Ameliorative effects of pomegranate on carbon tetrachloride hepatotoxicity in rats: A molecular and histopathological study

  • Authors:
    • Zein Shaban Ibrahim
    • Mohamed Abdo Nassan
    • Mohamed Mohamed Soliman
  • View Affiliations

  • Published online on: March 1, 2016     https://doi.org/10.3892/mmr.2016.4956
  • Pages: 3653-3660
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The present study aimed to investigate the molecular mechanism underlying the hepatoprotective effects of pomegranate (POM) against oxidative stress in a rat model of carbon tetrachloride (CCl4)-induced liver damage. Injection of rats with CCl4 resulted in hepatic inflammation and lipid accumulation via the upregulation of interleukin (IL)‑6 and sterol regulatory element‑binding protein 1c (SREBP‑1c) mRNA expression. CCl4 induced downregulation of the anti‑inflammatory factors alpha 2‑macroglobulin (α‑2M) and IL‑10 in comparison with the POM treated group. In addition, CCl4 induced downregulation of superoxide dismutase (SOD), glutathione S‑transferase (GST) and catalase (CAT) expression. Conversely, prior administration of POM counteracted the deleterious alterations induced by CCl4. POM downregulated CCl4-induced IL‑6 upregulation, normalized the increase in SREBP‑1c expression, and prevented CCl4‑induced α‑2M downregulation. POM counteracted CCL4‑induced alterations via immunosuppressive, anti‑inflammatory and regenerative effects by upregulating transforming growth factor‑β1, HSP70 and IL-10 mRNA expression. In addition, POM increased reactive oxygen species scavenging activity by augmenting the antioxidant defense mechanism against CCl4 hepatotoxicity, as demonstrated by detecting SOD, CAT and GST expression. These results confirm that, at the molecular level, POM exerts hepatoprotective effects against CCl4‑induced oxidative stress and liver tissue damage.

Introduction

Oxidative stress occurs due to the inability of various antioxidant mechanisms to scavenge excessive levels of reactive oxygen species (ROS) and/or a reduction in antioxidant defense mechanisms. Consequently, degenerative diseases, including hepatopathies (1) and nephropathies (2) may occur. The liver and kidneys are the first tissues to be affected by oxidative stress produced by infectious agents, alcohol, drugs, toxic industrial chemicals, food additives, and pollutants in the air and water. Furthermore, free radicals and ROS have a crucial role in the initiation and progression of liver disease and cancer (3).

Carbon tetrachloride (CCl4) is an industrial solvent, which is extensively used as a xenobiotic to induce chemical liver injury. CCl4-induced oxidative stress is commonly used in rodent models to determine the protective effects of synthetic or natural products against drug-associated hepatotoxicity and nephrotoxicity (4,5). CCl4 is metabolized by hepatic microsomal cytochrome P450 into trichloromethyl free radicals. Trichloromethyl can react with sulfhydryl groups (glutathione and protein thiols) and antioxidant enzymes, including catalase (CAT) and superoxide dismutase (SOD) (4). Overproduction of trichloromethyl free radicals may initiate membrane lipid peroxidation, eventually leading to various pathological alterations (6). ROS have an important role in the development and progression of human disease, including liver disorders, lung and kidney damage, diabetes mellitus, atherosclerosis and aging (7), via free radical-induced lipid peroxidation and cell membrane damage (8). Furthermore, CCl4 causes tissue damage during inflammation, cancer and aging (9). Parallel to oxidative stress, CCl4 may induce alterations in various pathways, which affect the metabolic and healthy state of subjects, including changes in the gene expression of acute phase proteins, cytokines (inflammatory and anti-inflammatory), and genes associated with lipid metabolism.

It has previously been demonstrated that various natural products can protect organs against CCl4-induced oxidative stress by enhancing the activities of antioxidant enzymes, including CAT, glutathione S-transferase (GST) and SOD (10). Pomegranate (Punica granatum; POM) is widely renowned in the Middle East due to its health benefits (11). POM fruit, juice and peel possess a marked antioxidant capacity, exert anti-obesity and antihypertensive effects, and may be used to treat prostate cancer (1214). POM contains high levels of polyphenols, particularly ellagitannins, condensed tannins and anthocyanins (15). POM juice consumption has been reported to significantly increase sperm quality, spermatogenic cell density, antioxidant activity and testosterone levels in male rats (16). In addition, POM juice has been proposed to exert chemopreventive, chemotherapeutic, antiatherosclerotic and anti-inflammatory effects (14,17); therefore, its consumption has markedly increased (18,19). It is well known that the liver is the main organ responsible for detoxification and drug metabolism; therefore, the present study aimed to investigate the effects of POM on CCl4-induced hepatotoxicity. In addition, the molecular mechanisms underlying the effects of POM on CCl4-induced alterations in the expression of antioxidants, cytokines, inflammatory markers and genes associated with lipid metabolism, as well as hepatic histopathology, were examined.

Materials and methods

Materials

CCl4 was purchased from Sigma-Aldrich (St. Louis, MO, USA). The DNA ladder (100 bp) was purchased from Thermo Fisher Scientific, Inc. (Waltham, MA, USA). QIAzol for RNA extraction and oligo-dT primers were purchased from Qiagen, Inc. (Valencia, CA, USA). Rabbit anti-rat heat shock protein 70 (HSP70) primary antibody was purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Experimental animals

Male Wistar rats, weighing 200–250 g, were purchased from the Animal House, King Abdulaziz University (Jeddah, Saudi Arabia). The adult male Wistar rats were divided into four equal groups (n=6/group) in the present study. The rats were kept under observation for ~1 week, in order to acclimate to the environment prior to onset of the experiment. The rats were maintained in stainless steel cages at normal atmospheric temperature (27±5°C), under good ventilation and a 12 h/12 h light/dark cycle. The rats had access to food and water ad libitum. All animal procedures were approved by the Ethics Committee of the Dean of Scientific Affairs of Taif University (Taif, Saudi Arabia).

Experimental design and treatments

Group 1 served as a control group, in which the rats were injected intraperitoneally (i.p.) with corn oil (0.5 ml/kg) once daily. Group 2 were administered water daily for 25 days and on days 18 and 20 were injected with 1 ml/kg CCl4 (50% in corn oil; i.p.). Group 3 were administered POM juice daily [30 ml/kg body weight (BW)], and were injected with corn oil (i.p.) on days 18 and 20. Group 4 were administered POM juice (30 ml/kg BW) daily for 25 days, and were injected with 1 ml/kg CCl4 (50% in corn oil; i.p.) on days 18 and 20. POM juice was administered to the rats in the morning, 2 h after water deprivation, and the rats consumed the given dose within 2 h, in order to assure no changes due to environmental conditions. The dose of POM juice was chosen based on a previous study (20).

Sampling

At the end of the experiment, the rats were sacrificed by cervical dislocation following anesthetization by diethyl ether (Sigma-Aldrich) inhalation. The liver tissues of all groups were harvested, homogenized and maintained in either formalin or QIAzol reagent for histopathology and RNA extraction, respectively.

Analysis of gene expression
RNA extraction and cDNA synthesis

Total RNA was extracted from 100 mg tissue samples using QIAzol reagent, according to the manufacturer's instructions. The integrity of the prepared RNA was determined by electrophoresis. RNA concentration and purity were determined spectrophotometrically at 260 and 280 nm (Bio-Rad SmartSpec Spectrophotometer; Bio-Rab Laboratories, Inc., Hercules, CA, USA). The 260/280 optical density ratio of all RNA samples was 1.7–1.9. A total of 2 µg RNA was reverse transcribed using oligo-dT primers and Moloney murine leukaemia virus (M-MuLV) reverse transcriptase (SibEnzyme Ltd., Novosibirsk, Russia). For cDNA synthesis, a mixture of 2 µg total RNA and 0.5 ng oligo dT primer in a total volume of 11 µl sterilized diethylpyrocarbonate (DEPC) water was incubated in a PeX 0.5 thermal Cycler (Bio-Rad Laboratories, Inc.) at 65°C for 10 min for denaturation. Then, 4 µl 5X RT-buffer, 2 µl 10 mM dNTPs and 100 units M-MuLV Reverse Transcriptase (all purchased from SibEnzyme Ltd., Novosibirsk, Russia) was added in a total volume of 20 µl by DEPC water. The mixture was re-incubated in the thermal cycler at 37°C for 1 h, then at 90°C for 10 min in order to inactivate the enzyme.

Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR)

RNA from hepatic tissues was analyzed by semi-quantitative RT-PCR using corresponding specific primers for the indicated genes (Table I). The primers were designed using Oligo-4 computer program (version 7.0; Molecular Biology Insights, Cascade, CO, USA) according to the nucleotide sequences published in GenBank (http://www.ncbi.nlm.nih.gov/genbank/; Table I), and were synthesized by Macrogen Korea (Seoul, South Korea). PCR was conducted in a final volume of 25 µl consisting of 1 µl cDNA, 1 µl (10 picomoles) of each primer (forward and reverse), and 12.5 µl PCR Master Mix (Promega Corporation, Madison, WI, USA). The final volume was brought to 25 µl using sterilized, nuclease-free deionized water. PCR was carried out using a PeX 0.5 Thermal Cycler, and the following cycling conditions were used: Denaturation at 94°C for 5 min for one cycle, followed by 27 cycles of denaturation at 94°C for 1 min, annealing at the specific temperature corresponding to each primer (Table I) for 1 min, and extension at 72°C for 1 min, followed by a final extension step at 72°C for 5 min. As an internal reference, glyceraldehyde 3-phosphate dehydrogenase mRNA expression was detected using specific primers (Table I). PCR products subsequently underwent 1.5% agarose gel electrophoresis (Bio Basic Inc., Markham, ON, Canada) in Tris-Borate-ethylenediaminetetraacetic acid buffer at 100 V for 30 min with ethidium bromide staining (Sigma-Aldrich). PCR products were visualized under ultraviolet (UV) light and images were captured using an InGenius 3.0 gel documentation system (Syngene, Frederick, MD, USA). Band intensities from the various rats from each group were quantified densitometrically using ImageJ software version 1.47 (http://imagej.en.softonic.com/).

Table I

Sequences and conditions of polymerase chain reaction primers.

Table I

Sequences and conditions of polymerase chain reaction primers.

GeneProduct size (bp)Annealing temp. (°C)Number of PCR cyclesDirectionSequence (5′-3′)
GST5755529Sense GCTGGAGTGGAGTTTGAAGAA
Antisense GTCCTGACCACGTCAACATAG
SOD4105528Sense AGGATTAACTGAAGGCGAGCAT
Antisense TCTACAGTTAGCAGGCCAGCAG
Catalase65255.530Sense GCGAATGGAGAGGCAGTGTAC
Antisense GAGTGACGTTGTCTTCATTAGCACTG
α-2M3255630Sense GCTCCTGTCTGTTTCCTTAGTT
Antisense ATTGGCCTTTCGTGGTTTAG
IL-64855732Sense AGTTGCCTTCTTGGGACTGA
Antisense GAGCATTGGAAGTTGGGGTA
IL-102595733Sense ACCAGCTGGACAACATACTGC
Antisense TCATTCTTCACCTGCTCCACT
TGF-β14565832Sense TGAGTGGCTGTCTTTTGACG
Antisense TGGTTGTAGAGGGCAAGGAC
SREBP-1c1915833Sense GGAGCCATGGATTGCACATT
Antisense AGGAAGGCTTCCAGAGAGGA
G3PDH3095225Sense AGATCCACAACGGATACATT
Antisense TCCCTCAAGATTGTCAGCAA

[i] GST, glutathione S-transferase; SOD, superoxide dismutase; AGP, ; α-2M, alpha 2-macroglobulin; IL, interleukin; TGF-β1, transforming growth factor-β1; FAS, ; SREBP-1c, sterol regulatory element-binding protein 1c; G3PDH, glyceraldehyde 3-phosphate dehydrogenase.

Immunohistochemical staining of HSP70

Tissue sections were deparaffinized and were then treated with 3% H2O2 for 10 min, in order to inactivate peroxidases. Subsequently, the sections were heated in 10 mM citrate buffer at 121°C for 30 min for antigen retrieval, blocked in 5% normal serum for 20 min, and were incubated with primary polyclonal anti-HSP70 [1:100 in phosphate-buffered saline (PBS); sc-33575; Santa Cruz Biotechnology, Inc.] overnight at 4°C. After three extensive washes with PBS, sections were incubated with a biotin-conjugated goat anti-rabbit secondary antibody (1:2,000 in PBS; sc-2040; Santa Cruz Biotechnology, Inc.) for 20 min at 32°C. Following a further incubation with horseradish peroxidase-labeled streptavidin (Santa Cruz Biotechnology, Inc.) according to the manufacturer's instructions, antibody binding was visualized with diaminobenzidine (Sigma-Aldrich) and sections were counterstained with hematoxylin (Sigma-Aldrich). Tissue slides were visualized using a Wolfe S9-0982 microscope (Carolina Biological Supply Co., Burlington, NC, USA) and photos were captured using a Canon Power Shot SX500 IS digital camera (Canon, Tokyo, Japan).

Statistical analysis

Data are presented as the mean ± standard error of the mean. Statistical analysis for the obtained results was conducted using one-way analysis of variance followed by the least significant difference test for multiple comparisons among groups. The analysis was performed using SPSS version 13.0 (SPSS Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of POM on the hepatic mRNA expression levels of interleukin (IL)-6, sterol regulatory element-binding protein 1c (SREBP-1c) and alpha 2-macroglobulin (α-2M)

To examine whether POM was able to modulate cytokine expression in order to exert its hepatoprotective effects, the mRNA expression levels of IL-6 were detected (Fig. 1A). The mRNA expression levels of IL6 were upregulated following CCl4 injection. Furthermore, when administered alongside CCl4, POM normalized the expression of IL6 mRNA. In addition, SREBP-1c, a lipogenic transcription factor and key regulator of hepatic lipid metabolism, was detected. The mRNA expression levels of SREBP-1 were significantly upregulated following CCl4 injection (P<0.05). Furthermore, when administered alongside CCl4, POM completely normalized SREBP-1c mRNA expression (Fig. 1B). α-2M is known to stabilize target protein and enhance its regeneration. In the present study, α-2M expression was significantly downregulated in the CCl4 group compared with the control (P<0.05). However, treatment with POM increased α-2M mRNA expression. Concurrent POM administration in the CCl4-injected group resulted in a further upregulation in α-2M expression (Fig. 1C).

Effects of POM on the mRNA expression levels of transforming growth factor (TGF)-β1 and IL-10

The mRNA expression levels of TGF-β1 were significantly upregulated in the CCl4-treated group compared with in the control group (P<0.05). POM treatment alone only slightly upregulated TGF-β1 mRNA expression, as compared with the control group. However, when the rats were co-treated with CCl4 and POM the mRNA expression levels of TGF-β1 were further significantly upregulated compared with in the CCl4 group (P<0.05; Fig. 2A). Treatment of the rats with CCl4 significantly suppressed the mRNA expression levels of the anti-inflammatory cytokine IL-10, as compared with the control (P<0.05). However, co-treatment with POM and CCl4 significantly upregulated interleukin-10 mRNA expression compared with the control and CCl4-treated groups (P<0.05; Fig. 2B).

Effects of POM on hepatic antioxidant enzyme expression

CCl4 induced the downregulation of the expression of CAT, GST and SOD, which were normalized following co-administration of POM with CCl4. Following co-treatment with CCl4 and POM, the mRNA expression levels of the antioxidant enzymes were completely restored, compared with in the CCl4 group (Fig. 3A–C).

Effects of POM on hepatic HSP70, as revealed by immunohistochemical staining

Immunostaining of liver samples from control rats with HSP70 antibodies indicated normal hepatic architecture, with normal hepatic cords, hepatic sinusoids and normal portal area, and an absence of HSP70 expression (Fig. 4A). Liver samples from the CCl4 group exhibited moderate HSP70 expression in the hepatocytes with increased fat infiltration (Fig. 4B). Liver samples from the POM-supplemented group exhibited a lack of HSP70 expression in hepatocytes, alongside normal hepatic architecture (Fig. 4C). Liver samples from the rats co-treated with CCl4 and POM exhibited significantly increased HSP70 expression in the hepatocytes (P<0.05), alongside a decrease in the aberrant alterations detected in the CCl4 group (Fig. 4D).

Discussion

The present study demonstrated that POM exerted a protective effect on the liver against CCl4-induced oxidative stress. CCl4 is one of the most commonly used hepatotoxins, and its metabolites trichloromethyl radical (CCl3) and trichloromethyl peroxy radical (Cl3COO•) are involved in the pathogenesis of liver and kidney damage (7,21). Both radicals are able to covalently bind macromolecules and induce peroxidative degradation of the cell membrane of liver cells.

IL-6 is produced in the liver by several types of cells, including biliary epithelial cells and cholangiocytes, in response to inflammatory mediators (22,23). IL-6 is a commonly used marker of inflammation, the expression of which has been demonstrated to be markedly increased in the liver of patients with non-alcoholic fatty liver disease and non-alcoholic steatohepatitis (24). In the present study, CCl4 induced inflammation, as demonstrated by an upregulation in hepatic IL-6 expression. However, downregulation of basal IL-6 mRNA expression levels, and attenuation of the CCl4-induced upregulation of IL-6 by POM, indicates its anti-inflammatory effects. Parallel with these results, increased levels of the proinflammatory cytokine IL-6 in the ileum of a rat model of necrotizing enterocolitis were normalized following treatment with POM seed oil (25).

SREBP-1c is an important transcription factor, which regulates the hepatic expression of enzymes associated with the de novo synthesis of fatty acids (26). Upregulation of the gene expression levels of SREBP-1c has previously been shown to accompany ethanol-induced fatty liver (27). In the present study, CCl4 induced the upregulation of SREBP-1c mRNA expression, thus indicating the disturbance of lipid metabolism through which CCl4 may induce liver degeneration. In addition, treatment with POM normalized SREBP-1c hepatic mRNA expression, thus suggesting that the hepatoprotective effects of POM operate via normalization of lipid metabolism. Consistently, a previous study demonstrated that strawberry seed oil was able to decrease SREBP-1c hepatic content, which was associated with reduced plasma triglycerides and a decreased proportion of liver fat (28).

α-2M is the largest major non-immunoglobulin plasma protein, which is synthesized by numerous cell lineages, including lung fibroblasts, monocytes, macrophages, hepatocytes, astrocytes and adrenocortical cells (29). α-2M is expressed in hepatocytes where it has an important role in the regulation of proteolytic activity in the tissue and pericellular space, and contributes to the clearance of α-2M-proteinase complexes from the circulation (30). In addition, α-2M exerts an inhibitory effect on various types of nonspecific proteases and possesses pronounced immunosuppressive activity (31). The results of the present study demonstrated that treatment with CCl4 resulted in downregulation of hepatic α-2M mRNA expression compared with the control group. The ability of POM to upregulate basal and CCl4-suppressed α-2M mRNA expression indicated that the hepatoprotective effects of POM may operate via upregulation of α-2M expression. Notably, increased α-2M levels have been reported to have an important role in radioprotection via anti-fibrotic, anti-inflammatory, antioxidant, homeostatic, and repair and remodeling mechanisms (32).

TGF-β1 is a powerful pleiotropic cytokine that possesses immune-suppressing and anti-inflammatory properties (33). In the present study, treatment with POM alone elevated TGF-β1 mRNA expression levels, thus indicating that the modulatory effects of POM on immune status may be caused by TGF-β1 upregulation. Treatment with CCl4 induced the upregulation of TGF-β1 mRNA expression, the expression of which was further upregulated in the rats co-treated with POM and CCl4. These results suggested that the anti-inflammatory effects of POM may be due to TGF-β1 upregulation. In patient-tolerated kidney or liver allografts, type 1 regulatory T cells were demonstrated to exist, and were capable of suppressing naïve T-cell activation and producing high levels of both IL-10 and TGF-β1 (34).

IL-10 has been reported to exert both pro- and antitumoral effects through the inhibition of nuclear factor-κB signaling; therefore, it is able to downregulate proinflammatory cytokine expression (35). IL-10 configures development of the immune response and suppresses proinflammatory cytokine expression (36). In addition, IL-10 induces the downregulation of T helper 1 cytokine mRNA expression, and inhibits IL-1 and IL-6 production (37,38). In the present study, CCl4-induced downregulation of IL-10 is consistent with the findings of a previous study, which reported that CCl4 reduced hepatic IL-10 expression, as compared with in the control group (39). In the present study, POM upregulated IL-10 expression, thus suggesting that POM exerts an anti-inflammatory effect, which protects the liver from CCl4-induced inflammation. Notably, previous studies have reported that IL-10 may exert anti-fibrotic effects during CCl4-induced hepatic fibrosis (40,41). Therefore, POM may protect the liver from CCl4-induced inflammation and fibrosis by upregulating the expression of IL-10 (42).

Delaying or inhibiting the oxidation of easily oxidizable macromolecules, such as lipids, is accomplished by antioxidants, including SOD, CAT and GST, which have a major role in protecting these molecules from the actions of free radicals or ROS (43). Conversion of superoxide to less toxic H2O2 is catalyzed by SOD, whereas conversion of H2O2 into nontoxic H2O is catalyzed by CAT (44). The present study demonstrated that administration of POM in CCl4-administered rats significantly restored mRNA expression of the antioxidants examined, thus suggesting that POM possesses anti-lipid peroxidation and antioxidative properties. Parallel with these results, Ocimum sanctum extract has been shown to cause a significant decrease in lipid peroxidation, coupled with a significant increase in SOD and CAT expression in the liver homogenates of rats exposed to oxidative stress (45). The present study suggested that CCl4-induced suppression of SOD mRNA expression may be caused by enhancement of lipid peroxidation or inactivation of antioxidant enzymes, which leads to increased accumulation of superoxide radicals and lipid peroxidation acceleration. However, when administered alongside CCl4, POM prevented CCl4-induced antioxidant suppression. These results indicated that the ROS scavenging activities of POM juice may protect the liver from CCl4-induced oxidative stress. A similar protective effect of flavonoids has been reported in a previous study, which detected the ability of flavonoids to scavenge oxidative radicals in the liver of mice and rats following exposure to CCl4 (46). In accordance with the present results, POM has been reported to exhibit a promising antioxidant capacity, and is an effective scavenger for several ROS, primarily due to its high levels of phenolic acids, flavonoids and other polyphenolic compounds (47), through which POM may protect against free radical-mediated oxidative stress and attenuate CCL4-induced antioxidant depletion (48).

HSPs are induced in response to various stressors, in order to protect cells from such effects (49). HSP70 has been reported to protect cells from tumor necrosis factor-α, prostaglandin, hydrogen peroxide, ethanol and UV (50). In the present study, HSP70 expression was slightly increased following treatment with CCl4, which is parallel to the previously reported induction of HSP70 in acute liver damage by CCl4 (51). POM administration, together with CCl4, induced strong HSP70 immunoreactivity, thus preventing protein denaturation, which may act as a mechanism to overcome CCl4-induced hepatic oxidative stress. Parallel with this assumption, CCl4-induced liver damage has been shown to be attenuated by pre-induction of chaperones by heat treatment (52).

In conclusion, the present study confirmed that POM exerts hepatoprotective effects against CCl4-induced oxidative stress. POM was demonstrated to possess anti-inflammatory effects by suppressing CCl4-induced IL-6 expression, and was able to normalize lipid peroxidation by decreasing CCl4-induced SREBP-1c expression and increasing CCl4-suppressed α-2M mRNA expression. In addition, POM may exert hepatoprotective activity by its immunosuppressive, anti-inflammatory and regenerative effects via upregulation of TGF-β1, HSP70 and IL-10, and may increase ROS scavenging activities by augmenting the antioxidant defense mechanism against CCl4-induced hepatotoxicity and preventing CCl4-induced SOD, CAT and GST downregulation.

Abbreviations:

α-2M

alpha 2-macroglobulin

CAT

catalase

GST

glutathione S-transferase

HSP70

heat shock protein 70

i.p.

intraperitoneal injection

IL-6

interleukin-6

IL-10

interleukin-10

SOD

superoxide dismutase

ROS

reactive oxygen species

POM

pomegranate

SREBP-1c

sterol regulatory element-binding protein 1c

TGF-β1

transforming growth factor-β1

RT-PCR

reverse transcription-polymerase chain reaction

Acknowledgments

The present study was supported by a research project grant (no. 1/436/3989) from Taif University (Taif, Saudi Arabia).

References

1 

Hensley K, Robinson KA, Gabbita SP, Salsman S and Floyd RA: Reactive oxygen species, cell signaling and cell injury. Free Radic Biol Med. 28:1456–1462. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Ateşşahin A, Karahan I, Yilmaz S, Ceribaşi AO and Princci I: The effect of manganese chloride on gentamicin-induced nephrotoxicity in rats. Pharmacol Res. 48:637–642. 2003. View Article : Google Scholar

3 

Jemal A, Siegel R, Ward E, Murray T, Xu J and Thun MJ: Cancer statistics, 2007. CA Cancer J Clin. 57:43–66. 2007. View Article : Google Scholar : PubMed/NCBI

4 

Khan RA, Khan MR and Sahreen S: CCl4-induced hepatotoxicity: Protective effect of rutin on p53, CYP2E1 and the antioxidative status in rat. BMC Complement Altern Med. 12:1782012. View Article : Google Scholar

5 

Es Haghi M, Dehghan G, Banihabib N, Zare S, Mikaili P and Panahi F: Protective effects of Cornus mas fruit extract on carbon tetrachloride induced nephrotoxicity in rats. Indian J Nephrol. 24:291–296. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Cemek M, Aymelek F, Büyükokuroğlu ME, Karaca T, Büyükben A and Yilmaz F: Protective potential of Royal Jelly against carbon tetrachloride induced-toxicity and changes in the serum sialic acid levels. Food Chem Toxicol. 48:2827–2832. 2010. View Article : Google Scholar : PubMed/NCBI

7 

Singh K, Khanna AK and Chander R: Hepatoprotective activity of ellagic acid against carbon tetrachloride induced hepatotoxicity in rats. Indian J Exp Biol. 37:1025–1026. 1999.

8 

Ogeturk M, Kus I, Kavakli A, Oner J, Kukner A and Sarsilmaz M: Reduction of carbon tetrachloride-induced nephropathy by melatonin administration. Cell Biochem Funct. 23:85–92. 2005. View Article : Google Scholar

9 

Bhadauria M, Nirala SK, Shrivastava S, Sharma A, Johri S, Chandan BK, Singh B, Saxena AK and Shukla S: Emodin reverses CCl induced hepatic cytochrome P450 (CYP) enzymatic and ultrastructural changes: The in vivo evidence. Hepatol Res. 39:290–300. 2009. View Article : Google Scholar

10 

Rajesh MG and Latha MS: Preliminary evaluation of the antihepatotoxic activity of Kamilari, a polyherbal formulation. J Ethnopharmacol. 91:99–104. 2004. View Article : Google Scholar : PubMed/NCBI

11 

Al-Olayan EM, El-Khadragy MF, Metwally DM and Abdel Moneim AE: Protective effects of pomegranate (Punica granatum) juice on testes against carbon tetrachloride intoxication in rats. BMC Complement Altern Med. 14:1642014. View Article : Google Scholar : PubMed/NCBI

12 

Ahmed MM, Samir el-SA, El-Shehawi AM and Alkafafy ME: Anti-obesity effects of Taif and Egyptian pomegranates: Molecular study. Biosci Biotechnol Biochem. 79:598–609. 2015. View Article : Google Scholar

13 

Kaur G, Jabbar Z, Athar M and Alam MS: Punica granatum (pomegranate) flower extract possesses potent antioxidant activity and abrogates Fe-NTA induced hepatotoxicity in mice. Food Chem Toxicol. 44:984–993. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Malik A, Afaq F, Sarfaraz S, Adhami VM, Syed DN and Mukhtar H: Pomegranate fruit juice for chemoprevention and chemotherapy of prostate cancer. Proc Natl Acad Sci USA. 102:14813–14818. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Seeram NP, Adams LS, Henning SM, Niu Y, Zhang Y, Nair MG and Heber D: In vitro antiproliferative, apoptotic and antioxidant activities of punicalagin, ellagic acid and a total pomegranate tannin extract are enhanced in combination with other polyphenols as found in pomegranate juice. J Nutr Biochem. 16:360–367. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Türk G, Sönmez M, Aydin M, Yüce A, Gür S, Yüksel M, Aksu EH and Aksoy H: Effects of pomegranate juice consumption on sperm quality, spermatogenic cell density, antioxidant activity and testosterone level in male rats. Clin Nutr. 27:289–296. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Rozenberg O, Howell A and Aviram M: Pomegranate juice sugar fraction reduces macrophage oxidative state, whereas white grape juice sugar fraction increases it. Atherosclerosis. 188:68–76. 2006. View Article : Google Scholar

18 

Mertens-Talcott SU, Jilma-Stohlawetz P, Rios J, Hingorani L and Derendorf H: Absorption, metabolism and antioxidant effects of pomegranate (Punica granatum L.) polyphenols after ingestion of a standardized extract in healthy human volunteers. J Agric Food Chem. 54:8956–8961. 2006. View Article : Google Scholar : PubMed/NCBI

19 

Faria A, Monteiro R, Mateus N, Azevedo I and Calhau C: Effect of pomegranate (Punica granatum) juice intake on hepatic oxidative stress. Eur J Nutr. 46:271–278. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Adhami VM, Siddiqui IA, Syed DN, Lall RK and Mukhtar H: Oral infusion of pomegranate fruit extract inhibits prostate carcinogenesis in the TRAMP model. Carcinogenesis. 33:644–651. 2012. View Article : Google Scholar :

21 

Srivastava SP, Chen NQ and Holtzman JL: The in vitro NADPH-dependent inhibition by CCl4 of the ATP-dependent calcium uptake of hepatic microsomes from male rats. Studies on the mechanism of inactivation of the hepatic microsomal calcium pump by the CCl3radical. J Biol Chem. 265:8392–8399. 1990.PubMed/NCBI

22 

Hirano T: Interleukin 6 and its receptor: Ten years later. Int Rev Immunol. 16:249–284. 1998. View Article : Google Scholar : PubMed/NCBI

23 

Park J, Gores GJ and Patel T: Lipopolysaccharide induces cholangiocyte proliferation via an interleukin-6-mediated activation of p44/p42 mitogen-activated protein kinase. Hepatology. 29:1037–1043. 1999. View Article : Google Scholar : PubMed/NCBI

24 

Wieckowska A, Papouchado BG, Li Z, Lopez R, Zein NN and Feldstein AE: Increased hepatic and circulating interleukin-6 levels in human nonalcoholic steatohepatitis. Am J Gastroenterol. 103:1372–1379. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Coursodon-Boyiddle CF, Snarrenberg CL, Adkins-Rieck CK, Bassaganya-Riera J, Hontecillas R, Lawrence P, Brenna JT, Jouni ZE and Dvorak B: Pomegranate seed oil reduces intestinal damage in a rat model of necrotizing enterocolitis. Am J Physiol Gastrointest Liver Physiol. 303:G744–G751. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Strable MS and Ntambi JM: Genetic control of de novo lipogenesis: Role in diet-induced obesity. Crit Rev Biochem Mol Biol. 45:199–214. 2010. View Article : Google Scholar : PubMed/NCBI

27 

Liu J, Takase I, Hakucho A, Okamura N and Fujimiya T: Carvedilol attenuates the progression of alcohol fatty liver disease in rats. Alcohol Clin Exp Res. 36:1587–1599. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Jurgoński A, Fotschki B and Juśkiewicz J: Dietary strawberry seed oil affects metabolite formation in the distal intestine and ameliorates lipid metabolism in rats fed an obesogenic diet. Food Nutr Res. 59:261042015. View Article : Google Scholar

29 

Sottrup-Jensen L: Alpha-macroglobulins: Structure, shape, and mechanism of proteinase complex formation. J Biol Chem. 264:11539–11542. 1989.PubMed/NCBI

30 

Strickland DK, Kounnas MZ and Argraves WS: LDL receptor-related protein: A multiligand receptor for lipoprotein and proteinase catabolism. FASEB J. 9:890–898. 1995.PubMed/NCBI

31 

Acosta JA, Hoyt DB, Schmid-Schönbein GW, Hugli TE, Anjaria DJ, Frankel DA and Coimbra R: Intraluminal pancreatic serine protease activity, mucosal permeability, and shock: A review. Shock. 26:3–9. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Chen X, Kong X, Zhang Z, Chen W, Chen J, Li H, Cao W, Ge Y and Fang S: Alpha-2-macroglobulin as a radioprotective agent: A review. Chin J Cancer Res. 26:611–621. 2014.PubMed/NCBI

33 

Landskron G, De la Fuente M, Thuwajit P, Thuwajit C and Hermoso MA: Chronic inflammation and cytokines in the tumor microenvironment. J Immunol Res. 2014:1491852014. View Article : Google Scholar : PubMed/NCBI

34 

VanBuskirk AM, Burlingham WJ, Jankowska-Gan E, Chin T, Kusaka S, Geissler F, Pelletier RP and Orosz CG: Human allograft acceptance is associated with immune regulation. J Clin Invest. 106:145–155. 2000. View Article : Google Scholar : PubMed/NCBI

35 

Schottelius AJ, Mayo MW, Sartor RB and Baldwin AS Jr: Interleukin-10 signaling blocks inhibitor of kappaB kinase activity and nuclear factor kappaB DNA binding. J Biol Chem. 274:31868–31874. 1999. View Article : Google Scholar : PubMed/NCBI

36 

Moore KW, de Waal Malefyt R, Coffman RL and O'Garra A: Interleukin-10 and the interleukin-10 receptor. Annu Rev Immunol. 19:683–765. 2001. View Article : Google Scholar : PubMed/NCBI

37 

Fiorentino DF, Zlotnik A, Mosmann TR, Howard M and O'Garra A: IL-10 inhibits cytokine production by activated macrophages. J Immunol. 147:3815–3822. 1991.PubMed/NCBI

38 

Soliman MM, Abdo Nassan M and Ismail TA: Immunohistochemical and molecular study on the protective effect of curcumin against hepatic toxicity induced by paracetamol in Wistar rats. BMC Complement Altern Med. 14:4572014. View Article : Google Scholar : PubMed/NCBI

39 

Hou YL, Tsai YH, Lin YH and Chao JC: Ginseng extract and ginsenoside Rb1 attenuate carbon tetrachloride-induced liver fibrosis in rats. BMC Complement Altern Med. 14:4152014. View Article : Google Scholar : PubMed/NCBI

40 

Huang YH, Shi MN, Zheng WD, Zhang LJ, Chen ZX and Wang XZ: Therapeutic effect of interleukin-10 on CCl4-induced hepatic fibrosis in rats. World J Gastroenterol. 12:1386–1391. 2006. View Article : Google Scholar : PubMed/NCBI

41 

Zhang LJ, Zheng WD, Chen YX, Huang YH, Chen ZX, Zhang SJ, Shi MN and Wang XZ: Antifibrotic effects of interleukin-10 on experimental hepatic fibrosis. Hepatogastroenterology. 54:2092–2098. 2007.

42 

Pestka S, Krause CD, Sarkar D, Walter MR, Shi Y and Fisher PB: Interleukin-10 and related cytokines and receptors. Annu Rev Immunol. 22:929–979. 2004. View Article : Google Scholar : PubMed/NCBI

43 

Ramnath V, Rekha PS and Sujatha KS: Amelioration of heat stress induced disturbances of antioxidant defense system in chicken by brahma rasayana. Evid Based Complement Alternat Med. 5:77–84. 2008. View Article : Google Scholar : PubMed/NCBI

44 

Celi P: The role of oxidative stress in small ruminants health and production. R Bras Zootec. 39:348–363. 2010. View Article : Google Scholar

45 

Ramesh B and Satakopan VN: Antioxidant activities of hydroalcoholic extract of Ocimum sanctum against cadmium Induced toxicity in rats. Indian J Clin Biochem. 25:307–310. 2010. View Article : Google Scholar

46 

Yuan LP, Chen FH, Ling L, Bo H, Chen ZW, Li F, Zhong MM and Xia LJ: Protective effects of total flavonoids of Bidens bipinnata L. against carbon tetrachloride-induced liver fibrosis in rats. J Pharm Pharmacol. 60:1393–1402. 2008. View Article : Google Scholar : PubMed/NCBI

47 

Aviram M, Dornfeld L, Rosenbblat M, Volkova N, Kaplan M, Coleman R, Hayek T, Presser D and Fuhrman B: Pomegranate juice consumption reduces oxidative stress, atherogenic modifications to LDL, and platelet aggregation: Studies in humans and in atherosclerotic apolipoprotein E-deficient mice. Am J Clin Nutr. 71:1062–1076. 2000.PubMed/NCBI

48 

Pirinççioğlu M, Kızıl G, Kızıl M, Kanay Z and Ketani A: The protective role of pomegranate juice against carbon tetrachloride-induced oxidative stress in rats. Toxicol Ind Health. 30:910–918. 2014. View Article : Google Scholar

49 

Garrido C, Gurbuxani S, Ravagnan L and Kroemer G: Heat shock proteins: Endogenous modulators of apoptotic cell death. Biochem Biophys Res Commun. 286:433–442. 2001. View Article : Google Scholar : PubMed/NCBI

50 

Ikeyama S, Kusumoto K, Miyake H, Rokutan K and Tashiro S: A non-toxic heat shock protein 70 inducer, geranylgeranylacetone, suppresses apoptosis of cultured rat hepatocytes caused by hydrogen peroxide and ethanol. J Hepatol. 35:53–61. 2001. View Article : Google Scholar : PubMed/NCBI

51 

Schiaffonati L and Tiberio L: Gene expression in liver after toxic injury: Analysis of heat shock response and oxidative stress-inducible genes. Liver. 17:183–191. 1997. View Article : Google Scholar : PubMed/NCBI

52 

Lee KJ, Terada K, Oyadomari S, Inomata Y, Mori M and Gotoh T: Induction of molecular chaperones in carbon tetrachloride-treated rat liver: Implications in protection against liver damage. Cell Stress Chaperones. 9:58–68. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

April-2016
Volume 13 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ibrahim ZS, Nassan MA and Soliman MM: Ameliorative effects of pomegranate on carbon tetrachloride hepatotoxicity in rats: A molecular and histopathological study. Mol Med Rep 13: 3653-3660, 2016.
APA
Ibrahim, Z.S., Nassan, M.A., & Soliman, M.M. (2016). Ameliorative effects of pomegranate on carbon tetrachloride hepatotoxicity in rats: A molecular and histopathological study. Molecular Medicine Reports, 13, 3653-3660. https://doi.org/10.3892/mmr.2016.4956
MLA
Ibrahim, Z. S., Nassan, M. A., Soliman, M. M."Ameliorative effects of pomegranate on carbon tetrachloride hepatotoxicity in rats: A molecular and histopathological study". Molecular Medicine Reports 13.4 (2016): 3653-3660.
Chicago
Ibrahim, Z. S., Nassan, M. A., Soliman, M. M."Ameliorative effects of pomegranate on carbon tetrachloride hepatotoxicity in rats: A molecular and histopathological study". Molecular Medicine Reports 13, no. 4 (2016): 3653-3660. https://doi.org/10.3892/mmr.2016.4956