving cetuximab.

In conclusion, in the present study ~8.3% of Chinese patients with gastric cancer harbored a mutation in either KRAS or PIK3CA, suggesting that these patients would not benefit from cetuximab. Therefore, in the future, KRAS and PIK3CA, but not BRAF mutations should be evaluated in order to select patients eligible for treatment with cetuximab.

Acknowledgments

The authors would like to thank the doctors of the Second Affiliated Hospital of Dalian Medical University for the collection of the samples. This study was supported by the National Natural Science Foundation of China (grant no. 81071805).

References

1 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Janunger KG, Hafström L, Nygren P and Glimelius B; SBU-group. Swedish Council of Technology Assessment in Health Care: A systematic overview of chemotherapy effects in gastric cancer. Acta Oncol. 40:309–326. 2001. View Article : Google Scholar : PubMed/NCBI

3 

Bang YJ, Van Cutsem E, Feyereislova A, et al: Trastuzumab in combination with chemotherapy versus chemotherapy alone for treatment of HER2-positive advanced gastric or gastro-oesophageal junction cancer (ToGA): a phase 3, open-label, randomised controlled trial. Lancet. 376:687–697. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Rojo F, Tabernero J, Albanell J, et al: Pharmacodynamic studies of gefitinib in tumor biopsy specimens from patients with advanced gastric carcinoma. J Clin Oncol. 24:4309–4316. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Moutinho C, Mateus AR, Milanezi F, Carneiro F, Seruca R and Suriano G: Epidermal growth factor receptor structural alterations in gastric cancer. BMC Cancer. 8:102008. View Article : Google Scholar : PubMed/NCBI

6 

Liu Z, Liu L, Li M, et al: Epidermal growth factor receptor mutation in gastric cancer. Pathology. 43:234–238. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Ciardiello F and Tortora G: EGFR antagonists in cancer treatment. N Engl J Med. 358:1160–1174. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Rivera F, Vega-Villegas ME and López-Brea MF: Cetuximab, its clinical use and future perspectives. Anticancer Drugs. 19:99–113. 2008. View Article : Google Scholar : PubMed/NCBI

9 

Chan JA, Blaszkowsky LS, Enzinger PC, et al: A multicenter phase II trial of single-agent cetuximab in advanced esophageal and gastric adenocarcinoma. Ann Oncol. 22:1367–1373. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Schoennemann KR, Bjerregaard JK, Hansen TP, et al: Biweekly cetuximab and irinotecan as second-line therapy in patients with gastro-esophageal cancer previously treated with platinum. Gastric Cancer. 14:219–225. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Shi M, Ji J, Wu J, et al: Cetuximab combined with FOLFOX4 as the first-line treatment for advanced gastric cancer: report of 25 cases from a single institution. Hepatogastroenterology. 59:1054–1058. 2012.PubMed/NCBI

12 

Karapetis CS, Khambata-Ford S, Jonker DJ, et al: K-ras mutations and benefit from cetuximab in advanced colorectal cancer. N Engl J Med. 359:1757–1765. 2008. View Article : Google Scholar : PubMed/NCBI

13 

De Roock W, Claes B, Bernasconi D, et al: Effects of KRAS, BRAF, NRAS and PIK3CA mutations on the efficacy of cetuximab plus chemotherapy in chemotherapy-refractory metastatic colorectal cancer: a retrospective consortium analysis. Lancet Oncol. 11:753–762. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Sartore-Bianchi A, Di Nicolantonio F, Nichelatti M, et al: Multi-determinants analysis of molecular alterations for predicting clinical benefit to EGFR-targeted monoclonal antibodies in colorectal cancer. PLoS One. 4:e72872009. View Article : Google Scholar : PubMed/NCBI

15 

Victor T, Du Toit R, Jordaan AM, Bester AJ and van Helden PD: No evidence for point mutations in codons 12, 13 and 61 of the ras gene in a high-incidence area for esophageal and gastric cancers. Cancer Res. 50:4911–4914. 1990.PubMed/NCBI

16 

Hongyo T, Buzard GS, Palli D, et al: Mutations of the K-ras and p53 genes in gastric adenocarcinomas from a high-incidence region around Florence, Italy. Cancer Res. 55:2665–2672. 1995.PubMed/NCBI

17 

Liu ZM, Liu LN, Li M, Zhang QP, Cheng SH and Lu S: Mutation detection of KRAS by high-resolution melting analysis in Chinese gastric cancer. Oncol Rep. 22:515–520. 2009.PubMed/NCBI

18 

Corso G, Velho S, Paredes J, et al: Oncogenic mutations in gastric cancer with microsatellite instability. Eur J Cancer. 47:443–451. 2011. View Article : Google Scholar

19 

Lee SH, Lee JW, Soung YH, et al: BRAF and KRAS mutations in stomach cancer. Oncogene. 22:6942–6945. 2003. View Article : Google Scholar : PubMed/NCBI

20 

Kim IJ, Park JH, Kang HC, et al: Mutational analysis of BRAF and K-ras in gastric cancers: absence of BRAF mutations in gastric cancers. Hum Genet. 114:118–120. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Oliveira C, Pinto M, Duval A, et al: BRAF mutations characterize colon but not gastric cancer with mismatch repair deficiency. Oncogene. 22:9192–9196. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Wu M, Semba S, Oue N, Ikehara N, Yasui W and Yokozaki H: BRAF/K-ras mutation, microsatellite instability and promoter hypermethylation of hMLH1/MGMT in human gastric carcinomas. Gastric Cancer. 7:246–253. 2004. View Article : Google Scholar

23 

Zhao W, Chan TL, Chu KM, Chan AS, Stratton MR, Yuen ST and Leung SY: Mutations of BRAF and KRAS in gastric cancer and their association with microsatellite instability. Int J Cancer. 108:167–169. 2004. View Article : Google Scholar

24 

Sasao S, Hiyama T, Tanaka S, Yoshihara M, Yasui W and Chayama K: Clinicopathologic and genetic characteristics of gastric cancer in young male and female patients. Oncol Rep. 16:11–15. 2006.PubMed/NCBI

25 

Stella G, Rojas Llimpe F, Barone C, et al: KRAS and BRAF mutational status as response biomarkers to cetuximab combination therapy in advanced gastric cancer patients. ASCO Meet Abstr. 27:e155032009.

26 

Li VS, Wong CW, Chan TL, et al: Mutations of PIK3CA in gastric adenocarcinoma. BMC Cancer. 5:292005. View Article : Google Scholar : PubMed/NCBI

27 

Samuels Y, Wang Z, Bardelli A, et al: High frequency of mutations of the PIK3CA gene in human cancers. Science. 304:5542004. View Article : Google Scholar : PubMed/NCBI

28 

Velho S, Oliveira C, Ferreira A, et al: The prevalence of PIK3CA mutations in gastric and colon cancer. Eur J Cancer. 41:1649–1654. 2005. View Article : Google Scholar : PubMed/NCBI

29 

Bardelli A and Siena S: Molecular mechanisms of resistance to cetuximab and panitumumab in colorectal cancer. J Clin Oncol. 28:1254–1261. 2010. View Article : Google Scholar : PubMed/NCBI

30 

Kiaris H and Spandidos D: Mutations of ras genes in human tumors (review). Int J Oncol. 7:413–421. 1995.PubMed/NCBI

31 

van Grieken NC, Aoyama T, Chambers PA, et al: KRAS and BRAF mutations are rare and related to DNA mismatch repair deficiency in gastric cancer from the East and the West: Results from a large international multicentre study. Br J Cancer. 108:1495–1501. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Davies H, Bignell GR, Cox C, et al: Mutations of the BRAF gene in human cancer. Nature. 417:949–954. 2002. View Article : Google Scholar : PubMed/NCBI

33 

Lee SH, Ahn BK, Baek SU and Chang HK: BRAF mutation in multiple primary cancer with colorectal cancer and stomach cancer. Gastroenterol Rep (Oxf). 1:70–74. 2013. View Article : Google Scholar

34 

Henke LE, Perkins SM, Pfeifer JD, Ma C, Chen Y, DeWees T and Grigsby PW: BRAF V600E mutational status in pediatric thyroid cancer. Pediatr Blood Cancer. 61:1168–1172. 2014. View Article : Google Scholar : PubMed/NCBI

35 

Campbell IG, Russell SE, Choong DY, et al: Mutation of the PIK3CA gene in ovarian and breast cancer. Cancer Res. 64:7678–7681. 2004. View Article : Google Scholar : PubMed/NCBI

36 

Lee JW, Soung YH, Kim SY, et al: PIK3CA gene is frequently mutated in breast carcinomas and hepatocellular carcinomas. Oncogene. 24:1477–1480. 2005. View Article : Google Scholar

37 

Simi L, Pratesi N, Vignoli M, et al: High-resolution melting analysis for rapid detection of KRAS, BRAF and PIK3CA gene mutations in colorectal cancer. Am J Clin Pathol. 130:247–253. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lu W, Wei H, Li M, Wang H, Liu L, Zhang Q, Liu L and Lu S: Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer. Mol Med Rep 12: 1219-1224, 2015.
APA
Lu, W., Wei, H., Li, M., Wang, H., Liu, L., Zhang, Q. ... Lu, S. (2015). Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer. Molecular Medicine Reports, 12, 1219-1224. https://doi.org/10.3892/mmr.2015.3530
MLA
Lu, W., Wei, H., Li, M., Wang, H., Liu, L., Zhang, Q., Liu, L., Lu, S."Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer". Molecular Medicine Reports 12.1 (2015): 1219-1224.
Chicago
Lu, W., Wei, H., Li, M., Wang, H., Liu, L., Zhang, Q., Liu, L., Lu, S."Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer". Molecular Medicine Reports 12, no. 1 (2015): 1219-1224. https://doi.org/10.3892/mmr.2015.3530
Copy and paste a formatted citation
x
Spandidos Publications style
Lu W, Wei H, Li M, Wang H, Liu L, Zhang Q, Liu L and Lu S: Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer. Mol Med Rep 12: 1219-1224, 2015.
APA
Lu, W., Wei, H., Li, M., Wang, H., Liu, L., Zhang, Q. ... Lu, S. (2015). Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer. Molecular Medicine Reports, 12, 1219-1224. https://doi.org/10.3892/mmr.2015.3530
MLA
Lu, W., Wei, H., Li, M., Wang, H., Liu, L., Zhang, Q., Liu, L., Lu, S."Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer". Molecular Medicine Reports 12.1 (2015): 1219-1224.
Chicago
Lu, W., Wei, H., Li, M., Wang, H., Liu, L., Zhang, Q., Liu, L., Lu, S."Identification of KRAS and PIK3CA but not BRAF mutations in patients with gastric cancer". Molecular Medicine Reports 12, no. 1 (2015): 1219-1224. https://doi.org/10.3892/mmr.2015.3530
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team