Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
May-2016 Volume 13 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2016 Volume 13 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth

  • Authors:
    • Jie Shao
    • Linghong Gan
    • Jie Wang
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Huashan Hospital, Fudan University, Shanghai 200040, P.R. China, Department of Nursing, Huashan Hospital, Fudan University, Shanghai 200040, P.R. China
  • Pages: 4303-4308
    |
    Published online on: March 31, 2016
       https://doi.org/10.3892/mmr.2016.5079
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Breast cancer affects one in every eight women, and has been associated with higher rates of female mortality than any other cancer type, with the exception of lung cancer. It has been reported that chondromodulin I (ChM-I) was able to suppress tumor angiogenesis and growth in vivo. In order to investigate the antitumor action of ChM‑I on human breast cancer cells, a plasmid expressing ChM‑I was constructed and transfected into human breast cancer cells using an adenoviral vector. Reverse transcription‑polymerase chain reaction detected ChM‑I expression in human breast cancer cell lines, whereas no expression was detected in the control groups. In order to assess the effect of ChM‑I on human breast cancer cells, cell counting kit‑8 (CCK‑8) and colony formation analyses were used to detect tumor cell proliferation, and the proliferation of ChM‑I‑transfected cells was significantly reduced, as compared with the control. In addition, the mRNA expression levels of cell cycle‑associated genes in ChM‑I‑transfected cells were significantly decreased, as compared with the control, which suggested that ChM‑I transfection was able to inhibit the expression of genes associated with the cell cycle. The results of the present study indicated that ChM‑I was able to inhibit the growth of breast cancer cells; thus suggesting that ChM-I may have potential clinical applications in the treatment of breast cancer.

Introduction

Breast cancer develops from the breast tissue. The most common type of breast cancer is ductal carcinoma, which begins in the lining of the milk ducts, while another type of breast cancer is lobular carcinoma, which begins in the lobules of the breast (1–3). Breast cancer accounts for >10% of cancer among women worldwide, and it is the leading cause of cancer-associated mortality in women aged 20–49 years (3,4). Breast cancer incidence is increasing worldwide; in the USA, ~14,000 women under the age of 40 are diagnosed with breast cancer annually and there are ~3,000 mortalities (5). Breast cancer risk factors are complex and are likely to be associated with multiple factors, including gender, age, genetics, family history of breast cancer, personal history of breast cancer, race and ethnicity (6).

Angiogenesis is essential in breast cancer progression and dissemination, and tumors have a limited ability to grow without blood supply (7,8). Therefore, inhibition of the formation of blood vasculature is an effective way to stop or slow the growth of a cancer mass. Accordingly, numerous angiogenesis inhibitors have been investigated for use in the treatment of cancer. Chondromodulin I (ChM-I), an endogenous anti-angiogenic factor expressed in cartilage, has been reported to suppress tumorigenesis in vivo, due to its anti-vascularization effect (9).

To further investigate the anti-vascularization effect and antitumor activity of ChM-I, a recombinant ChM-I expressing adenovirus vector was constructed and transfected into a human breast cancer cell line. The stable expression of ChM-I in the human breast cancer cell line was established.

Materials and methods

Patients and ethical approval

Human articular cartilage used in the present study was obtained from the femoral condyles of patients undergoing knee joint replacement surgery at Huashan Hospital, Fudan University (Shanghai, China). All experimental procedures in the present study were approved by the Ethics Committee of the Shanghai Fudan University School of Medicine (Shanghai, China).

Cell culture

The MDA-MB-231 human breast cancer cell line and 293T cells were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). The cells were cultured at 37°C under 5% CO2 in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin (all: Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA).

Construction of the human ChM-I cDNA expression vector (pcDNA3-ChM-I)

The pcDNA3-ChM-I expression vector was established, as described previously (10). Briefly, total RNA was extracted from human articular cartilage using the RNeasy Mini kit (Qiagen, Inc., Valencia, CA, USA), and was reverse transcribed into cDNA for amplification by polymerase chain reaction (PCR). The primers used to specifically amplify the ChM-I cDNA are presented in Table I and were obtained from Thermo Fisher Scientific, Inc. The cycling conditions were as follows: 94°C for 3 min, followed by 30 cycles of 94°C for 1 min, 60°C for 1 min and 72°C for 2 min, and then a final extension step at 72°C for 5 min. The PCR products were separated by 1.5% agarose gel electrophoresis and the target gene segment was retrieved and purified using the QIAquick Gel Extraction kit (cat. no. 28704; Qiagen, Inc.). The pcDNA3.1 linear plasmid (Invitrogen; Thermo Fisher Scientific, Inc.) underwent double enzyme digestion with Hind III and Not I (both from Thermo Fisher Scientific, Inc.), and the products of this reaction were connected with the ChM-I cDNA overnight at 16°C to produce the pcDNA3-ChM-I construct, which was then transformed into XL1-Blue competent bacteria (New England BioLabs, Inc., Ipswich, MA, USA). Positive bacterial colonies were selected for on Lysogeny broth media containing ampicillin (Sigma-Aldrich, St. Louis, MO, USA), and underwent plasmid extraction and purification using a commercially available kit (cat. no. 12123; Qiagen, Inc.). The extracted products were purified using the QIAquick PCR Purification kit (cat. no. 28104; Qiagen, Inc.), and sequenced (Invitrogen; Thermo Fisher Scientific, Inc.).

Table I

Primer sequences for polymerase chain reaction.

Table I

Primer sequences for polymerase chain reaction.

GenePrimer sequence (5′-3′)Product length (bp)
ChM-IF: ATCAGCAGGAAGGGGAAAGC308
R: TGGTCCCATCAGCATCAACC
Cyclin D1F: GGCGGAGGAGAACAAACAGA181
R: TGTGAGGCGGTAGTAGGACA
Cyclin D3F: ATGGAGCTGCTGTGTTG128
R: GAGAGGAGCCATCTAGACTA
CDK6F: TTCCCAGGCAGGCTTTTCAT245
R: GAAAGTTGGGCAGGCTGTAT
β-actinF: TCCATCATGAAGTGTGACGT161
R: CTCAGGAGGAGCAATGATCT

[i] ChM-I, chondromodulin I; CKD6, cyclin-dependent kinase 6.

Construction of the adenovirus ChM-I vector

The recombinant adenoviral vector was constructed according to a previously described method (11). Briefly, human ChM-I cDNA was inserted into the Xho I and EcoRV restriction sites of the pAdTrack-CMV shuttle vector (Invitrogen; Thermo Fisher Scientific, Inc.), encoding green fluorescent protein (GFP). The resultant DNA was linearized by digestion with Pme I (New England BioLabs, Inc.), and subsequently cotransformed with an adenoviral backbone plasmid (pAdEasy-1; Agilent Technologies, Inc., Santa Clara, CA, USA) into E coli BJ5183 (Invitrogen; Thermo Fisher Scientific, Inc.). Recombinants were selected on media containing kanamycin (Thermo Fisher Scientific, Inc.) and confirmed by digestion with PacI.

Transfection of 293T cells

The linearized recombinant plasmid was transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). In 293T cells, recombination between the homologous regions of the linearized transfer cosmid vector and the adenovirus genome resulted in formation of the complete adenoviral recombinant containing the ChM-I cDNA.

Measurement of virus titers

293T cells were used to measure the supernatant virus titer. The transfected 293T cells were collected and genomic DNA was extracted using the Genomic DNA Purification kit (cat. no. K0512; Thermo Fisher Scientific, Inc.). The extracted DNA was dissolved in 100 µl Tris-ethylenediaminetetraacetic acid buffer (Thermo Fisher Scientific, Inc.) and underwent quantitative (q)PCR using the Mx3000P® QPCR system (Agilent Technologies, Inc.) to determine the number of vector copies in the genomic DNA. The qPCR reaction mixture consisted of 1X Excite Real Time Mastermix with SYBR Green (cat. no. 95088-050; BioGene, Cambridge, UK), 40 nM each of ChM-I-specific sense and antisense primers (Table I), 1.6 µl genomic DNA (or distilled H2O for the control), and H2O to a final volume of 20 µl. The thermal cycler conditions included incubation at 95°C for 10 min, followed by 50 cycles of 95°C for 30 sec and 59°C for 1 min. Integration of the fluorescent SYBR green into the PCR product was monitored after each annealing step. Amplification of one specific product was confirmed by melting curve analysis, where a single melting peak eliminated the possibility of primer-dimer association. For melting curve analysis to be performed, the products were heated from 55 to 95°C after the 50 cycles.

Titers were calculated (IU/ml) according to the following formula: IU/ml = (C × N × D × 1,000) / V, where C=proviral copies per genome, N=number of cells at time of transduction, D=dilution of vector preparation and V=volume of diluted vector added in each well for transduction. To obtain an accurate titer, average values were obtained from three of the vector dilutions (12).

Transfection of the ChM-I recombinant adenovirus into MDA-MB-231 human breast cancer cells

MDA-MB-231 human breast cancer cells (5×104/ml) in the logarithmic phase were seeded into each well of a 6-well plate and divided into three groups: i) The ChM-I group (breast cancer cells transfected with ChM-I); ii) the empty vector group (breast cancer cells transfected with empty vector); and iii) the blank group (breast cancer cells).

After 12 h of culture and upon reaching 30–50% confluence, the human breast cancer cells were transfected with the ChM-I adenovirus vector. Briefly, based on the pre-established experimental multiplicity of infection (MOI), 100 µl virus or empty vector per 1 ml culture medium was added to each well. The medium was replaced with the DMEM containing 10% FBS and 1% penicillin/streptomycin after 12 h of culture. At 4 days following transfection, the transfection efficiency was calculated based on the number of GFP-positive cells under a fluorescent microscope (Eclipse 80i; Nikon Corporation, Tokyo, Japan). When the transfection efficiency had reached >80%, the cells were collected to assess the expression of ChM-I by reverse transcription (RT)-PCR. Briefly, total RNA was extracted from the cells using TRIzol reagent and treated with DNase (both Invitrogen; Thermo Fisher Scientific, Inc.), after which 1 mg RNA was reverse-transcribed into cDNA using a RT-PCR kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The PCR cycling conditions were as follows: Amplification at 94°C for 4 min, followed by 25 cycles at 60°C for 1 min, 72°C for 3 min and 94°C for 1 min. The PCR products were resolved in a 1.5% agarose gel. The forward and reverse primers for ChM-I are presented in Table I.

Cell proliferation in vitro

Cell Counting kit-8 (CCK-8; Dojindo China Co., Ltd., Beijing, China) was used to test the cell proliferation in the ChM-I, empty vector and blank groups. In total, 103 cells in 100 µl medium were seeded into each well of the 96-well plate. On days 1, 3, 5 and 7, 10 µl CCK-8 solution was added to each well prior to examination. After 3 h of culture, the absorbance was measured spectrophotometrically at 450 nm (DU® Series 700 UV/Vis Scanning Spectrophotometer (Beckman Coulter, Inc., Brea, CA, USA). These experiments were conducted at least in triplicate.

Colony formation assays

Cells in the ChM-I, empty vector and blank cell groups were cultured on 35 mm culture plates as described (9). The cells were detached and suspended in culture medium containing 0.68% malting agar (Sigma-Aldrich). The cell suspension was then plated on culture medium containing 0.4% agarose that had been allowed to harden beforehand. The culture medium was changed every 2–3 days. The numbers of colonies were measured under a phase contrast microscope (Olympus CX31; Olympus Soft Imaging Solutions GmbH, Münster, Germany) on days 7, 14 and 21 of culture. The experiment was conducted in triplicate.

Analysis of the mRNA expression levels of cell-cycle associated genes in target cells

RT-qPCR was used to investigate the mRNA expression levels of genes associated with the cell-cycle. Briefly, total RNA was extracted from the human breast cancer cells using TRIzol reagent, according to the manufacturer's protocol. RNA was reverse transcribed into cDNA using the Reverse Transcription kit (Qiagen, Inc.). PCR was performed in a qPCR detection system (Bio-Rad Laboratories, Hercules, CA, USA) and conducted with iQ SYBR Green Supermix (Bio-Rad). The primer sequences are presented in Table I. The cycling conditions were as follows: One cycle at 50°C for 2 min; one cycle at 95°C for 10 min; 40 cycles at 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec; and one cycle at 72°C for 10 min. Amplification reactions were performed in duplicate and the amount of cDNA in the reactions was normalized to β-actin. The specificity of the amplification was confirmed by 2% agarose gel electrophoresis and by analysis of the melting curves. An amplification reaction control with no reverse transcriptase enzyme was performed in order to assess the interference of potential genomic DNA in the RNA solution. Relative mRNA expression levels were calculated using the 2−ΔΔCq method (13).

Statistical analysis

Data are presented as the mean ± standard deviation. Data were analyzed using the SPSS 17.0 software (SPSS Inc., Chicago, IL, USA). One-way analysis of variance followed by Fisher's Least Significant Difference test were used to assess differences among groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Transfection of the ChM-I recombinant adenovirus in 293T cells

The ChM-I recombinant adenovirus was transfected into 293T cells. Fluorescence microscopy was used to GFP fluorescence following transfection, and the transfection rate was >95% (Fig. 1). RT-qPCR was used to determine the number of vector copies associated with genomic DNA extracted from transduced 293T cells. Vector copy numbers in 293T cells are normalized to human RNaseP gene copies and presented as proviral copies per genome equivalent. The average value obtained from 3 of the vector dilutions was 5.19×109 IU/ml (Table II).

Figure 1

Green fluorescent protein expression after transfection of Ad-chondromodulin I into 293T cells (A) Bright field. (B) Dark field (magnification, ×40).

Table II

Virus titer calculation.

Table II

Virus titer calculation.

SampleVCNDIUMean
110261.752×10515.23E+095.19E±09
2120.052×10514.10E+09
30.13.12 2×10516.24E+09

[i] IU/ml=(CxNxDx1,000)/V, where C=proviral copies per genome, N=number of cells at time of transduction, D=dilution of vector preparation, V=volume (ml) of diluted adenovirus sample added into each well for transduction.

Transfection of the ChM-I recombinant adenovirus in human breast cancer cells

The ChM-I recombinant adenovirus was successfully transfected and expressed constitutively in human breast cancer cells. The expression of GFP was observed in the experimental group under fluorescence microscope examination. Following recombinant adenovirus transfection for 7 days in human breast cancer cells, the transfection rate was >90% (Fig. 2). The result of RT-qPCR showed that expression of ChM-I was observed in the ChM-I transfected cell group, while no expression was identified in the in control groups (Fig. 3).

Figure 2

Transfection of Ad-Chm-I in human breast cancer cells. Ad-ChM-I was successfully transfected and expressed in human breast cancer cells. The expression of green fluorescent protein was observed under a fluorescence microscope, and the transfection rate was >90%. (A) Bright field. (B) Dark field (magnification, ×40). ChM-I:, chondromodulin I.

Figure 3

ChM-I expression in human breast cancer cells by RT-PCR. The production of the RT-PCR was detected by 1% agarose gel electrophoresis. ChM-I strongly expressed in the ChM-I group (~1,000 bp). RT-PCR, reverse transcription-polymerase chain reaction; ChM-I, chondromodulin I.

Ad-ChM-I inhibits the growth of human breast cancer cells in vitro

Compared with the two other groups, there was a significantly decrease in the cell growth of human breast cancer cell lines transfected with Ad-ChM-I cultures, indicating that ChM-I suppresses the proliferation of breast cancer cells (Fig. 4A).

Figure 4

Growth and colony formation assay of human breast cancer cells in vitro. (A) There was a significant decrease in the cell growth of human breast cancer cells transfected with Ad-ChM-I cultures (P<0.05). (B) Ad-ChM-I infection suppressed the number of colonies of the human breast cancer cells. Data are presented as the mean ± standard deviation. *P<0.05 vs. the blank and empty vector groups. OD, optical density; ChM-I, chondromodulin I.

Colony formation assay

A colony formation assay was conducted. Ad-ChM-I infection markedly suppressed the number of colonies of human breast cancer cells, a result that was consistent with the in vitro CCK-8 results (Fig. 4B).

ChM-I suppresses the expression of cell cycle-related genes in human breast cancer cells

To investigate the mechanism of ChM-I-induced suppression of tumor cell growth, the expression levels of cell cycle-related genes in human breast cancer cells were examined in vitro by RT-qPCR analysis. As shown in Fig. 5, Ad-ChM-I inhibited the levels of certain cell cycle-related genes after infection, the levels of cyclin D1, cyclin D3, and cyclin-dependent kinase (CDK)6 were significantly decreased by Ad-ChM-I.

Figure 5

Results of reverse transcription-quantitative polymerase chain reaction analysis. The cells transfected with Ad-ChM-I exhibited a significant decrease in the mRNA expression of (A) cyclin D1, (B) cyclin D3 and (C) CDK6, compared with the control groups (*P<0.05). No difference was identified between the levels in the blank group and the empty vector group (P>0.05). CDK6, cyclin-dependent kinase 6; ChM-I, chondromodulin I.

Discussion

Angiogenesis is essential in tumor development and subsequent growth, invasion and metastasis (14). Tumors require a blood supply to grow and spread, and blood vessels are required for tumors to grow beyond a few millimeters in size. Tumors can secrete chemical signals that stimulate angiogenesis to form blood vessels to increase supply. In addition, tumors can also stimulate nearby normal cells to produce angiogenesis signaling molecules (15,16).

Among the various angiogenic factors that are involved in tumor development, vascular endothelial growth factor (VEGF) is the most prominent (17,18). Thereby VEGF has been considered as a therapeutic target, and angiogenesis inhibitors have been designed to prevent the formation of novel blood vessels, to stop or slow the growth or spread of tumors (19,20). Accordingly, a variety of drugs blocking VEGF signal have been developed in recent years (21,22).

ChM-I is a 25-kDa glycoprotein, which contains two distinctive structural domains: The N-terminal third of the molecule is a hydrophilic domain that contains O-linked and N-linked oligosaccharide chains, and the C-terminal two-thirds is a hydrophobic domain that contains all of the cysteine residues, and is considered as an effective anti-vascualarization factor (23). Hakuno et al (24) reported that ChM-I is a crucial factor for maintaining normal cardiac valvular function by preventing angiogenesis that may lead to valvular heart diseases. Klinger et al (25) showed that CmH-I stabilizes the chondrocyte phenotype and inhibits endochondral ossification of porcine cartilage repair tissue. Mera et al (9) reported that ChM-I directly suppresses the proliferation of tumor cells in an anchorage-independent manner. In addition, Hiraki et al (26) reported that ChM-I was identified as an angiogenesis inhibitor, and found that ChM-I is specifically expressed in the avascular zone of cartilage in developing bone, but not present in calcifying cartilage. Purified ChM-I inhibited DNA synthesis and proliferation of vascular endothelial cells as well as tube morphogenesis in vitro (26).

The central importance of tumor neovascularization has been emphasized by experimental and clinical trials in various tumor types (27,28), and ChM-I has been shown to exhibit anti-vascularization action, thus, the present study aimed to transfect ChM-I into human breast cancer cells in order to investigate the effects of ChM-I.

In the present study, an adenoviral vector expressing ChM-I was constructed. Use of adenoviral vectors offers multiple advantages for gene replacement therapy, as they combine efficient delivery, an ability to transduce proliferating and non-proliferating cells, a capacity to integrate into the host chromatin to provide stable long-term expression of the transgene, an absence of any viral genes in the vector and an absence of interference from preexisting viral immunity (29). In the present study, ChM-I was successfully transfected into breast cancer cells and stably expressed. The effect of ChM-I on the proliferation on breast cancer cells was analyzed using CCK-8 and colony forming assays. It was demonstrated that ChM-I had a significant inhibitory effect on breast cancer cell proliferation. It is has previously been shown that cyclin D1, cyclin D3 and CDK6 are able to promote cell division, therefore, the expression of these genes was analyzed following ChM-I transfection. Ad-ChM-I significantly decreased the mRNA expression levels of cyclin D1, cyclin D3 and CDK6. These results suggested that ChM-I had a significant inhibitory effect on breast cancer cell division and proliferation.

In conclusion, recombinant ChM-I was successfully constructed and transfected into human breast cancer cells, wherein it was shown to be stably expressed. The in vitro results suggested that ChM-I was able to inhibit the growth of human breast cancer cells. Further in vivo studies are required to explore the role of ChM-I in human breast cancer cells.

Acknowledgments

This study was supported by the National Natural Science Fund of China (grant no. 81072188).

References

1 

Brinton LA, Smith L, Gierach GL, Pfeiffer RM, Nyante SJ, Sherman ME, Park Y, Hollenbeck AR and Dallal CM: Breast cancer risk in older women: Results from the NIH-AARP diet and health study. Cancer Causes Control. 25:843–857. 2014. View Article : Google Scholar : PubMed/NCBI

2 

National Cancer Institute: Breast cancer. What You Need To Know About. National Institutes of Health; Bethesda, MD: 2012

3 

Nyante SJ, Dallal CM, Gierach GL, Park Y, Hollenbeck AR and Brinton LA: Risk factors for specific histopathological types of postmenopausal breast cancer in the NIH-AARP diet and health study. Am J Epidemiol. 178:359–371. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Sasco AJ: Breast cancer and the environment. Horm Res. 60(Suppl 3): S502003. View Article : Google Scholar

5 

Ruddy KJ, Greaney ML, Sprunck-Harrild K, Meyer ME, Emmons KM and Partridge AH: Young women with breast cancer: A focus group study of unmet needs. J Adolesc Young Adult Oncol. 2:153–160. 2013. View Article : Google Scholar :

6 

John EM, Hopper JL, Beck JC, Knight JA, Neuhausen SL, Senie RT, Ziogas A, Andrulis IL, Anton-Culver H, Boyd N, et al: The breast cancer family registry: An infrastructure for cooperative multinational, interdisciplinary and translational studies of the genetic epidemiology of breast cancer. Breast Cancer Res. 6:R375–R389. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Fantozzi A and Christofori G: Mouse models of breast cancer metastasis. Breast Cancer Res. 8:2122006. View Article : Google Scholar : PubMed/NCBI

8 

Zetter BR: Angiogenesis and tumor metastasis. Annu Rev Med. 49:407–424. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Mera H, Kawashima H, Yoshizawa T, Ishibashi O, Ali MM, Hayami T, Kitahara H, Yamagiwa H, Kondo N, Ogose A, et al: Chondromodulin-1 directly suppresses growth of human cancer cells. BMC Cancer. 9:1662009. View Article : Google Scholar : PubMed/NCBI

10 

Xing S, Wang Z, Xi H, Zhou L, Wang D, Sang L, Wang X, Qi M and Zhai L: Establishment of rat bone mesenchymal stem cell lines stably expressing Chondromodulin I. Int J Clin Exp Med. 5:34–43. 2012.PubMed/NCBI

11 

Lin L, Fu X, Zhang X, Chen LX, Zhang JY, Yu CL, Ma KT and Zhou CY: Rat adipose-derived stromal cells expressing BMP4 induce ectopic bone formation in vitro and in vivo. Acta Pharmacol Sin. 27:1608–1615. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Wang S, Zeng X, Liu Y, Liang C, Zhang H, Liu C, Du W and Zhang Z: Construction and characterization of a PDCD5 recombinant lentivirus vector and its expression in tumor cells. Oncol Rep. 28:91–98. 2012.PubMed/NCBI

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

14 

Zheng K, Li HY, Su XL, Wang XY, Tian T, Li F and Ren GS: Chemokine receptor CXCR7 regulates the invasion, angiogenesis and tumor growth of human hepatocellular carcinoma cells. J Exp Clin Cancer Res. 29:312010. View Article : Google Scholar : PubMed/NCBI

15 

Nishida N, Yano H, Nishida T, Kamura T and Kojiro M: Angiogenesis in cancer. Vasc Health Risk Manag. 2:213–219. 2006. View Article : Google Scholar

16 

Wels J, Kaplan RN, Rafii S and Lyden D: Migratory neighbors and distant invaders: Tumor-associated niche cells. Genes Dev. 22:559–574. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Hoeben A, Landuyt B, Highley MS, Wildiers H, Van Oosterom AT and De Bruijn EA: Vascular endothelial growth factor and angiogenesis. Pharmacol Rev. 56:549–580. 2004. View Article : Google Scholar : PubMed/NCBI

18 

Neufeld G, Cohen T, Gengrinovitch S and Poltorak Z: Vascular endothelial growth factor (VEGF) and its receptors. FASEB J. 13:9–22. 1999.PubMed/NCBI

19 

Ferrara N: Vascular endothelial growth factor as a target for anticancer therapy. Oncologist. 9(Suppl 1): S2–S10. 2004. View Article : Google Scholar

20 

Ferrara N: VEGF as a therapeutic target in cancer. Oncology. 69(Suppl 3): S11–S16. 2005. View Article : Google Scholar

21 

Shibuya M: VEGF-VEGFR signals in health and disease. Biomol Ther (Seoul). 22:1–9. 2014. View Article : Google Scholar

22 

Ma J and Waxman DJ: Combination of antiangiogenesis with chemotherapy for more effective cancer treatment. Mol Cancer Ther. 7:3670–3684. 2008. View Article : Google Scholar : PubMed/NCBI

23 

Miura S, Kondo J, Kawakami T, Shukunami C, Aimoto S, Tanaka H and Hiraki Y: Synthetic disulfide-bridged cyclic peptides mimic the anti-angiogenic actions of chondromodulin-I. Cancer Sci. 103:1311–1318. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Hakuno D and Fukuda K: Role of anti-angiogenic factor chondromodulin-I for maintaining cardiac valvular function. Clin Calcium. 17:361–372. 2007.In Japanese. PubMed/NCBI

25 

Klinger P, Surmann-Schmitt C, Brem M, Swoboda B, Distler JH, Carl HD, von der Mark K, Hennig FF and Gelse K: Chondromodulin 1 stabilizes the chondrocyte phenotype and inhibits endochondral ossification of porcine cartilage repair tissue. Arthritis Rheum. 63:2721–2731. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Hiraki Y, Inoue H, Iyama K, Kamizono A, Ochiai M, Shukunami C, Iijima S, Suzuki F and Kondo J: Identification of chondromodulin I as a novel endothelial cell growth inhibitor. Purification and its localization in the avascular zone of epiphyseal cartilage. J Biol Chem. 272:32419–32426. 1997. View Article : Google Scholar

27 

Fox SB, Generali DG and Harris AL: Breast tumour angiogenesis. Breast Cancer Res. 9:2162007. View Article : Google Scholar

28 

Miller KD: Recent translational research: Antiangiogenic therapy for breast cancer - where do we stand? Breast Cancer Res. 6:128–132. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Muruve DA: The innate immune response to adenovirus vectors. Human Gene Ther. 15:1157–1166. 2004. View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Shao J, Gan L and Wang J: Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth. Mol Med Rep 13: 4303-4308, 2016.
APA
Shao, J., Gan, L., & Wang, J. (2016). Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth. Molecular Medicine Reports, 13, 4303-4308. https://doi.org/10.3892/mmr.2016.5079
MLA
Shao, J., Gan, L., Wang, J."Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth". Molecular Medicine Reports 13.5 (2016): 4303-4308.
Chicago
Shao, J., Gan, L., Wang, J."Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth". Molecular Medicine Reports 13, no. 5 (2016): 4303-4308. https://doi.org/10.3892/mmr.2016.5079
Copy and paste a formatted citation
x
Spandidos Publications style
Shao J, Gan L and Wang J: Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth. Mol Med Rep 13: 4303-4308, 2016.
APA
Shao, J., Gan, L., & Wang, J. (2016). Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth. Molecular Medicine Reports, 13, 4303-4308. https://doi.org/10.3892/mmr.2016.5079
MLA
Shao, J., Gan, L., Wang, J."Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth". Molecular Medicine Reports 13.5 (2016): 4303-4308.
Chicago
Shao, J., Gan, L., Wang, J."Transfection of chondromodulin I into human breast cancer cells and its effect on the inhibition of cancer cell growth". Molecular Medicine Reports 13, no. 5 (2016): 4303-4308. https://doi.org/10.3892/mmr.2016.5079
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team