This article is mentioned in:

Introduction

Tooth development is associated with the continuous interaction between mesenchymal cells and epithelial cells (1,2). As the hardest component of teeth, mammalian enamel serves an essential role in mastication and occlusion. In mammals, enamel development is categorized into various stages: Initiation, bud, cap and bell. Amelogenesis begins with the proliferation of restricted epithelia, which forms dental lamina, and subsequently invaginates into adjacent mesenchyme cells; these cells develop into a bud structure (referred to as the bud stage) (3,4). Following bud generation, tooth germ cells differentiate into inner enamel epithelium (IEE) cells and outer enamel epithelium (OEE) cells. Preameloblasts are provided by IEE cells and further develop into mature ameloblasts, which secrete enamel matrix proteins, including amelogenin, X-linked (Amelx), ameloblastin (Ambn) and enamelin (Enam); these secreted proteins form enamel (5). In rodent mature molars, ameloblasts are not present and are replaced by mineralized enamel, whereas in mature incisors, the dental epithelial stem cells in the labial cervical loop (laCL) maintain the capacity of self-renewal and differentiation, thus presenting immense potential for tooth regeneration (6,7).

Mammalian tooth development involves a complex signaling network, which includes various growth factors and transcription factors during the developmental process. Various transcription factors, including paired box 9, paired like homeodomain 2, Msh homeobox 1 (Msx1), Msh homeobox 2 (Msx2) and distal-less homeobox 2, are expressed in dental epithelium and mesenchyme, and participate in odontogenesis (8). B-cell CLL/lymphoma 11B (Bcl11b) (also known as COUP-TF-interacting protein 2) is a C2H2 zinc finger transcription factor, which has been demonstrated to serve crucial roles in the thymus (9), central nervous system (10), and during epidermal development (11). Mice with Bcl11b knockdown die perinatally, thus indicating an essential role for Bcl11b in vertebrate development (12). It has previously been reported that Bcl11b serves functions during tooth development, including ameloblast formation (13), and asymmetric development of the laCL and lingual cervical loop (liCL) (14). Early genetic studies demonstrated that Bcl11b knockout mice exhibited delayed odontogenesis at the bud stage and subsequent cap and bell stages, as well as thinner enamel (13). Furthermore, abnormal development occurred at the laCL with improper differentiation of ameloblasts, and at the lingual side with ectopic formation of ameloblast-like cells in Bcl11b knockout mice (14).

The present study aimed to generate an overview regarding the regulatory effects of Bcl11b in enamel development. Initally, the protein expression levels of Bcl11b were detected, thus revealing that Bcl11b was expressed throughout rat embryonic odontogenesis. Notably, Bcl11b expression was not detected in the epithelia or epithelial-originated tissues of postnatal rat teeth; however, it was continuously expressed in murine postnatal tooth germ cells. Combined with a previous report regarding the Bcl11b expression pattern in mice (5), the present study potentially indicated that Bcl11b may not be essential in postnatal amelogenesis, based on the parallel morphology of rat and mouse teeth but different Bcl11b expression profile during late development. Furthermore, the expression levels of various enamel-associated genes were detected, including Amelx, Ambn, Enam, kallikrein-related peptidase 4 (Klk4), matrix metallopeptidase 20 (Mmp20) and Msx2, which were regulated by Bcl11b. These results suggest that Bcl11b has principal functions in embryonic odontogenesis, particularly in dental epithelial development but less noticeably in postnatal tooth development.

Materials and methods

Cell culture and transient transfection

HAT-7 cells are dental epithelial cells originating from rat cervical loop epithelium, which were provided by Professor Hidemitsu Harada's Laboratory (Department of Oral Anatomy and Developmental Biology, Osaka University Graduate School of Dentistry, Osaka, Japan). The cells were cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Hyclone; GE Healthcare, Logan, UT, USA) and 1% penicillin/streptomycin. Three small interfering (si)RNAs (si1, si2 and si3) that were designed to specifically target various sites of Bcl11b (NM_001277288.1), as well as a negative control siRNA, were purchased from RiboBio Co., Ltd. (Guangzhou, China). Msx2 cDNA open reading frame (ORF) clone (cat. no. RR202436) and pCMV6-Entry plasmid (cat. no. PS100001) were purchased from OriGene Technologies, Inc. (Beijing, China). Cells were cultured in 6-well plates in culture medium for 24 h at 37°C prior to transfection. siRNA was transfected at a concentration of 50 nM into HAT-7 cells (70–80% confluence) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc). HAT-7 cells were harvested 72 h post-transfection. In addition, 2 µg Msx2 ORF plasmid was transfected using MegaTran 1.0 (cat. no. TT200002; OriGene Technologies, Inc.) into cells (70–80% confluence) in a 60-mm culture dish cultured in DMEM/F12 supplemented with 10% FBS. Transfected cells were harvested after a 72 h culture at 37°C in an incubator containing 5% CO2. RNA and protein samples were extracted from all transfected samples.

Animals, histology and immunohistochemistry

C57BL/6 mice and Sprague Dawley rats were commercially purchased from the Animal Centre (Sichuan University, Sichuan, China). Animal care and handling was conducted in compliance with the guidelines of the Ethics Committee of West China College of Stomatology (Sichuan University) for animal research. All experimental protocols were approved by the Sichuan University Science Animal Care and Use Committee. Embryos and mandibles from postnatal offspring were collected at various time points, which were then used for sectioning and subsequent immunostaining. The first detection of a vaginal plug was considered embryonic day (E) 0.5 and the date of birth was considered postnatal day (P) 0.5. All tissues were treated with 4% paraformaldehyde and the postnatal mandibles were treated with 10% EDTA for demineralization. Subsequently, the tissues were dehydrated with a sequential concentration of alcohol and finally with xylene. The tissues were embedded in paraffin and were cut into 5–7 µm sections.

To examine Bcl11b protein expression by immunohistochemistry, sections were dried overnight in a 60°C incubator, were dehydrated with sequential concentrations of alcohol, and were treated with 3% hydrogen peroxide for 15 min at room temperature to block endogenous peroxidase activity. Subsequently, the sections were incubated in slightly boiling 0.1 M sodium citrate buffer at 95°C for 15 min. Sections were then incubated with goat serum working solution (ZSGB-BIO, Beijing, China) for 30 min, followed by 1 h (37°C) and then overnight (4°C) incubations with anti-Bcl11b antibody (1:300; cat. no. 12120; Cell Signaling Technology, Inc., Danvers, MA, USA) and anti-Sonic hedgehog (Shh; 1:500; cat. no. 06-1106; EMD Millipore, Billerica, MA, USA), which was used as a positive control. Following primary antibody incubation, the slides were treated with horseradish peroxidase-labeled anti-rabbit secondary antibody (ChemMate EnVision Detection kit; Dako, Carpinteria, CA, USA) for 30 min at 37°C. Avidin biotin complex and 3,3′-diaminobenzidine substrate were used as a reporting system, and the nuclei were stained with hematoxylin. Finally images were captured under a light microscope (BX43F; Olympus Corporation, Tokyo, Japan).

Chromatin immunoprecipitation (ChIP) assay

The ChIP assays were performed according to the manufacturer's protocol of the ChIP assay kit (cat. no. 17-10086; Upstate; Merck Millipore, Darmstadt, Germany), and all reagents were provided in the kit. Briefly, HAT-7 cells were plated in 100 mm dishes and harvested the next day at ~90% confluence. Cells were treated with a final concentration of 1% formaldehyde, 10X glycine was added to quench unreacted formaldehyde. After two washes with PBS, cells were collected for lysis and subsequent nuclear lysis. The DNA/chromatin complex obtained from nuclear lysis were sonicated into fragments and the protein/DNA complex was immunoprecipitated with Bcl11b antibody. Finally purified DNA was obtained and underwent polymerase chain reaction (PCR).

All PCR analyses were conducted as follows: Initial denaturation at 94°C for 3 min followed by 32 cycles at 94°C for 20 sec, 59°C for 30 sec and 72°C for 30 sec, and final extension at 72°C for 2 min. The 2X PCR Master Mix (Thermo Fisher Scientific, Inc.) was used to conduct the PCR reaction. Primers (forward CTGAGGAAACACAAGACCAA and reverse GCGATGGAGAGGTACTGT) were used to amplify the Msx2 promoter. GAPDH primer (forward TATGACTCTACCCACGGCAAG and reverse TACTCAGCACCAGCATCACC) was used as a control primer. Size of sonicated DNA fragments were confirmed by 2% agarose gel electrophoresis.

To ensure the ChIP assay had been successfully performed, anti-RNA Polymerase II was used as a positive control and normal mouse immunoglobulin G was used to replace the Bcl11b antibody as a negative control, thus revealing nonspecific immunoprecipitation. GAPDH primer was used as a primer control.

RNA preparation and reverse transcription-quantitative (RT-q)PCR

RNA extraction was performed using RNAiso (Takara Biotechnology Co., Ltd., Dalian, China) according to the manufacturer's protocol. RT was performed using the First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). qPCR was conducted using SYBR Green I kit (Thermo Fisher Scientific, Inc.), and all quantification cycle (Cq) values were normalized to GAPDH levels (15). For qPCR, a reaction volume of 10 µl was prepared as follows: 5 µl SYBR Green I master mix, 100 ng cDNA, 0.2 µl forward and reverse primers (0.4 µM final concentration), and water. Cycling conditions were as follows: Denaturation at 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 30 sec, and finally 1 cycle at 95°C for 15 sec, 60°C for 1 min and 95°C for 15 sec. All qPCR products were examined by melt curve analysis and 2% agarose gel electrophoresis. The primers used are listed in Table I.

Table I. Primer sequences.

Table I.

Primer sequences.

Gene	Accession number	Primer sequence (5′-->3′)
Bcl11b	NM_001277288.1	F: GATCGGCAAGGAGGTGTA
		R: CATCATTAGTCAGCAAGTGTTC
Msx2	NM_012982	F: CTGAGGAAACACAAGACCAA
		R: GCGATGGAGAGGTACTGT
Amelx	NM_001271078.1	F: AGCTTTTGCTATGCCCCTACC
		R: GATGAGGCTGAAGGGTGTGACT
Ambn	NM_012900.1	F: CTGCTCCTGTTCCTGTCCCTA
		R: GCTTCCCAACTGTCTCATTGTC
Enam	NM_001106001.1	F: GGTGTCTTCCCTCTCCCTAAA
		R: AGTGGTTTGCCATTGTCTTTCT
Mmp20	NM_001106800.1	F: GCCTTGCTGTCCTTGTCAC
		R: GAGGTGGTAGTTGCTCCTGAAG
Klk4	NM_001004101.1	F: CCGAACTACAATGACCCTTCTT
		R: TCAGATGCTACCGAGAGATTCA
GAPDH	NM_017008.4	F: TATGACTCTACCCACGGCAAG
		R: TACTCAGCACCAGCATCACC

[i] Bcl11b, B-cell CLL/lymphoma 11B; Msx2, Msh homeobox 2; Amelx, amelogenin, X-linked; Ambn, ameloblastin; Enam, enamelin; Mmp20, matrix metallopeptidase 20; Klk4, kallikrein related peptidase 4.

Protein extraction and western blotting

Protein extraction was conducted using a total protein extraction kit (Nanjing KeyGen Biotech Co., Ltd., Nanjing, China). Protein samples were treated with 4X loading buffer and incubated at 100°C for 5–10 min. Briefly, protein concentration was determined using the Bicinchoninc Acid Protein Assay kit ((Nanjing KeyGen Biotech Co., Ltd.). Equal amounts of protein (30 ng) for each sample were separated by 8% SDS-PAGE and transferred to polyvinylidene difluoride membranes (Bio-Rad, Laboratories, Inc., Hercules, CA, USA). The membranes were then incubated with 5% fat-free milk at room temperature for 2 h, followed by primary antibody incubation at 4°C overnight. After three washes, the membranes were incubated with appropriate secondary antibodies at room temperature for 2 h. Finally, Immobilon Western Chemiluminescent Horseradish Peroxidase Substrate (WBKLS0500; EMD Millipore) was used for visualization combined with the LAS-3000 imaging system (Bio-Rad Laboratories, Inc.). The primary antibodies used for western blotting were as follows: Anti-Bcl11b (1:1,000; cat. no. 12120; Cell Signaling Technology, Inc.), anti-Msx2 (1:500; cat. no. sc-17731; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), anti-amelogenin (1:500; cat. no. sc-32892; Santa Cruz Biotechnology, Inc.), anti-ameloblastin (1:500; cat. no. sc-50534; Santa Cruz Biotechnology, Inc.), anti-Klk4 (1:500; cat. no. sc-20622; Santa Cruz Biotechnology, Inc.), anti-Mmp20 (1:1,000; cat. no. ab76109; Abcam, Cambridge, UK) and anti-β-actin (1:2,000; cat. no. ab3280; Abcam). In addition, anti-mouse, anti-rabbit and anti-goat antibodies (1:10,000; cat. nos. ZB-2305, ZB-2301 and ZB-2306; ZSGB-BIO) were used as secondary antibodies.

Cell proliferation assay

HAT-7 cells were seeded in a 48-well plate, transfected with Bcl11b-specific siRNA for 48 h, and were incubated with 5-ethynyl-2′-deoxyuridine (EdU; final concentration, 20 µM; RiboBio Co., Ltd.) for 2 h at 37°C. Images were acquired under a Leica DMI6000 B inverted fluorescence microscope (Leica Microsystems, Wetzlar, Germany). The number of fluorescent cells was counted and used to calculate proliferation rate (fluorescent cells/total cells).

Statistical analysis

Student's t-test was used to perform all statistical analyses, which were analyzed using Excel 2010 (Microscoft Corporation, Redmond, WA, USA). Data are presented as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference (16).

Results

Bcl11b expression pattern in early tooth germ cells

To determine the expression pattern of Bcl11b in rat teeth, the present study detected Bcl11b protein expression during the initiation stage and in postnatal tooth germ cells. The results demonstrated that Bcl11b was highly expressed in the thickened dental lamina at E12.5 (Fig. 1A), as detected by anti-Bcl11b immunohistochemistry; however, expression levels were much lower in the mesenchyme (Fig. 1A'). Bcl11b was also expressed in the tooth bud at E15.5 (Fig. 1B) as well as in the adjacent mesenchyme. During the later cap and bell stages, Bcl11b exhibited high expression in OEE cells, cervical loops, and stratum intermedium (SI) cells; however, levels were reduced in IEE cells and ameloblasts, and expression was negative in the mesenchyme and stellate reticulum cells (Fig. 1C and C'). In the neonatal molars, Bcl11b was detected in the IEE, OEE and SI cells (Fig. 1D and D'), similar to the late cap stage. However, no obvious expression was detected in the postnatal mineralizing tooth (Fig. 1E and F), which was confirmed by positive control Shh expression (Fig. 1F and F') and nuclear-specific location of Bcl11b. In addition, Bcl11b was detected in mineralized mouse teeth and was restricted to the root area (Fig. 1G and G'). Msx2 was negatively expressed in embryonic tooth germs at E18.5 (Fig. 1H); however, it was strongly expressed in mature ameloblasts at P1.5 (Fig. 1H').

Figure 1. Bcl11b expression pattern in rat teeth. Bcl11b immunostaining appeared brown in all panels colored by 3,3′-diaminobenzidine. Bcl11b expression in rat developing molars at (A) E12.5, (B) E15.5, (C) E18.5 and (D) P0.5 (D). (A', B', C', D' and G') are partial magnifications of (A, B, C, D and G) respectively, as indicated by red rectangles. No detectable Bcl11b expression was detected in (E) P2.5 molars, and (F) P8.5 molars and incisors. Sonic hedgehog expression was used as a positive control in (E') P2.5 molars, and (F') P8.5 molars and incisors. Bcl11b was expressed in mineralized mouse teeth at (G and G') P14. Msx2 was more strongly expressed in (H') mature ameloblasts (red arrow) compared with in (H) embryonic tooth germs. [Scale bars: (A, B, E, E', F, F') 200 µm; (C, D, G', H, H') 100 µm; (A', B', C', D') 50 µm; (G) 500 µm]. Bcl11b, B-cell CLL/lymphoma 11B; oe, oral epithelium; de, dental epithelium; dm, dental mesenchyme; oee, outer enamel epithelium; iee, inner enamel epithelium; a, ameloblast; sr, stellate reticulum; p, papilla; cl, cervical loop; si, stratum intermedium; E, embryonic day; P, postnatal day.

Knockdown of Bcl11b expression inhibits HAT-7 cell proliferation

The present study analyzed the effects of Bcl11b expression on dental epithelial cell proliferation using the EdU assay. The results indicated that transfection with Bcl11b-specific siRNA statistically attenuated HAT-7 proliferation (Fig. 2). The proliferative rate was represented by EdU-positive cells. These results suggest that Bcl11b may promote dental epithelial cell proliferation during tooth development.

Figure 2. Cell proliferation of Bcl11b knockdown cells. (A) EdU-labeled cells were detected and 4′,6-diamidino-2-phenylindole was used to stain cell nuclei in siRNA-treated cells and control cells. Scale bars, 50 µm. (B) Counting of EdU-positive cells following 48 h siRNA transfection. *P<0.05, n=3. Bcl11b, B-cell CLL/lymphoma 11B; EdU, 5-ethynyl-2′-deoxyuridine; SiN, negative control siRNA-transfected cells; Si1, Bcl11b siRNA-transfected cells. siRNA, small interfering RNA.

Bcl11b regulates the expression of enamel-associated genes and proteins

The present study aimed to determine whether Bcl11b exerts an effect on enamel-associated gene and protein expression. Two efficient siRNAs: Si1 and Si2, were screened from the three siRNA molecules designed to knockdown Bcl11b expression (Fig. 3A). Following transfection of HAT-7 cells with Bcl11b-specific siRNA the expression levels of enamel matrix genes and proteins, including Amelx, Ambn and Enam, were significantly downregulated. In addition, two enamel matrix enzymes, Klk4 and Mmp20, exhibited slight decreases at the gene and protein level (Fig. 3B-D); however, these findings were not significant (P=0.074 and 0.087).

Figure 3. Enamel-associated genes and proteins were downregulated following knockdown of Bcl11b. (A) Si1 and Si2 were efficient siRNA molecules, as determined by western blotting. Total protein was extracted from HAT-7 cells 72 h post-transfection. (B) Quantitative polymerase chain reaction and (C and D) western blotting demonstrated that enamel-associated genes and proteins were downregulated by Bcl11b knockdown. Statistical significance was determined using Student's t-test. *P<0.05, **P<0.005, ***P<0.001, n=3. ns, no significance; Bcl11b, B-cell CLL/lymphoma 11B; Amelx/AMGN, amelogenin, X-linked; Ambn/AMBN, ameloblastin; Enam, enamelin; Mmp20, matrix metallopeptidase 20; Klk4, kallikrein related peptidase 4; SiN, negative control siRNA-transfected cells; Si1/2/3, Bcl11b siRNA-transfected cells. siRNA, small interfering RNA.

Msx2 is associated with enamel-related gene regulation

As shown in Fig. 4A, knockdown of Bcl11b significantly downregulated the expression of Msx2. To determine whether Bcl11b regulated enamel expression through Msx2, the binding of Bcl11b to the promoter region of Msx2 was determined in HAT-7 cells using a ChIP assay. Msx2 promoter enrichment in Bcl11b immunoprecipitation was determined using PCR (Fig. 4B and C). As shown in Fig. 4C Msx2 was significantly enriched in Bcl11b immunoprecipitation, compared with the anti-polymerase II positive control. These results indicate that Msx2 is a target gene of the transcription factor Bcl11b (Fig. 4B and C).

Figure 4. Msx2 regulates enamel-associated genes. Msx2 is a target gene of the transcription factor Bcl11b, as verified by ChIP assay. (A) Knockdown of Bcl11b led to a significant decrease in Msx2 expression. *P<0.05, **P<0.005, n=3. (B) PCR products of ChIP assay were verified by 2% agrose gel electrophoresis. Bcl11b, anti-Bcl11b antibody; input, cell lysate; Positive control, anti-RNA polymerase II antibody; GAPDH, GAPDH primer; pBcl11b, Bcl11b promoter primer; Bcl11b, Bcl11b primer. (C) Analysis of relative fold enrichment of ChIP. Quantitative PCR result between the Bcl11b experimental group and the positive control group. Student's t-test was used for statistical analysis. *P<0.05, n=3. (D) Relative expression of enamel-associated genes following Msx2 overexpression. *P<0.05, ***P<0.001, n=3. ns, not significant; Bcl11b, B-cell CLL/lymphoma 11B; Msx2, Msh homeobox 2; Amelx, amelogenin, X-linked; Ambn, ameloblastin; Enam, enamelin; Mmp20, matrix metallopeptidase 20; Klk4, kallikrein related peptidase 4; PCR, polymerase chain reaction.

The present study also transfected an Msx2 ORF cDNA clone into HAT-7 cells; pCMV6-Entry plasmid was used as a control. The results demonstrated that all enamel-associated genes, including Ambn, Amelx, Enam and Klk4, were downregulated by overexpression of Msx2 (Fig. 4D). Notably, Bcl11b was also significantly decreased. These results suggest that a feedback loop may exist between Bcl11b and Msx2. However, further experiments are required.

Discussion

The present study demonstrated that Bcl11b regulates enamel-associated gene and protein expression, via its transcriptional target Msx2, thus suggesting that Bcl11b serves a role in sustaining differentiation of epithelial cells.

Bcl11b-null mice exhibited a reduction in early tooth germ size, as well as aberrant ameloblast proliferation and differentiation, and reduced stellate reticulum (13). Furthermore, asymmetric development of incisor laCL and liCL was disrupted by ectopic proliferation of epithelial cells, thus suggesting that Bcl11b was crucial for epithelial cell proliferation and differentiation (14). At the molecular level, Bcl11b is expressed at all stages throughout embryonic odontogenesis in mice and rats, particularly in the epithelium; however, its expression is reduced during late postnatal rat tooth development (Fig. 1). Notably, Bcl11b protein was continuously expressed in mouse teeth until adulthood (Fig. 1G and G'). In mineralized mouse molars, Bcl11b appeared in preameloblasts, ameloblasts, dental follicle cells (DFCs) and periodontal ligament cells (PLCs). In mineralized mouse incisors, Bcl11b was similarly located in preameloblasts, ameloblasts, DFCs and PLCs (data not shown); and in the adult cervical loop area it was strongly expressed in OEE of the laCL and liCL, whereas it was lowly expressed in IEE and mature ameloblasts (5). Mouse and rat teeth share similarities in shape and regulation pattern during odontogenesis, with a different expression pattern of Bcl11b. However, teeth in newborn Bcl11b mutant mice (P0) exhibited indistinguishable differences in morphogenesis and mineralization compared with wild type mice (13), which may suggest a nonessential role for Bcl11b in late embryonic and postnatal tooth development. Furthermore, the present study revealed that in Bcl11b siRNA-transfected HAT-7 cells, proliferation was reduced compared with the control, which was consistent with the reduced proliferation of cells in the laCL of P21 Bcl11b mutant mouse incisors (5). These findings may suggest that Bcl11b maintains the proliferation of non-differentiated epithelial cells.

Msx2, together with Msx1 and Msx3, belongs to the Msx homeobox gene family, lack of which may cause defects in tooth cusp morphogenesis and amelogenesis (17,18). Msx2 protein was markedly expressed in secretory ameloblasts (Fig. 1H'), and has been reported to control expression of the extracellular matrix gene laminin 5α3 to mediate terminal ameloblast differentiation (17). These findings suggested that Msx2 serves a significant role in enamel development. The present study demonstrated that the expression of enamel-associated genes, such as Amelx, Ambn, Enam and Mmp20, were decreased post-transfection with Msx2 overexpression DNA (Fig. 4D), and Bcl11b expression was also downregulated. Previous studies have demonstrated that Ambn prevented Msx2 expression (19) and Msx2 transcriptionally suppressed Ambn (20), thus presenting a reciprocal regulatory mechanism between Msx2 and Ambn. A dose-dependent relationship has also been identified between Msx2 and enamel-related genes. In Msx2−/− mice, Amelx and Enam were significantly decreased, whereas in Msx2+/− heterozygous mice Amelx exhibited increased expression (18). Furthermore, knockdown of Bcl11b also led to diminished Msx2 expression (Fig. 4A), and results of a ChIP assay suggested that Msx2 was a target gene of the transcription factor Bcl11b (Fig. 4B) (13). Therefore it may be hypothesized that a feedback regulatory network exists between the two molecules for proper expression and function during amelogenesis (Fig. 5). In addition, Msx2 is highly expressed in osteoclasts and regulates bone resorption in the alveolar compartment (21), which may provide evidence regarding the regulatory mechanism between Msx2 and Bcl11b, since Bcl11b was continuously observed in the alveolar areas in the postnatal secretory and mature stages (data not shown).

Figure 5. Regulatory network among Bcl11b, Msx2 and enamel matrix proteins. Bcl11b promoted expression of enamel matrix proteins Amelx, Ambn and Enam, and Msx2. Msx2 regulated Amelx and Ambn in a dose-dependent manner. In turn, Msx2 inhibited enamel matrix protein expression, thus indicating the existence of a negative feedback loop between Msx2 and Bcl11b. Bcl11b, B-cell CLL/lymphoma 11B; Msx2, Msh homeobox 2; Amelx, amelogenin, X-linked; Ambn, ameloblastin; Enam, enamelin.

Amelogenin is the most abundant component of the enamel matrix, and together with other non-amelogenin matrix proteins, ameloblastin and enamelin, is directly responsible for enamel formation (22). Aberrant expression of these proteins results in grievous amelogenesis imperfecta, which is characterized by disorganized hypoplastic enamel, thinner enamel and chalky-white discoloration (23–25). Adhesion of ameloblastin to ameloblasts maintains the differentiation fate of secretory ameloblasts but inhibits proliferation (23). Bcl11b is a transcriptional suppressor in the central nervous, tumor and cutaneous systems (11,26); however, it has been reported that Bcl11b-null mice exhibit defects in enamel (13) and knockdown of Bcl11b in the present study induced decreased enamel matrix expression. A previous study reported that Bcl11b was detected on promoter regions of amelogenin, enamelin and laminin 5α3, which control ameloblast terminal differentiation (13,17). Furthermore, it has been reported that Msx2 acts as a dose-dependent transcriptional suppressor that regulates amelogenin expression through antagonistic protein-protein interaction with CCAAT/enhancer-binding protein α, which binds to its homologous region on the mouse amelogenin promoter (27). Taken together, Bcl11b positively regulates enamel development, and its role in ameloblast differentiation may be mediated via Msx2 and enamel matrix proteins. In addition, the present data revealed that Bcl11b appeared to positively regulate Mmp20 and Klk4, and their expression is consistent with enamel proteins; thus suggesting that enamel proteinase expression relies on their enamel matrix substrates.

In conclusion, there is a complex regulatory network among Bcl11b, Msx2 and enamel matrix proteins (Fig. 5). Bcl11b serves a critical role in early epithelial development and amelogenesis (13,14), and promotes the expression of enamel matrix proteins, which are deemed to be markers of ameloblasts. These findings suggested that Bcl11b has a role in mediating ameloblast differentiation. However, in the present study, Bcl11b was revealed to possess a spatiotemporal differential regulatory role during rat enamel development. These results indicated that postnatal Bcl11b may not be as essential as it is during embryonic tooth development.

Acknowledgements

The present study was supported by the Nature Science Foundation of China (grant no. 81271119), the Program for New Century Excellent Talents by the State Education Commission of China (grant no. NCET-13-0385), the Key Technology R&D Program of Sichuan Province of China (grant nos. 13ZC0971, 2013GZX0158 and 13ZC0979) and the Basic Research Program of Sichuan Province of China (grant no. 2013JY0019).

References