This article is mentioned in:

Introduction

Retinal G protein coupled receptor (RGR) [Online Mendelian Inheritance in Man (MIM) 600342)] encodes a putative retinal G-protein coupled receptor, a rhodopsin homologue, expressed exclusively in the retina (1–3). RGR is essential for the visual cycle as it is involved in the production of 11-cis-retinal (4). An abnormal visual cycle affects visual perception and ultimately leads to ocular disorders (5). However, the association of RGR with specific ocular diseases has been rarely reported. Only a homozygous missense mutation and a heterozygous frameshift mutation have been reported to be associated with retinitis pigmentosa and choroidal sclerosis, respectively (5). However, the involvement of RGR in the pathogenesis of retinitis pigmentosa has not been implicated in subsequent studies (6,7). The potential role of RGR in retinal diseases remains to be elucidated. Thus, the present study aims to systemically evaluate and analyze the potential role and pathogenicity of variants in RGR. This will be done with reference to a whole exome sequencing dataset from 820 probands with different forms of genetic ocular diseases.

Materials and methods

Patients

The present study is part of a project to investigate genetic defects associated with genetic ocular diseases using whole exome sequencing. Whole exome sequencing was performed on samples from 820 probands with different forms of genetic ocular diseases. All patients were recruited from the clinic of the Zhongshan Ophthalmic Center (Guangzhou, China). Written informed consent was obtained from the participants or their guardians, following the tenets of the Declaration of Helsinki. The present study was approved by the Institutional Review Board of Zhongshan Ophthalmic Center.

Sequencing

Whole exome sequencing was performed using a SureSelect Human All Exon Enrichment kit V4 (Agilent Technologies, Inc., Santa Clara, CA, USA) or TruSeq Exome Enrichment Kit (Illumina, Inc., San Diego, CA, USA) as previously described (8,9). Variants in coding regions and splice sites in RGR were selected from the whole exome sequencing data of 820 probands with various genetic ocular diseases. Those variants with minor allele frequency (MAF) ≤0.01 were further analyzed by functional prediction using online methods, including SIFT (sift.jcvi.org/www/SIFT_enst_submit.html) (10), PolyPhen-2 (genetics.bwh.harvard.edu/pph2/) (11), and Berkeley Drosophila Genome Project (www.fruitfly.org/) (12). The MAF of each variant was obtained from the public databases, dbSNP (www.ncbi.nlm.nih.gov/projects/SNP/), 1000 Genomes (www.1000genomes.org/), and the Exome Variation Server (evs.gs.washington.edu/EVS/). Potential variants of RGR were further confirmed by Sanger sequencing and validated in available family members. Primers used for amplification of fragments were designed using the Primer3 online tool (bioinfo.ut.ee/primer3-0.4.0/) and are presented in Table I. The methods used for amplification, sequencing, and analysis of the target fragments were as previously described (13). The descriptions of the variants are consistent with the nomenclature for sequence variations (www.hgvs.org/mutnomen/) (14).

Table I. Primers used for amplification and sequencing of RGR.

Table I.

Primers used for amplification and sequencing of RGR.

Primer	Forward primer (5′-3′)	Reverse primer (5′-3′)	Amplicon (bp)	Annealing temperature (°C)
RGR-86008695	GCAGCATTCAGGAACACACA	CCCTGCCTCTTATCCTCTCC	283	65–58a
RGR-86017741	TGCTGACCTGGTTTTCTTGG	AGGAAGAGACTGACACAGAGGT	300	65–58a

a Gradient annealing temperatures from 65 to 58°C. RGR, retinal G protein coupled receptor.

Results

Following a review of the whole exome dataset of 820 probands with different forms of genetic ocular diseases, a total of 5 variants of RGR were detected in 6 of the 820 probands. Of the five variants, two were heterozygous truncation variants, c.266C>A (p.S89*) and c.722_723delCC (p.S242Yfs*29), identified in two probands with early-onset high myopia (Fig. 1A and Table II). These two variants were further confirmed by Sanger sequencing (Fig. 1A). Segregation analysis on available family relatives identified that p.S89* and p.S242Yfs*2 did not co-segregate with high myopia, they were present in the unaffected relatives but absent in the affected relatives (Fig. 1A). The other three variants were heterozygous missense variants and identified in four probands, one with high myopia, one with cone-rod dystrophy, and two with Leber congenital amaurosis (Table II). No homozygous or compound heterozygous variants in RGR were detected.

Figure 1. Truncation variants in retinal G protein coupled receptor identified in two probands with early-onset high myopia. (A) Sequence chromatography and pedigrees of HM723 and HM824. Sequence changes detected in the patients with early-onset high myopia were shown in the left column, whereas normal sequences were shown in the right column. Fundus photographs from right eyes of high myopes, (B) HM723I1 and (C) HM824II2, and (D) unaffected relative, HM723II4. M, mutation; +, wild-type.

Table II. Summary of variants in RGR detected in probands with different forms of genetic ocular diseases.

Table II.

Summary of variants in RGR detected in probands with different forms of genetic ocular diseases.

				Variation				MAF
Gene	Chromosome	Position	Sample	Nucleotide	Amino acid	Status	SIFT	Poly Phen-2	1000G	EVS
RGR	chr10	86007503	HM345, QT371	c.236G>A	p.R79H	Hetero	D	B	None	None
RGR	chr10	86007377	QT1072	c.110C>T	p.T37I	Hetero	D	B	None	None
RGR	chr10	86008695	HM723	c.266C>A	p.S89*	Hetero	–	–	None	None
RGR	chr10	86012764	QT90	c.522C>G	p.D174E	Hetero	T	D	None	None
RGR	chr10	86017741	HM824	c.722_723delCC	p.S241Yfs*29	Hetero	–	–	None	None

[i] D, damaging; B, benign; T, tolerate; NA, not available/not applicable; EVS, Exome Variant Sever; MAF, minor allele frequency; RGR, retinal G protein coupled receptor; 1000G, 1000 Genomes database.

The two probands with RGR truncation variants complained of poor vision at younger than primary school age, but denied photophobia and night blindness (Table III). Fundus examination demonstrated tigroid fundus and temporal crescent of optic nerve head (Fig. 1B and C), which was consistent with the diagnosis of high myopia. Neither marked retinal vessel attenuation nor bone corpuscle type of pigmentation were observed (Fig. 1B and C). However, additional family members with RGR truncation variants (HM723II4 and HM824I1) were unaffected individuals without high myopia (Table III) and did not have any notable signs of abnormal fundus changes (Fig. 1D).

Table III. Summary of clinical features in the families with truncation variants of RGR.

Table III.

Summary of clinical features in the families with truncation variants of RGR.

							BCA		Refraction (D)		Axial length (mm)
Case ID	Status	Mutation	Effect	Gender	Age at exam (years)	First symptom	Right	Left	Right	Left	Right	Left	Fundus
HM723I1	Affected	c.[266C>A];[=]	Stopgain	F	43	PV	0.2	0.2	−12.00	−13.00	27.57	28.18	Myopic
HM723II2	Affected	c.[=];[=]	Normal	F	22	PV	0.5	0.5	−7.00	−6.50	26.28	26.09	Normal
HM723II4	Unaffected	c.[266C>A];[=]	Stopgain	M	10	No	1.2	1.0	−1.00	−0.50	23.18	23.24	Normal
HM824II2	Affected	c.[722_723delCC];[=]	Frameshift	M	35	PV	0.7	0.1	−15.50	−18.00	31.52	NAa	Myopic
HM824I1	Unaffected	c.[722_723delCC];[=]	Frameshift	M	66	No	1.0	1.0	−2.50	1.00	23.92	23.86	Normal

a Axial length of the left eye was not determined as the patient underwent surgery for retinal detachment. RGR, retinal G protein coupled receptor; D, diopter; F, female; M, male; BCA, best corrected acuity; EC, early childhood; No, no complaint of visual problem; PV, poor vision; NA, not available.

Discussion

Based on the whole exome sequencing dataset from 820 probands with different forms of genetic ocular diseases, two heterozygous truncation variants in RGR were identified in two probands with high myopia, but these did not co-segregate with high myopia. The other three variants in RGR were heterozygous missense variants, and occurred randomly in four patients with different forms of genetic ocular diseases. No homozygous or compound heterozygous variants were detected in RGR.

Only a limited number of RGR variants have been previously reported (5–7). Among them, only two have been identified in two families with either retinitis pigmentosa or choroidal sclerosis (5), a homozygous c.196A>C (p.Ser66Arg) variant identified in a family with autosomal recessive retinitis pigmentosa and a heterozygous c.824dupG (p.M275Ifs*83) insertion identified in a small family with autosomal dominant choroidal sclerosis (5). Subsequently, screening of RGR in two independent studies only identified a number of less likely pathogenic variants and polymorphisms, as reviewed in Table IV. Of the five variants detected in the current study, two were heterozygous novel truncations, p.S89* and p.S242Yfs*29, which presented in two probands with high myopia. These two variants and the previously reported heterozygous variant, c.824dupG, were located in exon 3, exon 6, and exon 7 of RGR, respectively, and have been predicted to result in an abnormal transcript. They were absent in the Exome Variants Server and 1000 Genomes databases. However, the p.S89* and p.S242Yfs*29 variants were also detected in unaffected family members without any abnormalities of the fundus. Furthermore, searching of the Exome Variants Server and 1000 Genomes databases revealed a further five truncation variants of RGR, c.190G>A (p.W47*) in 1/4406 alleles, c.775del1 (p.M260Wfs*43) in 99/12,518 alleles, c.775A>T (p.K259*) in 2/13,006 alleles, c.796_797insCC (p.I267Pfs*37) in 1/12,518 alleles, and c.877C>T (p.R293*) in 1/13,006 alleles. These findings suggest that heterozygous truncation variants of RGR are less likely to be pathogenic. Furthermore, it has been observed that heterozygous missense variants of RGR have a similar distribution among probands with different forms of genetic ocular diseases and thus, may not be pathogenic. The pathogenicity of the homozygous or compound variants of RGR, remains to be elucidated, as no such variants were detected in the current study.

Table IV. Reported variants in RGR.

Table IV.

Reported variants in RGR.

First author, year	Nucleotide	Protein	Status	MAF case	Phenotype in case	Co-segre gation	MAF in control	Refs.
Morimura, 1999	c.824dupGa	Gly275Ilefs*83	Hetero	1/1684	adRPb	Yes	0/190	(5)
Morimura, 1999	c.196A>Ca	Ser66Arg	Homo	2/1684	arRP	Yes	0/190	(5)
Morimura, 1999	IVS5-12A→Gc	Splicing	Hetero	1/1684	sRP	NA	0/190	(5)
Morimura, 1999	IVS6+3A→Gc	Splicing	Hetero	1/1684	sRP	NA	0/190	(5)
Morimura, 1999	IVS6+5A→Gc	Splicing	Hetero	4/1684	sRP	NA	1/190	(5)
Morimura, 1999	GTG→TTGc	Val132Leu	Hetero	1/1684	sRP	NA	0/190	(5)
Morimura, 1999	CAC→AACc	His152Asn	Hetero	1/1684	sRP	NA	0/190	(5)
Morimura, 1999	GCA→ACAc	Ala234Thr	Hetero	1/1684	sRP	NA	0/190	(5)
Morimura, 1999	TCC→TTCc	Ser241Phe	Hetero/Homo	6/1684	adRP; sRP	NA	1/190	(5)
Bernal, 2003	TCC→TTCc	Ser241Phe	Hetero	10/184	arRP	No	5/190	(6)
Bernal, 2003	nt 615 G>Ac	p.=	Hetero	1/184	arRP	NA	NA	(6)
Bernal, 2003	IVS6+5 A>G*c	Splicing	Hetero	1/184	arRP	No	0/190	(6)
Ksantini, 2010	c.466C>Ac	His156Asn	Hetero/Homo	3/662	arRP; sRP	NA	0/100	(7)d
Ksantini, 2010	c.474C>Tc	p.=	NA	1/184	sRP	NA	NA	(7)
Morimura,1999; Bernal, 2003	IVS5+16C→Te	Intronic	NA	0.07	NA	NA	NA	(5,6)
Morimura, 1999; Bernal, 2003	nt 19 C>Te	p.=	NA	0.07	NA	NA	NA	(5,6)
Morimura, 1999; Bernal, 2003	nt 27 C>Te	p.=	NA	0.47	NA	NA	NA	(5,6)
Morimura, 1999; Bernal, 2003	nt 459 C>Te	p.=	NA	0.37	NA	NA	NA	(5,6)
Ksantini, 2010	c.19C>Te	p.=	NA	0.03	NA	NA	NA	(7)
Ksantini, 2010	c.27T>Ce	p.=	NA	0.36	NA	NA	NA	(7)
Ksantini, 2010	c.-111A>Ge	Non coding	NA	0.72	NA	NA	NA	(7)
Ksantini, 2010	c.79 + 59C>Te	Non coding	NA	0.02	NA	NA	NA	(7)
Ksantini, 2010	c.642 + 16G>Ae	Non coding	NA	0.07	NA	NA	NA	(7)
Ksantini, 2010	c.*65A>Ge	Non coding	NA	0.11	NA	NA	NA	(7)
Ksantini, 2010	c.*100_101insAe	Non coding	NA	0.06	NA	NA	NA	(7)

a Mutations associated with RP

b originally diagnosed with choroidal sclerosis

c less likely to be pathogenic variants

d the variant was predicted to be damaging by Polyphen but not conserved among species

e polymorphisms. MAF, minor allele frequency; RP, retinitis pigmentosa; adRP, autosomal dominant RP; arRP, autosomal recessive RP; sRP, sporadic RP; NA, not available; RGR, retinal G protein coupled receptor.

In conclusion, the results of the present study suggest that the potential role of heterozygous truncation of RGR in ocular diseases remains to be determined. Additional studies are required to provide further understanding.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. U1201221), the Natural Science Foundation of Guangdong (grant no. S2013030012978), and the Fundamental Research Funds of the State Key Laboratory of Ophthalmology (grant no. 2012PI01).

References