Open Access

Epidermal growth factor receptor kinase substrate 8 promotes the metastasis of cervical cancer via the epithelial-mesenchymal transition

  • Authors:
    • Qian Li
    • Wei Bao
    • Qiong Fan
    • Wen‑Jing Shi
    • Zhu‑Nan Li
    • Ying Xu
    • Dan Wu
  • View Affiliations

  • Published online on: August 18, 2016     https://doi.org/10.3892/mmr.2016.5638
  • Pages: 3220-3228
  • Copyright: © Li et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Epidermal growth factor receptor pathway substrate 8 (Eps8) has been identified as a novel substrate for epidermal growth factor receptor (EGFR) kinase and is involved in EGFR‑mediated signaling pathways correlated with tumorigenesis, proliferation and metastasis in various cancer types. However, the precise role of Eps8 in cervical cancer metastasis remains to be elucidated. Immunohistochemistry revealed that Eps8 was significantly increased in cervical cancer specimens compared with squamous intraepithelial lesion and normal cervical tissues. Additionally, it was revealed that Eps8 expression not only correlated with cervical cancer progression, but also exhibited a close correlation with the epithelial‑mesenchymal transition (EMT) markers, E‑cadherin and vimentin. Furthermore, the present study focused predominantly on the EMT‑associated role of Eps8 in the EMT, migration and invasion of cervical cancer cells. Eps8‑short hairpin (sh)RNA was transfected into HeLa and SiHa cells to deplete its expression, and reverse transcription-quantitative polymerase chain reaction and western blot analyses were performed to confirm Eps8‑knockdown and to investigate the influence of Eps8 on EMT markers. The present findings have revealed that Eps8 silencing led to the upregulation of the epithelial marker E‑cadherin, while expression of the mesenchymal marker vimentin and the transcription factor snail was decreased at both mRNA and protein expression levels. Transwell cell migration and Matrigel invasion assays showed that downregulation of Eps8 significantly inhibited cell migration and invasion of HeLa and SiHa cells. Taken together, these results suggested that Eps8 promotes cervical cancer metastasis by orchestrating the EMT.

Introduction

Despite the great progress that has been made in early screening of cervical cancer programs, cervical cancer remains the leading cause of gynecological cancer-associated mortalities worldwide (1). Persistent high-risk human papilloma virus infection is suggested to be the prerequisite for cervical cancer (2); however, the virus alone is insufficient for the development of cervical cancer, suggesting that other molecular events are involved in the initiation and progression of cervical cancer (3). The expression of molecules associated with tumor invasion and metastasis indicate an unfavorable prognosis (4). The present understanding of the molecular mechanisms contributing to the invasion-metastasis of cervical cancer remains limited, although accumulating evidence suggests that the epithelial-mesenchymal transition (EMT) serves a pivotal role in the initial step of tumor invasion-metastasis (5). Consequently, the EMT has become the focus of cervical cancer metastasis research.

The EMT is a process of switching the epithelial cell phenotype to a more loosely fibroblast-like phenotype (6). This is coupled with the loss of cell polarity and intercellular junctions, remodeling of the cytoskeleton and alteration of various EMT-related markers, including downregulation of epithelial markers, including E-cadherin, and upregulation of the mesenchymal markers N-cadherin and vimentin (6). These changes provide cancer cells with elevated invasive/metastatic capacities and therapeutic resistance (7).

Epidermal growth factor receptor pathway substrate 8 (Eps8) was initially identified as a novel substrate for epidermal growth factor receptor (EGFR) kinase (8). Overexpression of Eps8 facilitates enhanced mitogenesis and malignant transduction via EGFR-mediated activation of downstream signaling pathways (9). Previous studies have revealed that Eps8 is highly expressed in various human tumor types, including colorectal, pituitary, oral, esophageal, pancreatic, ovarian, lung, breast, thyroid and cervical cancer (1017). Eps8 overexpression has also been shown to be involved in numerous signaling pathways associated with tumorigenesis, metastasis and proliferation of cancer, and represents an unfavorable prognostic biomarker in patients with cancer (10,1214,17).

Epithelial growth factor (EGF) is suggested to be one of the most potent EMT regulatory factors in cervical cancer. Overexpression of EGFR in cervical cancer indicates poor clinical prognosis and EGF-mediated EMT may account for this (1820). More recent studies have shown that chemoresistance is associated with the EMT in cancer cells, and the acquired chemotherapeutic resistance is often accompanied by the transformation from the epithelial to the mesenchymal phenotype in cancer cells (2123). Chen et al (17) found that Eps8 knockdown contributes to increased sensitivity to chemotherapy. Based on these findings, it was hypothesized that Eps8 is associated with the process of EMT in cervical cancer.

In the present study, immunohistochemistry was used to detect the expression of Eps8 in different cervical samples. Correlations between Eps8 expression and the clinicopathological characteristics, as well as EMT associated proteins in cervical cancer tissues were further analyzed. RNA interference (RNAi) was applied to inhibit the expression of Eps8 in cervical cancer cells, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analyses were performed to investigate the influence of Eps8 knockdown on EMT markers at the mRNA and protein expression levels. Transwell cell migration and Matrigel invasion assays were used to investigate the effects of Eps8-knockdown on the capacity of invasive and migration in HeLa and SiHa cells.

Materials and methods

Cell culture and clinical specimens

Human HeLa and SiHa cervical cancer cell lines were purchased from the Cell Bank of China (Shanghai, China) and were maintained in Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) and 1% penicillin/streptomycin solution (Gibco; Thermo Fisher Scientific, Inc.). The cells were cultured at 37°C in a humidified atmosphere containing 5% CO2.

A total of 134 paraffin-embedded cervical specimens, including 16 normal cervical epithelia (NC), 25 low-grade squamous intraepithelial lesion (LSIL), 30 high-grade squamous intraepithelial lesion (HSIL) and 63 squamous cervical cancer (SCC) specimens, were obtained from the Pathology Department at the International Peace Maternity and Child Health Hospital of the China Welfare Institute (Shanghai, China) between 2008 and 2014. The age of the patients was between 29 and 68 years (mean age, 42 years). The NC specimens were obtained from patients who underwent hysterectomies for uterine fibroids, the LSIL and HSIL specimens were obtained from patients who underwent cervical conization. None of the patients enrolled in the present study received preoperative chemotherapy, radiotherapy or immunotherapy. The tumor clinical stages and clinicopathological classifications were based on the International Federation of Gynecology and Obstetrics (FIGO) criteria. Approval for the use of these specimens was granted by the Ethics Committee of the International Peace Maternity and Child Health Hospital of the China Welfare Institute. The main clinical characteristics of the patients with cervical cancer are summarized in Table I.

Table I

Correlation between the clinicopathological characteristics, and the expression levels of Eps8, E-cadherin and vimentin in patients with cervical cancer.

Table I

Correlation between the clinicopathological characteristics, and the expression levels of Eps8, E-cadherin and vimentin in patients with cervical cancer.

CharacteristicNo. patientsEps8 expression
E-cadherin expression
Vimentin expression
NegativeLowHighP-valueNegativeLowHighP-valueNegativeLowHighP-value
Age0.5030.8160.240
 ≤45 years26261851470917
 >45 years3785241114126724
FIGO stage0.0720.4910.979
 I4189248211221326
 II2222188774315
Histological grade0.0010.1040.508
 Well12633246156
 Moderate413731122184928
 Poor10118235127
Invasive interstitial depth<0.0010.0150.005
 <1/216844259547
 ≥1/247273814231011036
Lymph node metastases0.0090.0060.015
 Negative469112615211061525
 Positive1710161790116

[i] FIGO, International Federation of Gynecology and Obstetrics.

Immunohistochemical analysis

Immunohistochemical staining was performed on 4 µm thick paraffin-embedded tissue sample sections. Briefly, the sections were dewaxed with xylene twice for 15 min and rehydrated through a graded alcohol series (100, 90 and 70%) at room temperature. Antigen retrieval was performed using citrate buffer (pH 6.0) at 95°C for 15 min and endogenous peroxidase activity was quenched by immersion in 3% H2O2 for 10 min at room temperature. Subsequently, tissue sections were blocked by incubation in 1% bovine serum albumin (BSA; Beyotime Institute of Biotechnology, Beijing, China) for 30 min at room temperature to prevent non-specific binding. The tissue sections were then incubated at 4°C overnight with anti-Eps8 (1:200; ab203272; Abcam, Cambridge, UK), anti-E-cadherin (1:300; 3195S; Cell Signaling Technology, Inc., Danvers, MA, USA) and anti-vimentin (1:200; 5741S; Cell Signaling Technology, Inc.) primary rabbit monoclonal antibodies. Following incubation with the primary antibodies, the tissues sections were incubated at 37°C for 30 min with horseradish peroxidase-conjugated goat anti-rabbit secondary antibody (1:500; GTX26721; GeneTex Inc., Irvine, CA, USA). The 3,3′-diaminobenzidine substrate was applied to visualize the immunoreactivity prior to counterstaining the slides with 10% hematoxylin, dehydrating in graded ethanol and cleared in xylene. For negative controls, phosphate-buffered saline was substituted for the primary antibodies. The expression levels were evaluated by two pathologists in a blinded manner. The protein expression levels of Eps8, E-cadherin and vimentin were scored semi-quantitatively by multiplying the 'percent positivity score' by the 'staining intensity score'. The percent positivity was scored according to the following criteria: 0, <10%; 1, 10–24%; 2, 25–50%; 3, >50% positive tumor cells. Staining intensity was graded as 0, no staining; 1, weak staining; 2, moderate staining; or 3, strong staining. The final score was defined as follows: 0, negative; 1–4, low expression; 5–12, high expression.

Transient transfection

The short hairpin (sh)RNA sequence targeting Eps8 (Eps8-shRNA: 5′-GCTGTGAGCCTGATTGATTTA-3′) and the negative control shRNA were synthesized and cloned into the pGPU6/green fluorescent protein (GFP)/Neo vector (GenePharma, Shanghai, China). The HeLa (2×105) or SiHa (4×105) cells were grown in 6-well plates at 70–80% confluence prior to transient transfection with a mixture of Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) and Eps8 shRNA or control shRNA, according to the manufacturer's instructions. Following incubation for 6 h, the transfection medium was replaced with regular medium and after 48 h, GFP expression was evaluated by fluorescent microscopy (Zeiss Axioskop 40; Zeiss, Oberkochen, Germany), for the qualitative assessment of the transfection efficiency. The cells were harvested at 48 h post-transfection for RNA analyses and at 72 h post-transfection for protein analyses to confirm the downregulation of Eps8 expression.

RNA extraction and RT-qPCR

The total RNA from HeLa and SiHa cells was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). The extracted RNA (2 µg) was reverse-transcribed into cDNA using the Prime Script RT reagent kit (Takara Bio, Inc., Dalian, China), according to the manufacturer's protocol. RT-qPCR was then performed in Eps8-silenced and control cells using the cDNA as a template and the SYBR Green PCR kit (Takara Bio, Inc.), according to the manufacturer's protocol. All primers used in this experiments were designed using Premier 5.0 software and their sequences are listed in Table II. The PCR reaction conditions were as follows: 95°C for 3 min, followed by 40 cycles at 95°C for 10 sec and 60°C for 30 sec. The target gene expression levels were normalized against that of GAPDH. Quantification of the relative expression of target genes was calculated using the comparative 2−ΔΔCq method (24). All experiments were performed in triplicate.

Table II

Quantitative polymerase chain reaction primer sequences.

Table II

Quantitative polymerase chain reaction primer sequences.

GeneSequence (5′-3′)
Eps8
 Forward TGAATGGCTACGGATCATCACC
 Reverse: CACTGTCCCGTGCATAATTCT
E-cadherin
 Forward CGAGAGCTACACGTTCACGG
 Reverse GGGTGTCGAGGGAAAAATAGG
Vimentin
 Forward GACGCCATCAACACCGAGTT
 Reverse CTTTGTCGTTGGTTAGCTGGT
Snail
 Forward TCGGAAGCCTAACTACAGCGA
 Reverse AGATGAGCATTGGCAGCGAG
GAPDH
 Forward GGAGCGAGATCCCTCCAAAAT
 Reverse GGCTGTTGTCATACTTCTCATGG

[i] Esp8, epidermal growth factor receptor kinase substrate 8; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Western blot analysis

HeLa and SiHa cells were harvested and washed twice using ice-cold PBS. The cells were subsequently lysed on ice for 30 min with radioimmunoprecipitation buffer (Beyotime Institute of Biotechnology, Beijing, China), containing 1 mM phenylmethanesulfonyl fluoride. The lysates were subsequently centrifuged at 12,000 × g at 4°C for 15 min. The protein concentrations were measured using bicinchoninic acid protein assays (Beyotime Biotechnology). Equivalent quantities (60 µg) of total protein were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel and blotted onto a polyvinylidene membrane (EMD Millipore, Billerica, MA, USA). Following blocking in 5% BSA at room temperature for 2 h, the membranes were incubated overnight at 4°C with the following primary rabbit monoclonal antibodies: Anti-Eps8 (1:1,000; Abcam), anti-E-cadherin (1:1,000; Cell Signaling Technology, Inc.), anti-vimentin (1:1,000; Cell Signaling Technology, Inc.) and anti-GAPDH (1:2,000; Tiangen Biotech Co., Ltd., Beijing, China). The membranes were washed in Tris-buffered saline containing 0.1% Tween-20 three times and were subsequently incubated with horseradish peroxidase-conjugated goat-anti-rabbit secondary antibody (1:2,000; GeneTex Inc.) for 1 h at room temperature. Target protein bands were visualized by electrochemical luminescence using an Enhanced Chemiluminescence Plus kit (Beyotime Institute of Biotechnology), according to the manufacturer's protocol. The levels of target proteins were normalized against that of GAPDH using Image Pro Plus 6.0.

Cell migration and invasion assays

The migration/invasion assay was performed using 24-well Transwell chambers (Corning, Inc., Glendale, AZ, USA) containing polycarbonate filters (8 µm pore size) that were uncoated/coated with Matrigel (BD Biosciences, Hercules, CA, USA). At 48 h after transfection, 2×104 cells were resuspended in 200 µl serum-free DMEM medium with 0.1% BSA and were added to the upper chambers, while 500 µl DMEM with 20% FBS was placed in the lower chambers. Following incubation for 24 h, the non-migratory/non-invasive cells on the upper chamber surface were wiped off using a cotton swab and the cells that had migrated/invaded to the lower membrane surface were fixed for 20 min in 4% paraformaldehyde, and stained for 15 min with 0.1% crystal violet. A total of 10 random visual fields were selected under an inverted microscope (magnification, ×200) to capture images and count the number of migrated/invading cells. Each assay was performed in triplicate.

Statistical analysis

Each experiment was performed in triplicate. SPSS 17.0 software was used to perform statistical analysis. The data are presented as the mean ± standard deviation. Kruskal-Wallis one-way analysis of variance or Student's unpaired t-test was applied to evaluate significant differences. Correlations were assessed using the Pearson's correlation coefficient test. P<0.05 was considered to indicate a statistically significant difference.

Results

Expression levels of Eps8, E-cadherin and vimentin in the normal cervix, LSIL, HSIL and SCC

To investigate the expression of Eps8 and its association with EMT-related proteins, immunohistochemistry was performed using Eps8, E-cadherin and vimentin antibodies in NC, LSIL, HSIL and SCC (Fig. 1A). Eps8 and vimentin were predominantly localized in the cytoplasm of cervical cancer tissues, and were absent from the 16 normal cervix samples. Weak expression of Eps8 and vimentin was observed in 12/25 (48.0%) LSIL specimens, and 13/30 (43.3%) and 15/30 (50.0%) of the 30 HSIL specimens, respectively. Of the 63 SCC cases, the staining intensity of Eps8 was weak and strong in 11 (17.5%) and 42 (66.7%) specimens, respectively. In addition, vimentin was expressed weakly in 16 cases (25.4%) and strongly in 41 cases (65.1%). E-cadherin was expressed predominantly in the plasma membrane of epithelial cells in the NC. Based on the expression scores, the percentage of high E-cadherin-expressing samples decreased gradually from 87.5% (14/16) in NC, >72.0% (18/25) in LSIL and >60.0% (18/30) in HSIL to 30.2% (19/63) in SCC (Fig. 1B).

Association of the expression levels of Eps8, E-cadherin, vimentin with the clinicopathological characteristics of patients with SCC

As shown in Table II, Eps8 expression was significantly associated with histological grade (P=0.001), invasive interstitial depth (P<0.001) and lymph node metastases (P=0.009). However, little association was demonstrated between the expression of Eps8 and age (P=0.503), and FIGO stage (P=0.072). The expression levels of E-cadherin and vimentin demonstrated a marked correlation with invasive interstitial depth (P=0.015 and P=0.005, respectively) and lymph node metastases (P=0.006 and P=0.015, respectively).

Expression of Eps8 correlates with EMT-related proteins in cervical cancer samples

The present study further explored correlations between the expression of Eps8 and EMT marker proteins in 63 samples of cervical SCC tissues. In accordance with the changes in the expression of proteins during the EMT process, the reduced expression of E-cadherin was significantly associated with the increased expression of vimentin (P=0.001; r=−0.398). Furthermore, a significant negative correlation was observed between the expression levels of E-cadherin and Eps8 (P=0.004; r=−0.355), and the expression of Eps8 correlated positively with that of vimentin (P<0.001; r= 0.562) (Table III). These analyses suggested that Eps8 is associated with the expression of the EMT-related proteins and may be an important indicator of the EMT process in cervical cancer.

Table III

Association between the expression levels of Eps8, E-cadherin and vimentin in patients with cervical cancer.

Table III

Association between the expression levels of Eps8, E-cadherin and vimentin in patients with cervical cancer.

DefinitionEps8 expression
Vimentin expression
NegativeLowHighP-valuerNegativeLowHighP-valuer
E-cadherin expression0.004−0.3550.001−0.398
 Negative21131213
 Low23231522
 High676496
Vimentin expression<0.0010.562
 Negative600
 Low394
 High1238
Knockdown of Eps8 led to increased expression of epithelial markers and reduced expression of mesenchymal markers

To further characterize the role of Eps8 in the process of the EMT in cervical cancer, Eps8-targeting shRNA and control shRNA plasmids were designed and transiently transfected into HeLa and SiHa cells. To confirm Eps8-knockdown and to investigate the influence of Eps8 on EMT markers, RT-qPCR and western blot analyses were performed in Eps8-inhibited cell lines and control cells. As shown in Fig. 2, Eps8 expression in Eps8-inhibited cell lines was significantly downregulated at both the mRNA and protein expression levels compared with the control cells. RT-qPCR analysis demonstrated that knockdown of Eps8 led to increased expression of the epithelial marker, E-cadherin, and decreased expression of the mesenchymal marker, vimentin, as well as a key EMT inducer, snail, at the mRNA level (Fig. 2A). Additionally, western blot analysis revealed that the inhibition of Eps8 resulted in downregulated protein expression of vimentin and snail (Fig. 2B). Taken together, these results revealed that Eps8 is involved in EMT progression and that inhibition of Eps8 impairs the process of the EMT in cervical cancer.

Eps8 silencing represses cell migration and invasion

The present study subsequently performed Transwell cell migration and Matrigel invasion assays to investigate the effects of Eps8 knockdown on the regulation of cell migration and invasion in HeLa and SiHa cells. As shown in Fig. 3, the Transwell migration assay demonstrated that Eps8 knockdown notably inhibited the migration capacity of the Eps8 shRNA transfected cells compared with that of the control cells (P<0.01; Fig. 3). Matrigel invasion assays also demonstrated that transfection with Eps8 shRNA plasmids effectively impaired the invasive capacity of HeLa and SiHa cells (P<0.01; Fig. 3). These results suggested that Eps8 knockdown decreases the migration and invasiveness of HeLa and SiHa cell.

Discussion

The progression of malignant tumors is a sophisticated process involving multiple factors and molecular events. The EMT, which is believed to be a crucial step in tumor metastasis (25), allows cancer cells to invade adjacent tissues and metastasize to distance sites. It is important to understand the molecular mechanisms underlying the EMT pathway and identification of ways to prevent or reverse the process are critical to the development of novel therapeutic strategies against cancer. Several signaling pathways, including the Wnt, transforming growth factor-β, EGF, Notch and fibroblast growth factor pathways, have been shown to be involved in regulating the process of the EMT by modulating the expression of certain key transcription factors, including snail, ZEB and twist, which suppress the expression of E-cadherin and activate the mesenchymal transcriptomes (26,27).

Eps8 is a novel phosphorylation substrate for EGFR, which enhances the cellular transformation of EGFR-dependent mitogenic signals upon overexpression (28). As an actin-capping protein, the role of Eps8 in cancer metastasis has aroused widespread concern, resulting in a number of studies to elucidate the mechanisms by which Eps8 influences tumor migration. Eps8 overexpression is responsible for enhanced Rac-induced actin cytoskeleton remodeling and cell migration by formation of Eps8-Abi-1-Sos-1 and Eps8-IRSp53 complexes, which are involved in transducing signals to activate the Rho-GTPase family members Rac and Cdc42 (2931). In addition to the role of Eps8 in tumor metastasis mediated via Rac-dependent pathways, Eps8 is also involved in tumor migration mediated via Rac-independent pathways, including the the Eps8/AKT/FOXM1/matrix metalloproteinase-9 cascade (32). Although considerable efforts have been made to clarify the functions of Eps8 in the metastasis of numerous cancer types, the role of Eps8 in the development of cervical cancer remains to be elucidated. Chen et al (17) analyzed the expression levels of Eps8 in 110 cervical cancer samples by immunohistochemistry and observed that increased Eps8 expression was associated with shorter disease-free survival and overall survival (17). These observations suggested that Eps8 serves a role in the progression of cervical cancer. Therefore, the present study hypothesized that Eps8 is also involved in cervical cancer metastasis. The present study focused predominantly on the EMT-related role of Eps8 in this process.

The present data demonstrated that Eps8 expression in cervical cancer samples was significantly higher compared with that in NC, LSIL and HSIL samples; thus, indicating the involvement of Eps8 in the development of cervical cancer. The analysis with regard to its clinical significance revealed that high Eps8 expression correlated with histological grade and lymph node metastases, suggesting that Eps8 serves a pivotal role in cervical cancer progression, and may be an independent biomarker for an unfavorable clinical prognosis. This is in agreement with previous observations that Eps8 overexpression is associated with poor prognosis in patients with oral squamous cell carcinoma, mixed lineage leukaemia and ovarian cancer (3335). It is generally accepted that decreased expression of E-cadherin, coupled with increased expression of vimentin, is characteristic of EMT (36). Therefore, the present study analyzed the possible association between the expression levels of Eps8 and EMT-associated proteins (E-cadherin and vimentin) in cervical carcinoma tissues. Correlation analysis revealed that high Eps8 expression was negatively correlated with the expression of E-cadherin and positively correlated with the expression of vimentin, implying the involvement of Eps8 in the EMT phenotype. Taken together, it was hypothesized that Eps8 makes a vital contribution to the progression of cervical cancer, partly through its influence on the EMT.

Given the results of the immunohistochemical analysis, the present study further investigated the role of Eps8 in the process of the EMT using shRNA-mediated knockdown of Eps8 in HeLa and SiHa cells. Eps8 knockdown appeared to cause a reversal of the EMT process in HeLa and SiHa cells, with changes observed in the expression of certain EMT markers (Fig. 2), including the E-cadherin upregulation and vimentin downregulation at both the mRNA and protein expression levels. E-cadherin is a major cell adhesion molecule involved in epithelial cell adhesion. Its loss or decreased expression has been suggested to be a key event in the EMT process. Reduced expression of E-cadherin serves an pivotal role in cancer progression and is associated with metastasis (3742). E-cadherin is considered to be a prognostic biomarkers in certain solid malignant tumor types (43,44). In addition, vimentin, as a canonical marker of the EMT, is widely expressed in mesenchymal cells. It has been previously reported that vimentin is overexpressed in various epithelial-derived tumor cells and tissues (45), and its overexpression is associated with enhanced tumor cell invasiveness (46). The present finding that Eps8 knockdown resulted in E-cadherin upregulation and vimentin downregulation suggested that Eps8 is involved in the EMT in HeLa and SiHa cells.

The present study also revealed that knockdown of Eps8 led to the downregulation of the transcription factor snail, which is hypothesized to be a key regulator of the EMT (47). The expression of snail has been implicated in suppressing the expression of E-cadherin and is involved in the initial migratory phenotype (48). Snail is expressed at the invasive front of tumors and is associated with tumor recurrence and lymph node metastasis, suggesting a role for snail in tumor progression (49). Other previous studies have indicated that Eps8 activates AKT by stimulating phosphatidylinositol 4,5-bisphosphate 3-kinase (PI3K) (16), and that the PI3K/AKT-snail pathway is involved in the EMT in breast and lung cancer cells (50,51). Furthermore, it was speculated that downregulation of snail by Eps8 silencing represents a plausible mechanism by which Eps8 is involved in the process of the EMT in cervical cancer cells. Furthermore, the present observation that Eps8 depletion in cell invasion and migration assays significantly impaired the invasive and migratory capacities of cervical cancer cells indicated that Eps8 serves a vital role in tumor progression.

In conclusion, the results of the present study demonstrated that the expression of Eps8 was significantly associated with the expression of EMT-related proteins in cervical cancer samples. Furthermore, these results indicated that Eps8 overexpression was correlated with lymphatic and distant metastasis of cervical cancer. Additionally, decreased expression of Eps8 impaired the EMT process and suppressed the migration and invasion of HeLa and SiHa cells. These results provided an insight into the important function of Eps8 in cervical cancer progression by orchestrating the EMT, and indicated that Eps8 is a novel potential target for developing therapeutic strategies for cervical cancer. However, the specific regulatory role of Eps8 in the EMT remains unknown and further in vitro and in vivo investigations are required to elucidate the detailed mechanism by which Eps8 regulates the EMT.

Acknowledgments

The authors would like to thank Dr Huijuan Zhang and Dr Bei Chen (Department of Pathology of the International Peace Maternity and Child Health Hospital of the China Welfare Institute) for their assistance with immunohistochemistry. This research was supported by grants from the Project of Health and Family Planning Commission of Shanghai Municipality (no. 201440603), the National Natural Science Foundation of China (no. 81402134) and the Science and Technology Commission of Shanghai Municipality (no. 12ZR1451400).

References

1 

Crosbie EJ, Einstein MH, Franceschi S and Kitchener HC: Human papillomavirus and cervical cancer. Lancet. 382:889–899. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Partridge EE, Abu-Rustum N, Giuliano A, Massad S, McClure J, Dwyer M and Hughes M: National comprehensive cancer network: Cervical cancer screening. J Natl Compr Canc Netw. 12:333–341; quiz 341. 2014.

3 

Liu X, Wang D, Liu H, Feng Y, Zhu T, Zhang L, Zhu B and Zhang Y: Knockdown of astrocyte elevated gene-1 (AEG-1) in cervical cancer cells decreases their invasiveness, epithelial to mesenchymal transition, and chemoresistance. Cell Cycle. 13:1702–1707. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Kim CJ, Jeong JK, Park M, Park TS, Park TC, Namkoong SE and Park JS: HPV oligonucleotide microarray-based detection of HPV genotypes in cervical neoplastic lesions. Gynecol Oncol. 89:210–217. 2003. View Article : Google Scholar : PubMed/NCBI

5 

Jung HY, Fattet L and Yang J: Molecular pathways: Linking tumor microenvironment to epithelial-mesenchymal transition in metastasis. Clin Cancer Res. 21:962–968. 2015. View Article : Google Scholar

6 

Thiery JP, Acloque H, Huang RY and Nieto MA: Epithelial-mesenchymal transitions in development and disease. Cell. 139:871–890. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Kalluri R and Neilson EG: Epithelial-mesenchymal transition and its implications for fibrosis. J Clin Invest. 112:1776–1784. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Fazioli F, Minichiello L, Matoska V, Castagnino P, Miki T, Wong WT and Di Fiore PP: Eps8, a substrate for the epidermal growth factor receptor kinase, enhances EGF-dependent mitogenic signals. EMBO J. 12:3799–3808. 1993.PubMed/NCBI

9 

Matoskova B, Wong WT, Salcini AE, Pelicci PG and Di Fiore PP: Constitutive phosphorylation of eps8 in tumor cell lines: Relevance to malignant transformation. Mol Cell Biol. 15:3805–3812. 1995. View Article : Google Scholar : PubMed/NCBI

10 

Maa MC, Lee JC, Chen YJ, Chen YJ, Lee YC, Wang ST, Huang CC, Chow NH and Leu TH: Eps8 facilitates cellular growth and motility of colon cancer cells by increasing the expression and activity of focal adhesion kinase. J Biol Chem. 282:19399–19409. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Xu M, Shorts-Cary L, Knox AJ, Kleinsmidt-DeMasters B, Lillehei K and Wierman ME: Epidermal growth factor receptor pathway substrate 8 is overexpressed in human pituitary tumors: Role in proliferation and survival. Endocrinology. 150:2064–2071. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Yap LF, Jenei V, Robinson CM, Moutasim K, Benn TM, Threadgold SP, Lopes V, Wei W, Thomas GJ and Paterson IC: Upregulation of Eps8 in oral squamous cell carcinoma promotes cell migration and invasion through integrin-dependent Rac1 activation. Oncogene. 28:2524–2534. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Bashir M, Kirmani D, Bhat HF, Baba RA, Hamza R, Naqash S, Wani NA, Andrabi KI, Zargar MA and Khanday FA: P66shc and its downstream Eps8 and Rac1 proteins are upregulated in esophageal cancers. Cell Commun Signal. 8:132010. View Article : Google Scholar : PubMed/NCBI

14 

Welsch T, Endlich K, Giese T, Büchler MW and Schmidt J: Eps8 is increased in pancreatic cancer and required for dynamic actin-based cell protrusions and intercellular cytoskeletal organization. Cancer Lett. 255:205–218. 2007. View Article : Google Scholar : PubMed/NCBI

15 

Liu PS, Jong TH, Maa MC and Leu TH: The interplay between Eps8 and IRSp53 contributes to Src-mediated transformation. Oncogene. 29:3977–3989. 2010. View Article : Google Scholar : PubMed/NCBI

16 

Wang H, Patel V, Miyazaki H, Gutkind JS and Yeudall WA: Role for EPS8 in squamous carcinogenesis. Carcinogenesis. 30:165–174. 2009. View Article : Google Scholar

17 

Chen YJ, Shen MR, Chen YJ, Maa MC and Leu TH: Eps8 decreases chemosensitivity and affects survival of cervical cancer patients. Mol Cancer Ther. 7:1376–1385. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Ackland ML, Newgreen DF, Fridman M, Waltham MC, Arvanitis A, Minichiello J, Price JT and Thompson EW: Epidermal growth factor-induced epithelia-mesenchymal transition in human breast carcinoma cells. Lab Invest. 83:435–448. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Hagemann T, Bozanovic T, Hooper S, Ljubic A, Slettenaar VI, Wilson JL, Singh N, Gayther SA, Shepherd JH and Van Trappen PO: Molecular profiling of cervical cancer progression. Br J Cancer. 96:321–328. 2007. View Article : Google Scholar : PubMed/NCBI

20 

Shen MR, Hsu YM, Hsu KF, Chen YF, Tang MJ and Chou CY: Insulin-like growth factor 1 is a potent stimulator of cervical cancer cell invasiveness and proliferation that is modulated by alphavbeta3 integrin signaling. Carcinogenesis. 27:962–971. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Adam L, Zhong M, Choi W, Qi W, Nicoloso M, Arora A, Calin G, Wang H, Siefker-Radtke A, McConkey D, et al: MiR-200 expression regulates epithelial-to-mesenchymal transition in bladder cancer cells and reverses resistance to epidermal growth factor receptor therapy. Clin Cancer Res. 15:5060–5072. 2009. View Article : Google Scholar : PubMed/NCBI

22 

Cannito S, Novo E, di Bonzo LV, Busletta C, Colombatto S and Parola M: Epithelial-mesenchymal transition: From molecular mechanisms, redox regulation to implications in human health and disease. Antioxid Redox Signal. 12:1383–1430. 2010. View Article : Google Scholar

23 

Wang Z, Li Y, Ahmad A, Azmi AS, Kong D, Banerjee S and Sarkar FH: Targeting miRNAs involved in cancer stem cell and EMT regulation: An emerging concept in overcoming drug resistance. Drug Resist Updat. 13:109–118. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. 2001. View Article : Google Scholar

25 

Qureshi R, Arora H and Rizvi MA: EMT in cervical cancer: Its role in tumour progression and response to therapy. Cancer Lett. 356:321–331. 2015. View Article : Google Scholar

26 

Polyak K and Weinberg RA: Transitions between epithelial and mesenchymal states: Acquisition of malignant and stem cell traits. Nat Rev Cancer. 9:265–273. 2009. View Article : Google Scholar : PubMed/NCBI

27 

Acloque H, Adams MS, Fishwick K, Bronner-Fraser M and Nieto MA: Epithelial-mesenchymal transitions: The importance of changing cell state in development and disease. J Clin Invest. 119:1438–1449. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Castagnino P, Biesova Z, Wong WT, Fazioli F, Gill GN and Di Fiore PP: Direct binding of eps8 to the juxtamembrane domain of EGFR is phosphotyrosine- and SH2-independent. Oncogene. 10:723–729. 1995.PubMed/NCBI

29 

Disanza A, Mantoani S, Hertzog M, Gerboth S, Frittoli E, Steffen A, Berhoerster K, Kreienkamp HJ, Milanesi F, Di Fiore PP, et al: Regulation of cell shape by Cdc42 is mediated by the synergic actin-bundling activity of the Eps8-IRSp53 complex. Nat Cell Biol. 8:1337–1347. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Goicoechea S, Arneman D, Disanza A, Garcia-Mata R, Scita G and Otey CA: Palladin binds to Eps8 and enhances the formation of dorsal ruffles and podosomes in vascular smooth muscle cells. J Cell Sci. 119:3316–3324. 2006. View Article : Google Scholar : PubMed/NCBI

31 

Innocenti M, Frittoli E, Ponzanelli I, Falck JR, Brachmann SM, Di Fiore PP and Scita G: Phosphoinositide 3-kinase activates Rac by entering in a complex with Eps8, Abi1, and Sos-1. J Cell Biol. 160:17–23. 2003. View Article : Google Scholar : PubMed/NCBI

32 

Wang H, Teh MT, Ji Y, Patel V, Firouzabadian S, Patel AA, Gutkind JS and Yeudall WA: EPS8 upregulates FOXM1 expression, enhancing cell growth and motility. Carcinogenesis. 31:1132–1141. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Chu PY, Liou JH, Lin YM, Chen CJ, Chen MK, Lin SH, Yeh CM, Wang HK, Maa MC, Leu TH, et al: Expression of Eps8 correlates with poor survival in oral squamous cell carcinoma. Asia Pac J Clin Oncol. 8:e77–e81. 2012. View Article : Google Scholar : PubMed/NCBI

34 

Kang H, Wilson CS, Harvey RC, Chen IM, Murphy MH, Atlas SR, Bedrick EJ, Devidas M, Carroll AJ, Robinson BW, et al: Gene expression profiles predictive of outcome and age in infant acute lymphoblastic leukemia: A children's oncology group study. Blood. 119:1872–1881. 2012. View Article : Google Scholar : PubMed/NCBI

35 

Chen H, Wu X, Pan ZK and Huang S: Integrity of SOS1/EPS8/ABI1 tri-complex determines ovarian cancer metastasis. Cancer Res. 70:9979–9990. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Lim J and Thiery JP: Epithelial-mesenchymal transitions: Insights from development. Development. 139:3471–3486. 2012. View Article : Google Scholar : PubMed/NCBI

37 

Schipper JH, Frixen UH, Behrens J, Unger A, Jahnke K and Birchmeier W: E-cadherin expression in squamous cell carcinomas of head and neck: Inverse correlation with tumor dedifferentiation and lymph node metastasis. Cancer Res. 51:6328–6337. 1991.PubMed/NCBI

38 

Shiozaki H, Tahara H, Oka H, Miyata M, Kobayashi K, Tamura S, Iihara K, Doki Y, Hirano S, Takeichi M, et al: Expression of immunoreactive E-cadherin adhesion molecules in human cancers. Am J Pathol. 139:17–23. 1991.PubMed/NCBI

39 

Kadowaki T, Shiozaki H, Inoue M, Tamura S, Oka H, Doki Y, Iihara K, Matsui S, Iwazawa T, Nagafuchi A, et al: E-cadherin and alpha-catenin expression in human esophageal cancer. Cancer Res. 54:291–296. 1994.PubMed/NCBI

40 

Bowie GL, Caslin AW, Roland NJ, Field JK, Jones AS and Kinsella AR: Expression of the cell-cell adhesion molecule E-cadherin in squamous cell carcinoma of the head and neck. Clin Otolaryngol Allied Sci. 18:196–201. 1993. View Article : Google Scholar : PubMed/NCBI

41 

Koseki S, Aoki T, Ansai S, Hozumi Y, Mitsuhashi Y and Kondo S: An immunohistochemical study of E-cadherin expression in human squamous cell carcinoma of the skin: Relationship between decreased expression of E-cadherin in the primary lesion and regional lymph node metastasis. J Dermatol. 26:416–422. 1999. View Article : Google Scholar : PubMed/NCBI

42 

Wu H, Lotan R, Menter D, Lippman SM and Xu XC: Expression of E-cadherin is associated with squamous differentiation in squamous cell carcinomas. Anticancer Res. 20:1385–1390. 2000.PubMed/NCBI

43 

Berx G, Staes K, van Hengel J, Molemans F, Bussemakers MJ, van Bokhoven A and van Roy F: Cloning and characterization of the human invasion suppressor gene E-cadherin (CDH1). Genomics. 26:281–289. 1995. View Article : Google Scholar : PubMed/NCBI

44 

Prognostic significance of CyclinD1 and E-Cadherin in patients with esophageal squamous cell carcinoma: Multiinstitutional retrospective analysis. Research committee on malignancy of esophageal cancer, Japanese society for esophageal diseases. J Am Coll Surg. 192:708–718. 2001. View Article : Google Scholar : PubMed/NCBI

45 

Helfand BT, Mendez MG, Murthy SN, Shumaker DK, Grin B, Mahammad S, Aebi U, Wedig T, Wu YI, Hahn KM, et al: Vimentin organization modulates the formation of lamellipodia. Mol Biol CellMol Biol Cell. 22:1274–1289. 2011. View Article : Google Scholar

46 

Adam SA and Gerace L: Cytosolic proteins that specifically bind nuclear location signals are receptors for nuclear import. Cell. 66:837–847. 1991. View Article : Google Scholar : PubMed/NCBI

47 

Moody SE, Perez D, Pan TC, Sarkisian CJ, Portocarrero CP, Sterner CJ, Notorfrancesco KL, Cardiff RD and Chodosh LA: The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell. 8:197–209. 2005. View Article : Google Scholar : PubMed/NCBI

48 

Wu Y and Zhou BP: New insights of epithelial-mesenchymal transition in cancer metastasis. Acta Biochim Biophys Sin (Shanghai). 40:643–650. 2008. View Article : Google Scholar

49 

Guarino M: Epithelial-mesenchymal transition and tumour invasion. Int J Biochem Cell Biol. 39:2153–2160. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Chen KC, Chen CY, Lin CR, Yang TY, Chen TH, Wu LC and Wu CC: Luteolin attenuates TGF-β1-induced epithelial-mesenchymal transition of lung cancer cells by interfering in the PI3K/Akt-NF-κB Snail pathway. Life Sci. 93:924–933. 2013. View Article : Google Scholar : PubMed/NCBI

51 

Zhang B, Yin C, Li H, Shi L, Liu N, Sun Y, Lu S, Liu Y, Sun L, Li X, et al: Nir1 promotes invasion of breast cancer cells by binding to chemokine (C-C motif) ligand 18 through the PI3K/Akt/GSK3β/Snail signalling pathway. Eur J Cancer. 49:3900–3913. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

October-2016
Volume 14 Issue 4

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Li Q, Bao W, Fan Q, Shi WJ, Li ZN, Xu Y and Wu D: Epidermal growth factor receptor kinase substrate 8 promotes the metastasis of cervical cancer via the epithelial-mesenchymal transition. Mol Med Rep 14: 3220-3228, 2016.
APA
Li, Q., Bao, W., Fan, Q., Shi, W., Li, Z., Xu, Y., & Wu, D. (2016). Epidermal growth factor receptor kinase substrate 8 promotes the metastasis of cervical cancer via the epithelial-mesenchymal transition. Molecular Medicine Reports, 14, 3220-3228. https://doi.org/10.3892/mmr.2016.5638
MLA
Li, Q., Bao, W., Fan, Q., Shi, W., Li, Z., Xu, Y., Wu, D."Epidermal growth factor receptor kinase substrate 8 promotes the metastasis of cervical cancer via the epithelial-mesenchymal transition". Molecular Medicine Reports 14.4 (2016): 3220-3228.
Chicago
Li, Q., Bao, W., Fan, Q., Shi, W., Li, Z., Xu, Y., Wu, D."Epidermal growth factor receptor kinase substrate 8 promotes the metastasis of cervical cancer via the epithelial-mesenchymal transition". Molecular Medicine Reports 14, no. 4 (2016): 3220-3228. https://doi.org/10.3892/mmr.2016.5638
a