Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
November-2016 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2016 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations

  • Authors:
    • Jiali Li
    • Xueshan Xiao
    • Shiqiang Li
    • Xiaoyun Jia
    • Xiangming Guo
    • Qingjiong Zhang
  • View Affiliations / Copyright

    Affiliations: State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat‑sen University, Guangzhou, Guangdong 510060, P.R. China
  • Pages: 4811-4815
    |
    Published online on: October 13, 2016
       https://doi.org/10.3892/mmr.2016.5847
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

It has been previously reported that mutations in retinal G protein coupled receptor (RGR) are associated with retinitis pigmentosa. The present study aims to systemically analyze the potential role of variants of RGR in retinal diseases. Variants in coding regions and splice sites of RGR were selected from a whole exome sequencing dataset of 820 probands with various forms of genetic ocular diseases. Potential variants of RGR were further confirmed by Sanger sequencing and analyzed in available family members. Clinical data was reviewed for patients with RGR variants. As a result, a total of five variants in RGR were detected in six probands with different types of ocular diseases. Of the five variants, two were novel heterozygous truncation variations, c.266C>A (p.S89*) and c.722_723delCC (p.S241Yfs*29), identified in two probands with high myopia and confirmed by Sanger sequencing. Segregation analysis on available family members demonstrated p.S89* and p.S241Yfs*29 were also present in unaffected relatives. The other three variants of RGR were heterozygous missense variants randomly occurring in patients with different genetic ocular diseases. No homozygous or compound heterozygous variants were detected. The results of the present study suggested that the heterozygous truncation variants in RGR were less likely to be pathogenic. Further studies are expected to evaluate the pathogenicity of variants in RGR.

Introduction

Retinal G protein coupled receptor (RGR) [Online Mendelian Inheritance in Man (MIM) 600342)] encodes a putative retinal G-protein coupled receptor, a rhodopsin homologue, expressed exclusively in the retina (1–3). RGR is essential for the visual cycle as it is involved in the production of 11-cis-retinal (4). An abnormal visual cycle affects visual perception and ultimately leads to ocular disorders (5). However, the association of RGR with specific ocular diseases has been rarely reported. Only a homozygous missense mutation and a heterozygous frameshift mutation have been reported to be associated with retinitis pigmentosa and choroidal sclerosis, respectively (5). However, the involvement of RGR in the pathogenesis of retinitis pigmentosa has not been implicated in subsequent studies (6,7). The potential role of RGR in retinal diseases remains to be elucidated. Thus, the present study aims to systemically evaluate and analyze the potential role and pathogenicity of variants in RGR. This will be done with reference to a whole exome sequencing dataset from 820 probands with different forms of genetic ocular diseases.

Materials and methods

Patients

The present study is part of a project to investigate genetic defects associated with genetic ocular diseases using whole exome sequencing. Whole exome sequencing was performed on samples from 820 probands with different forms of genetic ocular diseases. All patients were recruited from the clinic of the Zhongshan Ophthalmic Center (Guangzhou, China). Written informed consent was obtained from the participants or their guardians, following the tenets of the Declaration of Helsinki. The present study was approved by the Institutional Review Board of Zhongshan Ophthalmic Center.

Sequencing

Whole exome sequencing was performed using a SureSelect Human All Exon Enrichment kit V4 (Agilent Technologies, Inc., Santa Clara, CA, USA) or TruSeq Exome Enrichment Kit (Illumina, Inc., San Diego, CA, USA) as previously described (8,9). Variants in coding regions and splice sites in RGR were selected from the whole exome sequencing data of 820 probands with various genetic ocular diseases. Those variants with minor allele frequency (MAF) ≤0.01 were further analyzed by functional prediction using online methods, including SIFT (sift.jcvi.org/www/SIFT_enst_submit.html) (10), PolyPhen-2 (genetics.bwh.harvard.edu/pph2/) (11), and Berkeley Drosophila Genome Project (www.fruitfly.org/) (12). The MAF of each variant was obtained from the public databases, dbSNP (www.ncbi.nlm.nih.gov/projects/SNP/), 1000 Genomes (www.1000genomes.org/), and the Exome Variation Server (evs.gs.washington.edu/EVS/). Potential variants of RGR were further confirmed by Sanger sequencing and validated in available family members. Primers used for amplification of fragments were designed using the Primer3 online tool (bioinfo.ut.ee/primer3-0.4.0/) and are presented in Table I. The methods used for amplification, sequencing, and analysis of the target fragments were as previously described (13). The descriptions of the variants are consistent with the nomenclature for sequence variations (www.hgvs.org/mutnomen/) (14).

Table I.

Primers used for amplification and sequencing of RGR.

Table I.

Primers used for amplification and sequencing of RGR.

PrimerForward primer (5′-3′)Reverse primer (5′-3′)Amplicon (bp)Annealing temperature (°C)
RGR-86008695 GCAGCATTCAGGAACACACA CCCTGCCTCTTATCCTCTCC28365–58a
RGR-86017741 TGCTGACCTGGTTTTCTTGG AGGAAGAGACTGACACAGAGGT30065–58a

a Gradient annealing temperatures from 65 to 58°C. RGR, retinal G protein coupled receptor.

Results

Following a review of the whole exome dataset of 820 probands with different forms of genetic ocular diseases, a total of 5 variants of RGR were detected in 6 of the 820 probands. Of the five variants, two were heterozygous truncation variants, c.266C>A (p.S89*) and c.722_723delCC (p.S242Yfs*29), identified in two probands with early-onset high myopia (Fig. 1A and Table II). These two variants were further confirmed by Sanger sequencing (Fig. 1A). Segregation analysis on available family relatives identified that p.S89* and p.S242Yfs*2 did not co-segregate with high myopia, they were present in the unaffected relatives but absent in the affected relatives (Fig. 1A). The other three variants were heterozygous missense variants and identified in four probands, one with high myopia, one with cone-rod dystrophy, and two with Leber congenital amaurosis (Table II). No homozygous or compound heterozygous variants in RGR were detected.

Figure 1.

Truncation variants in retinal G protein coupled receptor identified in two probands with early-onset high myopia. (A) Sequence chromatography and pedigrees of HM723 and HM824. Sequence changes detected in the patients with early-onset high myopia were shown in the left column, whereas normal sequences were shown in the right column. Fundus photographs from right eyes of high myopes, (B) HM723I1 and (C) HM824II2, and (D) unaffected relative, HM723II4. M, mutation; +, wild-type.

Table II.

Summary of variants in RGR detected in probands with different forms of genetic ocular diseases.

Table II.

Summary of variants in RGR detected in probands with different forms of genetic ocular diseases.

Variation MAF


GeneChromosomePositionSampleNucleotideAmino acidStatusSIFTPoly Phen-21000GEVS
RGRchr1086007503HM345, QT371c.236G>Ap.R79HHeteroDBNoneNone
RGRchr1086007377QT1072c.110C>Tp.T37IHeteroDBNoneNone
RGRchr1086008695HM723c.266C>Ap.S89*Hetero––NoneNone
RGRchr1086012764QT90c.522C>Gp.D174EHeteroTDNoneNone
RGRchr1086017741HM824c.722_723delCCp.S241Yfs*29Hetero––NoneNone

[i] D, damaging; B, benign; T, tolerate; NA, not available/not applicable; EVS, Exome Variant Sever; MAF, minor allele frequency; RGR, retinal G protein coupled receptor; 1000G, 1000 Genomes database.

The two probands with RGR truncation variants complained of poor vision at younger than primary school age, but denied photophobia and night blindness (Table III). Fundus examination demonstrated tigroid fundus and temporal crescent of optic nerve head (Fig. 1B and C), which was consistent with the diagnosis of high myopia. Neither marked retinal vessel attenuation nor bone corpuscle type of pigmentation were observed (Fig. 1B and C). However, additional family members with RGR truncation variants (HM723II4 and HM824I1) were unaffected individuals without high myopia (Table III) and did not have any notable signs of abnormal fundus changes (Fig. 1D).

Table III.

Summary of clinical features in the families with truncation variants of RGR.

Table III.

Summary of clinical features in the families with truncation variants of RGR.

BCARefraction (D)Axial length (mm)



Case IDStatusMutationEffectGenderAge at exam (years)First symptomRightLeftRightLeftRightLeftFundus
HM723I1Affected c.[266C>A];[=]StopgainF43PV0.20.2−12.00−13.0027.5728.18Myopic
HM723II2Affectedc.[=];[=]NormalF22PV0.50.5−7.00−6.5026.2826.09Normal
HM723II4Unaffected c.[266C>A];[=]StopgainM10No1.21.0−1.00−0.5023.1823.24Normal
HM824II2Affected c.[722_723delCC];[=]FrameshiftM35PV0.70.1−15.50−18.0031.52NAaMyopic
HM824I1Unaffected c.[722_723delCC];[=]FrameshiftM66No1.01.0−2.501.0023.9223.86Normal

a Axial length of the left eye was not determined as the patient underwent surgery for retinal detachment. RGR, retinal G protein coupled receptor; D, diopter; F, female; M, male; BCA, best corrected acuity; EC, early childhood; No, no complaint of visual problem; PV, poor vision; NA, not available.

Discussion

Based on the whole exome sequencing dataset from 820 probands with different forms of genetic ocular diseases, two heterozygous truncation variants in RGR were identified in two probands with high myopia, but these did not co-segregate with high myopia. The other three variants in RGR were heterozygous missense variants, and occurred randomly in four patients with different forms of genetic ocular diseases. No homozygous or compound heterozygous variants were detected in RGR.

Only a limited number of RGR variants have been previously reported (5–7). Among them, only two have been identified in two families with either retinitis pigmentosa or choroidal sclerosis (5), a homozygous c.196A>C (p.Ser66Arg) variant identified in a family with autosomal recessive retinitis pigmentosa and a heterozygous c.824dupG (p.M275Ifs*83) insertion identified in a small family with autosomal dominant choroidal sclerosis (5). Subsequently, screening of RGR in two independent studies only identified a number of less likely pathogenic variants and polymorphisms, as reviewed in Table IV. Of the five variants detected in the current study, two were heterozygous novel truncations, p.S89* and p.S242Yfs*29, which presented in two probands with high myopia. These two variants and the previously reported heterozygous variant, c.824dupG, were located in exon 3, exon 6, and exon 7 of RGR, respectively, and have been predicted to result in an abnormal transcript. They were absent in the Exome Variants Server and 1000 Genomes databases. However, the p.S89* and p.S242Yfs*29 variants were also detected in unaffected family members without any abnormalities of the fundus. Furthermore, searching of the Exome Variants Server and 1000 Genomes databases revealed a further five truncation variants of RGR, c.190G>A (p.W47*) in 1/4406 alleles, c.775del1 (p.M260Wfs*43) in 99/12,518 alleles, c.775A>T (p.K259*) in 2/13,006 alleles, c.796_797insCC (p.I267Pfs*37) in 1/12,518 alleles, and c.877C>T (p.R293*) in 1/13,006 alleles. These findings suggest that heterozygous truncation variants of RGR are less likely to be pathogenic. Furthermore, it has been observed that heterozygous missense variants of RGR have a similar distribution among probands with different forms of genetic ocular diseases and thus, may not be pathogenic. The pathogenicity of the homozygous or compound variants of RGR, remains to be elucidated, as no such variants were detected in the current study.

Table IV.

Reported variants in RGR.

Table IV.

Reported variants in RGR.

First author, yearNucleotideProteinStatusMAF casePhenotype in caseCo-segre gationMAF in controlRefs.
Morimura, 1999 c.824dupGaGly275Ilefs*83Hetero1/1684adRPbYes0/190(5)
Morimura, 1999 c.196A>CaSer66ArgHomo2/1684arRPYes0/190(5)
Morimura, 1999 IVS5-12A→GcSplicingHetero1/1684sRPNA0/190(5)
Morimura, 1999 IVS6+3A→GcSplicingHetero1/1684sRPNA0/190(5)
Morimura, 1999 IVS6+5A→GcSplicingHetero4/1684sRPNA1/190(5)
Morimura, 1999 GTG→TTGcVal132LeuHetero1/1684sRPNA0/190(5)
Morimura, 1999 CAC→AACcHis152AsnHetero1/1684sRPNA0/190(5)
Morimura, 1999 GCA→ACAcAla234ThrHetero1/1684sRPNA0/190(5)
Morimura, 1999 TCC→TTCcSer241PheHetero/Homo6/1684adRP; sRPNA1/190(5)
Bernal, 2003 TCC→TTCcSer241PheHetero10/184arRPNo5/190(6)
Bernal, 2003nt 615 G>Acp.=Hetero1/184arRPNANA(6)
Bernal, 2003IVS6+5 A>G*cSplicingHetero1/184arRPNo0/190(6)
Ksantini, 2010 c.466C>AcHis156AsnHetero/Homo3/662arRP; sRPNA0/100(7)d
Ksantini, 2010 c.474C>Tcp.=NA1/184sRPNANA(7)
Morimura,1999; Bernal, 2003 IVS5+16C→TeIntronicNA0.07NANANA(5,6)
Morimura, 1999; Bernal, 2003nt 19 C>Tep.=NA0.07NANANA(5,6)
Morimura, 1999; Bernal, 2003nt 27 C>Tep.=NA0.47NANANA(5,6)
Morimura, 1999; Bernal, 2003nt 459 C>Tep.=NA0.37NANANA(5,6)
Ksantini, 2010 c.19C>Tep.=NA0.03NANANA(7)
Ksantini, 2010 c.27T>Cep.=NA0.36NANANA(7)
Ksantini, 2010 c.-111A>GeNon codingNA0.72NANANA(7)
Ksantini, 2010c.79 + 59C>TeNon codingNA0.02NANANA(7)
Ksantini, 2010c.642 + 16G>AeNon codingNA0.07NANANA(7)
Ksantini, 2010 c.*65A>GeNon codingNA0.11NANANA(7)
Ksantini, 2010 c.*100_101insAeNon codingNA0.06NANANA(7)

a Mutations associated with RP

b originally diagnosed with choroidal sclerosis

c less likely to be pathogenic variants

d the variant was predicted to be damaging by Polyphen but not conserved among species

e polymorphisms. MAF, minor allele frequency; RP, retinitis pigmentosa; adRP, autosomal dominant RP; arRP, autosomal recessive RP; sRP, sporadic RP; NA, not available; RGR, retinal G protein coupled receptor.

In conclusion, the results of the present study suggest that the potential role of heterozygous truncation of RGR in ocular diseases remains to be determined. Additional studies are required to provide further understanding.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. U1201221), the Natural Science Foundation of Guangdong (grant no. S2013030012978), and the Fundamental Research Funds of the State Key Laboratory of Ophthalmology (grant no. 2012PI01).

References

1 

Jiang M, Pandey S and Fong HK: An opsin homologue in the retina and pigment epithelium. Invest Ophthalmol Vis Sci. 34:3669–3678. 1993.PubMed/NCBI

2 

Shen D, Jiang M, Hao W, Tao L, Salazar M and Fong HK: A human opsin-related gene that encodes a retinaldehyde-binding protein. Biochemistry. 33:13117–13125. 1994. View Article : Google Scholar : PubMed/NCBI

3 

Trifunovic D, Karali M, Camposampiero D, Ponzin D, Banfi S and Marigo V: A high-resolution RNA expression atlas of retinitis pigmentosa genes in human and mouse retinas. Invest Ophthalmol Vis Sci. 49:2330–2336. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Chen P, Lee TD and Fong HK: Interaction of 11-cis-retinol dehydrogenase with the chromophore of retinal g protein-coupled receptor opsin. J Biol Chem. 276:21098–21104. 2001. View Article : Google Scholar : PubMed/NCBI

5 

Morimura H, Saindelle-Ribeaudeau F, Berson EL and Dryja TP: Mutations in RGR, encoding a light-sensitive opsin homologue, in patients with retinitis pigmentosa. Nat Genet. 23:393–394. 1999. View Article : Google Scholar : PubMed/NCBI

6 

Bernal S, Calaf M, Garcia-Hoyos M, Garcia-Sandoval B, Rosell J, Adan A, Ayuso C and Baiget M: Study of the involvement of the RGR, CRPB1, and CRB1 genes in the pathogenesis of autosomal recessive retinitis pigmentosa. J Med Genet. 40:e892003. View Article : Google Scholar : PubMed/NCBI

7 

Ksantini M, Sénéchal A, Bocquet B, Meunier I, Brabet P and Hamel CP: Screening genes of the visual cycle RGR, RBP1 and RBP3 identifies rare sequence variations. Ophthalmic Genet. 31:200–204. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Huang X, Li M, Guo X, Li S, Xiao X, Jia X, Liu X and Zhang Q: Mutation analysis of seven known glaucoma-associated genes in Chinese patients with glaucoma. Invest Ophthalmol Vis Sci. 55:3594–3602. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Li J, Jiang D, Xiao X, Li S, Jia X, Sun W, Guo X and Zhang Q: Evaluation of 12 myopia-associated genes in Chinese patients with high myopia. Invest Ophthalmol Vis Sci. 56:722–729. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Kumar P, Henikoff S and Ng PC: Predicting the effects of coding non-synonymous variants on protein function using the SIFT algorithm. Nat Protoc. 4:1073–1081. 2009. View Article : Google Scholar : PubMed/NCBI

11 

Flanagan SE, Patch AM and Ellard S: Using SIFT and PolyPhen to predict loss-of-function and gain-of-function mutations. Genet Test Mol Biomarkers. 14:533–537. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Reese MG, Eeckman FH, Kulp D and Haussler D: Improved splice site detection in Genie. J Comput Biol. 4:311–323. 1997. View Article : Google Scholar : PubMed/NCBI

13 

Jiang D, Li J, Xiao X, Li S, Jia X, Sun W, Guo X and Zhang Q: Detection of mutations in LRPAP1, CTSH, LEPREL1, ZNF644, SLC39A5, and SCO2 in 298 families with early-onset high myopia by exome sequencing. Invest Ophthalmol Vis Sci. 56:339–345. 2014. View Article : Google Scholar : PubMed/NCBI

14 

den Dunnen JT and Antonarakis SE: Mutation nomenclature extensions and suggestions to describe complex mutations: A discussion. Hum Mutat. 15:7–12. 2000. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li J, Xiao X, Li S, Jia X, Guo X and Zhang Q: RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations. Mol Med Rep 14: 4811-4815, 2016.
APA
Li, J., Xiao, X., Li, S., Jia, X., Guo, X., & Zhang, Q. (2016). RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations. Molecular Medicine Reports, 14, 4811-4815. https://doi.org/10.3892/mmr.2016.5847
MLA
Li, J., Xiao, X., Li, S., Jia, X., Guo, X., Zhang, Q."RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations". Molecular Medicine Reports 14.5 (2016): 4811-4815.
Chicago
Li, J., Xiao, X., Li, S., Jia, X., Guo, X., Zhang, Q."RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations". Molecular Medicine Reports 14, no. 5 (2016): 4811-4815. https://doi.org/10.3892/mmr.2016.5847
Copy and paste a formatted citation
x
Spandidos Publications style
Li J, Xiao X, Li S, Jia X, Guo X and Zhang Q: RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations. Mol Med Rep 14: 4811-4815, 2016.
APA
Li, J., Xiao, X., Li, S., Jia, X., Guo, X., & Zhang, Q. (2016). RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations. Molecular Medicine Reports, 14, 4811-4815. https://doi.org/10.3892/mmr.2016.5847
MLA
Li, J., Xiao, X., Li, S., Jia, X., Guo, X., Zhang, Q."RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations". Molecular Medicine Reports 14.5 (2016): 4811-4815.
Chicago
Li, J., Xiao, X., Li, S., Jia, X., Guo, X., Zhang, Q."RGR variants in different forms of retinal diseases: The undetermined role of truncation mutations". Molecular Medicine Reports 14, no. 5 (2016): 4811-4815. https://doi.org/10.3892/mmr.2016.5847
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team