Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2017 Volume 16 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response

  • Authors:
    • Chunhua Wang
    • Zongyao Hao
    • Jun Zhou
    • Li Zhang
    • Yexiang Sun
    • Chaozhao Liang
  • View Affiliations / Copyright

    Affiliations: Department of Burns, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China, Department of Urology, The First Affiliated Hospital of Anhui Medical University, Hefei, Anhui 230032, P.R. China
  • Pages: 922-928
    |
    Published online on: May 25, 2017
       https://doi.org/10.3892/mmr.2017.6631
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

In the present study, the protective effect and the potential underlying mechanism of rutaecarpine (Ru) on renal ischemia reperfusion injury (IRI) in rats were investigated. A renal ischemia reperfusion mouse model was established. Ru at 30, 60 mg/kg administered intraperitoneally prior to reperfusion led to attenuated renal injury. The results demonstrated that Ru treatment significantly reduced the content of serum creatinine, urea nitrogen and neutrophil gelatinase‑associated lipocalin in rats with renal IRI. In addition, Ru treatment improved the degree of renal proximal tubular necrosis, decreased the content of inflammatory cytokines in reperfused renal tissue and increased serum superoxide dismutase levels to protect the kidney. The associated underlying mechanism may involve the inhibition of p38 kinase phosphorylation and c‑Jun N‑terminal kinase, anti‑lipid peroxidation, elimination of free radicals, and a reduction in the degree of apoptotic damage and oxidative stress injury induced by renal IRI. Therefore, Ru may be a suitable compound for the prevention and treatment of renal IRI.

Introduction

In the late 1970s, Wasser et al (1) first observed that renal injury became more severe following renal ischemia reperfusion, thus, the concept of renal ischemia reperfusion injury (IRI) was introduced (1). The kidney, which is a hypertransfusion organ, is more sensitive to ischemia and ischemia reperfusion than other organs. The incidence of renal ischemia reperfusion worldwide is ~13–38%, of which ~80% is induced by acute renal tubular injury (2–4). Renal IRI is commonly observed in clinical settings, including during kidney transplantation, renal vascular surgery, extracorporeal lithotripsy and shock resuscitation. Renal IRI is a severe injury, which results in acute ischemic renal failure. It often induces delayed graft function and upregulates the expression of major histocompatibility complex (MHC) I and MHC II antigens, thereby aggravating immunological rejection and leading to serious graft function loss (5–7).

Inflammation serves an important role in the occurrence and progression of renal IRI. Previous studies have demonstrated that neutrophil infiltration in the reperfused renal tissue, and the levels of tumor necrosis factor (TNF)-α, transforming growth factor-β, interleukin (IL)-6, IL-1β, inflammatory cytokines, monocyte chemoattractant protein, IL-8 and normal T cells, secretory factors and other chemotactic factors increase in IRI (8–10). Reactive oxygen species (ROS) are also produced in large quantities under these conditions. High concentrations of ROS induce apoptosis and necrosis through the cell oxidative stress response. Therefore, inhibiting the inflammatory signaling pathway and the production of inflammatory mediators may effectively reduce kidney damage (11–13). The mitogen-activated protein kinase (MAPK) pathway is known as the cellular survival pathway. The MAPK pathway in mammalian cells is involved in a number of processes affecting the final cellular response, including cell proliferation, differentiation and adaptation to environmental stress and apoptosis (14). The c-Jun N-terminal kinase (JNK)/p38 MAPK signaling pathway, a subclass of MAPKs, is active in a number of tissues and cells, and serves an important role in mediating inflammatory reactions. Previous studies have demonstrated that the JNK/p38 MAPK signaling pathway is activated in cells following IRI (15,16). Inflammatory cytokines, including nuclear factor (NF)-κB, intercellular adhesion molecule (ICAM)-1, TNF-α and IL-6, also activate this pathway (17,18). Thus, blocking the JNK/p38 MAPK signaling pathway and inhibiting the production of ROS may effectively alleviate early organ dysfunction following renal IRI.

Evodia rutaecarpa, was originally recorded in ‘Shen Nong's Herbal Classic’ (19), and is classified as a traditional interior-warming herb and a medium-grade drug in traditional Chinese medicine. The herb is pungent, bitter, heated and slightly poisonous. In traditional Chinese medicine, it is believed to affect the liver, spleen, stomach and kidney channels and is commonly used to treat hypertension, and gastrointestinal and gynecological diseases. Rutaecarpine (Ru), a quinazoline carboline alkaloid, is one of the main components of E. rutaecarpa (Fig. 1) (20). Ru exhibits significant anti-inflammatory and immunomodulatory effects. Previous studies have investigated the pharmacological activity of this substance and have demonstrated its multiple-targeting effects (21–23). Ru appears to inhibit secretion of inflammatory mediators, release of ROS, expression of adhesion molecules, activation and infiltration of neutrophils, as well as generally regulate immunity (21–23). At present, to the best of our knowledge, there is no information available on the ability of Ru to reduce multiple-organ IRI. Therefore, the effect and underlying mechanism of Ru on early-stage renal IRI were investigated using a rat renal IRI model. The influence of Ru on inflammatory mediators, the JNK/p38 MAPK signaling pathway and the oxidative stress response were also investigated. The present results may provide information about the potential use of Ru as a new drug to treat organ IRI.

Figure 1.

Evodia rutaecarpa and the structure of rutaecarpine. Adapted from Ref. 19.

Materials and methods

Materials

A total of 50 adult male Sprague-Dawley rats (age, 6–8 weeks; weight, 250±10 g) were obtained from the Institute of Laboratory Animal Sciences, Anhui Medical University (Hefei, China). All the animals were housed in individual cages with a constant temperature (18–20°C) and humidity (65–69%) at 12/12 h light/dark cycle with free access to food and water. All experimental procedures were approved by the Animal Experimental Ethics Committee of Anhui Medical University (Hefei, China). Ru was obtained from the School of Pharmaceutical Sciences, Sun Yat-sen University (Guangzhou, China). The nuclear magnetic resonance (NMR) analysis results for Ru were as follows: 1H NMR (500 MHz, d6-DMSO): δ 3.21 (t, J=7.0 Hz, 2H), 4.44 (t, J=7.0 Hz, 2H), 7.12 (dt, J=7.5, 1.0 Hz, 1H), 7.27 (dt, J=7.5, 1.0 Hz, 1H), 7.47–7.51 (m, 2H), 7.62 (d, J=8.5 Hz, 1H), 7.70 (d, J=7.5 Hz, 1H), 7.78–7.84 (m, 1H), 8.18 (dd, J=8.0, 1.0 Hz, 1H), 11.88 (s, 1H); 13C NMR (125 MHz, d6-DMSO): 160.5, 146.9, 145.2, 138.8, 134.7, 127.0, 126.4, 126.3, 126.2, 124.8, 124.6, 120.5, 120.1, 119.6, 117.8, 112.5, 40.9, 18.7; HRMS calcd for C18H13N3O 287.1059; Found: 287.1064. Enzyme-linked immunosorbent assay (ELISA) kits for NF-κB (cat. no. H202), ICAM-1 (cat. no. KF066), TNF-α (cat. no. H052) and IL-6 (cat. no. H007) were purchased from Bioval Technologies (Shanghai, China). Superoxide dismutase activity (SOD; cat. no. A001-1) and lipid peroxidation malondialdehyde (MDA; cat. no. A003-1) assay kits were purchased from Nanjing Jian Cheng Bioengineering Research Institute (Nanjing, China).

Experimental design

The IRI rat model was established by superior mesenteric artery (SMA) occlusion, as described previously (24). Rats were anesthetized with chloral hydrate (100 mg/kg) intraperitoneally and randomly divided into the following five groups (n=10/group): Sham group (sham operation; isolation of the SMA without occlusion), normal saline (NS) group (a group treated with 10 ml/kg saline 10 min prior reperfusion); IRI group (intestinal ischemia reperfusion), Ru-30 group (30 mg/kg Ru treatment; surgery was performed in the same way as the IRI group with administration of 10 ml/kg 3% Ru intraperitoneally 10 min prior to reperfusion), and Ru-60 group (60 mg/kg Ru treatment; surgery was performed in the same way as the IRI group with administration of 10 ml/kg 6% Ru intraperitoneally 10 min prior to reperfusion). Blood and kidney samples were obtained for analysis after 2 h and 24 h of reperfusion, respectively.

Measurement of serum levels of creatinine (Cr), blood urea nitrogen (BUN) and neutrophil gelatinase-associated lipocalin (NGAL)

Serum levels of Cr and BUN were measured on an America Johnson FS 5.1 Biochemistry analyzer (Johnson & Johnson, New Brunswick, NJ, USA). NGAL levels were measured using an NGAL Rapid ELISA kit (cat. no. KIT 037; Neobioscience, Shenzhen, China) according to the manufacturer's instructions.

Renal histopathological assessment

The left kidney sections were stained with haematoxylin and eosin (H&E) for the observation of renal tissues structure (BX50; Olympus Corporation, Tokyo, Japan). Renal tissues were immersed in 4% paraformaldehyde for 4 h and transferred to 70% ethanol. Individual lobes of renal tissues biopsy material were placed in processing cassettes, dehydrated through a serial alcohol gradient and embedded in paraffin wax blocks. Prior to staining, 5-µm-thick renal tissue sections were dewaxed in xylene, rehydrated through decreasing concentrations of ethanol, and washed in PBS and then stained with H&E. After staining, sections were dehydrated through increasing concentrations of ethanol and xylene. Histological assessment of tubular necrosis was measured semi-quantitatively using the method by McWhinnie et al (25). A total of 10 randomly selected high-power fields were observed per slide. Symptoms were scored from 0 to 3 according to tubular profiles involving an intersection: 0, normal structures; 1, tubular epithelial swelling, nuclear condensation, loss of the brush border with up to one third of the tubular profile exhibiting nuclear loss; 2, more than one-third though less than two-thirds of the tubular profile exhibiting nuclear loss; 3, over two-thirds of the tubular profile exhibiting nuclear loss.

Measurement of NF-κB, TNF-α, IL-6 and ICAM-1 in renal tissues

Renal tissues were harvested and immediately homogenized on ice with 5 volumes of normal saline. The homogenates were centrifuged at 1,200 × g for 10 min at 4°C. NF-κB, TNF-α, IL-6 and ICAM-1 levels were measured in renal tissue supernatants using commercial ELISA kits (Bioval Technologies, Shanghai, China)).

Reverse transcription-polymerase chain reaction (RT-PCR) was performed as previously described (26). Briefly, renal tissue RNA was extracted using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in accordance with the manufacturer's instructions. Any potential DNA contamination was removed by RNase-free DNaseI (cat. no. M6101, Promega Biotech Co., Ltd., Beijing, China) treatment. Then, cDNA was synthesized from the total RNA using AMV reverse transcriptase (cat. no. M5101, Promega Biotech Co., Ltd.) according to the manufacturer's instructions. The primer sequences are listed in Table I. Each PCR reaction (20 µl total) contained 1X PCR buffer, 1.5 µM of NF-κB, TNF-α, IL-6, ICAM-1 or 0.15 µM GAPDH primers, 500 µM dNTPs, 0.1% RNase-free H2O, 1 U of Taq polymerase (cat. no. EP0702, Invitrogen; Thermo Fisher Scientific, Inc.) and 3 µl of the cDNA template. The reaction was performed in a thermal cycler as follows: 95°C for 5 min then 36 cycles of 95°C for 1 min, 50°C for 1 min and 72°C for 1 min. The amplified products were separated using 1.5% agarose gel electrophoresis, and images were obtained on a Gel Doc 2000 Imager System (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Table I.

Primer sequences for reverse transcription-polymerase chain reaction.

Table I.

Primer sequences for reverse transcription-polymerase chain reaction.

Gene targetPrimerSequence (5′-3′)Product size (bp)
NF-κBForward GAGCCACCAATCCACACAGAGT107
Reverse ATGAGCTTCTGGCGTTTCCTCT
TNF-αForward GCAGAAGAGGCACTCCCCCA326
Reverse GATCCATGCCGTTGGCCAGG
IL-6Forward AGTTGCCTTCTTGGGACTGA191
Reverse TTCTGCAAGTGCATCATCGT
ICAM-1Forward AACCGGAAGGTGTATGAACTG390
Reverse CGAGGTGTTCTCAAACAGCTC
GAPDHForward AGAAGGAAATGGCTGCAGAA223
Reverse GCTCGGCTTCCAGTATTGAG

[i] NF-κB, nuclear factor-κB; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ICAM-1, intercellular adhesion molecule-1.

Phosphorylated (p) and total JNK and p38 MAPK western blot analyses

Endochylema and cellular nuclear proteins were extracted from frozen renal tissue with NE-PER Nuclear and Cytoplasmic Extraction reagent (cat. no. 78833, Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The total protein (20 µg) were separated by 10% SDS-PAGE, transferred onto polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA) and then assessed by Ponceau S solution staining. The membranes were blocked with 5% dehydrated skim milk in TBS/0.1% Tween 20 (TBST) for 1 h at room temperature and then incubated overnight at 4°C with primary antibodies specific to p-p38 (cat. no. SAB4301534; 1:500; Sigma-Aldrich, Merck KGaA, Darmstadt, Germany), p38 (cat. no. SAB1302631; 1:500; Sigma-Aldrich, Merck KGaA) p-JNK (cat. no. SAB4504449; 1:500; Sigma-Aldrich, Merck KGaA) and JNK (cat. no. SAB4502398; 1:500; Sigma-Aldrich, Merck KGaA). The blots were washed thrice in TBST buffer and subsequently incubated with the horseradish peroxidase-conjugated anti-rabbit secondary antibody (cat. no. A4914; 1:1000; Sigma-Aldrich, Merck KGaA) at room temperature for 1 h at room temperature. Specific proteins in the blots were visualized using an enhanced chemiluminescence reagent (Thermo Fisher Scientific, Inc.).

SOD and MDA assays

Renal tissues were harvested and immediately homogenized on ice with 5 volumes of normal saline. The homogenates were centrifuged at 1,200 × g for 10 min at 4°C. SOD and MDA levels in the supernatant were determined using SOD and MDA assay kits, according to the manufacturer's instructions.

Statistical analysis

Each experiment was performed 3 times. Results are expressed as the mean ± standard deviation. Statistical comparisons were performed using unpaired Student's t-test and one-way analysis of variance followed by Dunnett's post-hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results and Discussion

Effect of rutaecarpine on alleviating renal function injury induced by IRI

Serum Cr and BUN, which are the end products of nitrogenous organic matter and protein metabolism, serve as indicators for diagnosing and screening for glomerular filtration function (27). NGAL can reveal the occurrence of early-stage acute renal tubular injury with good sensitivity and specificity (28). As demonstrated in Table II, the levels of BUN, Cr and NGAL in the blood significantly increased and renal function was severely impaired in rats in the IRI and NS groups when compared with those in the sham group (P<0.05). When compared with the IRI and NS groups, treatment with 30 mg/kg and 60 mg/kg Ru markedly decreased serum BUN, Cr and NAGL levels (Table II).

Table II.

Plasma levels of Cr, BUN, and NGAL in experimental rats.

Table II.

Plasma levels of Cr, BUN, and NGAL in experimental rats.

FactorShamIRINSRu-30Ru-60
Cr (mmol/l)37.82±2.63 115.71±4.60a 109.84±3.72a 77.49±3.52b 66.72±2.14b
BUN (µmol/l)7.94±0.62 36.82±1.46a 35.24±0.92a 11.47±1.18b 8.80±1.35b
NGAL (ng/ml)56.38±4.57 123.72±5.20a 119.42±3.84a 99.75±5.34b 81.36±6.17b

{ label (or @symbol) needed for fn[@id='tfn2-mmr-16-01-0922'] } Data are presented as the mean ± standard deviation (n=10 rats/group).

a P<0.05 vs. sham group

b P<0.05 vs. IRI group. Cr, creatinine; BUN, blood urea nitrogen; NGAL, neutrophil gelatinase-associated lipocalin; Sham, sham operation group; IRI, ischemia reperfusion injury; NS, normal saline; Ru-30, 30 mg/kg rutaecarpine treatment prior to IRI; Ru-60, 60 mg/kg rutaecarpine treatment prior to IRI.

Rutaecarpine treatment improves the necrotic degree of proximal tubules in renal tissue

Renal tissue pathology can directly reveal the degree of renal injury induced by renal ischemia reperfusion (29). Under a light microscope, no noticeable necrosis was observed in the renal tissue of the sham group after 24 h (Fig. 2A). The cellular morphology of the renal tissue from this group was normal and no vacuoles were observed in the cytoplasm (Fig. 2A). The nuclei were round or elliptical, staining was uniform and no necrotic exfoliative cells were observed in the renal tubules (Fig. 2A). Alterations in the renal tubules were similar in all experimental groups. No significant change was observed in the glomeruli. In the majority of the renal tubular epithelial cells in the IRI and NS groups, significantly swollen vacuolar degeneration and necrosis were observed (Fig. 2B and C). Karyopyknosis, karyorrhexis, cytoplasmic shrinkage, apoptotic body formation and other features of apoptosis were also observed (Fig. 2B and C). The renal tubules were narrow and a large number of necrotic exfoliative cells were observed (Fig. 2B and C). Cellular and protein casts were observed in some of the renal tubules. Renal interstitial edema, congestion and inflammatory cell infiltration were also observed (Fig. 2B and C). While cellular and protein casts and apoptosis were detected in the renal tubules of the 30 mg/kg (Fig. 2D) and 60 mg/kg (Fig. 2E) Ru groups, edema and necrosis of renal tubular epithelial cells were significantly alleviated, and cast and leukocyte infiltration decreased.

Figure 2.

Effect of Ru on the degree of proximal tubules damage during renal IRI. Representative images of renal tissue sections stained with hematoxylin and eosin from rats in the (A) Sham (sham operation), (B) IRI, (C) NS, (D) Ru-30 (30 mg/kg Ru treatment prior to IRI) and (E) Ru-60 (60 mg/kg Ru treatment prior to IRI) groups. Scale bar, 200 µm. (F) Pathology scores. *P<0.05 vs. sham group, #P<0.05 vs. IRI group. NS, normal saline; Ru, rutaecarpine; IRI, ischemia reperfusion injury.

The pathology scores of the sham, IRI and NS groups were 0.29±0.11, 3.14±0.27 and 2.87±0.16, respectively (Fig. 2F). The scores for the latter groups were significantly higher than that of the sham group (P<0.05). The pathology scores of the Ru groups, 1.98±0.14 for the Ru-30 group and 1.19±0.24 for the Ru-60 group, were significantly lower than those of the other groups and the decrease observed was dose-dependent (P<0.05).

Rutaecarpine treatment inhibits the production of inflammatory cytokines in renal tissue

The inflammatory cytokines secreted by renal endothelial cells and parenchymal cells are important markers of the inflammatory response following IRI (30). As shown in Table III, when compared with the sham group, levels of the inflammatory cytokines NF-κB, TNF-α, IL-6 and ICAM-1 increased in the renal tissues of rats in the IRI, NS, Ru-30 and Ru-60 groups (P<0.05) compared with the sham group, indicating that inflammatory factors were released from the renal tissue during the early stage of IRI. When compared with the IRI group, the contents of inflammatory cytokines in the Ru-30 and Ru-60 groups decreased with increasing Ru treatment (Table III). The effect of Ru on mRNA expression levels of NF-κB, TNF-α, IL-6 and ICAM-1 was also examined by RT-PCR. As demonstrated in Fig. 3, Ru treatment markedly inhibited the mRNA expression of inflammatory factors. These findings combined with the results of the renal biopsy and renal function diagnosis, indicate that Ru may alleviate renal injury caused by ischemia reperfusion in rats.

Figure 3.

mRNA expression levels of NF-κB, TNF-α, IL-6 and ICAM-1 were measured in the five experimental groups by reverse transcription-polymerase chain reaction. Representative images from the gel electrophoresis are shown, with GAPDH used as an internal reference control. NF-kB, nuclear factor-κB; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ICAM-1, intercellular adhesion molecule-1; Sham, sham operation group; IRI, ischemia reperfusion injury; NS, normal saline; Ru-30, 30 mg/kg Ru treatment prior to IRI; Ru-60, 60 mg/kg Ru treatment prior to IRI.

Table III.

Comparison of NF-κB, TNF-α, IL-6 and ICAM-1 levels in rat kidney tissues.

Table III.

Comparison of NF-κB, TNF-α, IL-6 and ICAM-1 levels in rat kidney tissues.

GroupNF-κBTNF-αIL-6ICAM-1
Sham0.57±0.130.61±0.161.01±1.0610.42±1.63
IRI 1.31±0.09a 1.18±0.14a 6.08±1.42a 36.54±3.16a
NS 1.42±0.11a 0.98±0.13a 6.21±1.06a 36.87±2.71a
Ru-30 1.02±0.21b 0.78±0.17b 4.91±1.37b 30.57±3.29b
Ru-60 0.73±0.15b 0.67±0.09b 4.32±1.16b 17.38±2.62b

{ label (or @symbol) needed for fn[@id='tfn5-mmr-16-01-0922'] } Data are presented as the mean ± standard deviation (n=10 rats/group).

a P<0.05 vs. sham group

b P<0.05 vs. IRI group. NF-κB, nuclear factor-κB; TNF-α, tumor necrosis factor-α; IL-6, interleukin-6; ICAM-1, intercellular adhesion molecule-1; Sham, sham operation group; IRI, ischemia reperfusion injury; NS, normal saline; Ru-30, 30 mg/kg rutaecarpine treatment prior to IRI; Ru-60, 60 mg/kg rutaecarpine treatment prior to IRI.

Rutaecarpine treatment inhibits phosphorylation of JNK and p38 in renal tissue

The MAPK signaling pathway participates in multiple cell processes, including inflammation, proliferation, differentiation and apoptosis. Activation of the MAPK signaling pathway induces the expression of cytokines, including IL-6, IL-8 and TNF-α, which in turn enhance the inflammatory and immune responses (15–17). Therefore, the effects of Ru on the phosphorylation of JNK and p38 MAPK in renal tissue were investigated by western blotting. The experimental results are demonstrated in Fig. 4. Protein expression levels of p-JNK and p-p38 MAPK in the renal tissues from rats treated with different concentrations (30 or 60 mg/kg) of Ru were lower than those in the sham and NS groups. Among the groups tested, the decrease in p-JNK and p-p38 MAPK was obvious in the Ru-60 treated group. Total levels of p38 and JNK MAPKs were not affected by IRI or by IRI in combination with Ru. These results suggest that Ru treatment effectively suppressed IRI-induced phosphorylation of JNK and p38MAPK, which may be involved in reducing cellular damage in renal tissue following IRI.

Figure 4.

Effect of Ru treatment on IRI-induced p38 and JNK mitogen-activated protein kinase phosphorylation in renal tissues. Total tissue extracts were subjected to western blot analysis for protein expression levels of p-JNK, total JNK, p-p38 and total p38. β-actin was used as a loading control. Ru, rutaecarpine; JNK, c-Jun N-terminal kinase; p, phosphorylated; Sham, sham operation group; IRI, ischemia reperfusion injury; NS, normal saline; Ru-30, 30 mg/kg Ru treatment prior to IRI; Ru-60, 60 mg/kg Ru treatment prior to IRI.

Rutaecarpine treatment significantly decreases MDA contents and increases SOD activity in renal tissue

The oxidative stress response is an important indicator of the early stage of renal tissue injury following IRI (31). MDA, a degradation product of lipid peroxidation, can disturb protein, glucose and nucleic acid metabolism, decrease enzyme activity, induce nucleic acid template dysfunction and tissue structure damage, and exacerbate IRI (32). Thus, MDA levels reflect the content of ROS in cells. SOD is a major macromolecule antioxidant that eliminates ROS in vivo and can disproportionate oxygen into hydrogen peroxide to protect cells from ROS damage. SOD activity thus represents the ability of an organ to eliminate ROS (33). Consistent with the observed changes in renal function, the MDA contents (Fig. 5A) increased and SOD activity (Fig. 5B) decreased in renal tissue following IRI, compared with the sham group. These alterations were consistent with the deterioration of renal function, indicating that renal IRI induced renal ROS production, increased endogenous antioxidant consumption, significantly decreased the ability of cells to eliminate ROS and exacerbated renal damage. Ru treatment 10 min prior to ischemia markedly reduced MDA contents and enhanced SOD activity in renal tissues, compared with the IRI group. Thus, Ru treatment may have increased ROS scavenging by decreasing ROS generation and inhibiting lipid peroxidation to relieve renal damage.

Figure 5.

Changes in (A) MDA and (B) SOD content in renal tissues. *P<0.05 vs. sham group; #P<0.05 vs. IRI group. MDA, lipid peroxidation; SOD, superoxide dismutase activity; Sham, sham operation group; IRI, ischemia reperfusion injury; NS, normal saline; Ru, rutaecarpine; Ru-30, 30 mg/kg Ru treatment prior to IRI; Ru-60, 60 mg/kg Ru treatment prior to IRI.

The present study confirmed that rutaecarpine exerted extensive anti-IRI effects. Ru treatment was demonstrated to block activation of the JNK/p38 MAPK signaling pathway, inhibit transcription of inflammatory cytokines, resist lipid peroxidation and eliminate free radicals, all of which may help to alleviate renal ischemia reperfusion-induced apoptosis and oxidative stress injury. Therefore, rutaecarpine may be an effective compound to prevent or treat renal IRI.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant nos. 81370856 and 81272092).

References

1 

Wasser WG, Krakoff LR, Haimov M, Glabman S and Mitty HA: Restoration of renal function after bilateral renal artery occlusion. Arch Intern Med. 141:1647–1651. 1981. View Article : Google Scholar : PubMed/NCBI

2 

Devarajan P: Update on mechanisms of ischemic acute kidney injury. J Am Soc Nephrol. 17:1503–1520. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Sharfuddin AA and Molitoris BA: Pathophysiology of ischemic acute kidney injury. Nat Rev Nephrol. 7:189–200. 2011. View Article : Google Scholar : PubMed/NCBI

4 

Ali T, Khan I, Simpson W, Prescott G, Townend J, Smith W and Macleod A: Incidence and outcomes in acute kidney injury: A comprehensive population-based study. J Am Soc Nephrol. 18:1292–1298. 2007. View Article : Google Scholar : PubMed/NCBI

5 

Lenaerts K, Ceulemans LJ, Hundscheid IH, Grootjans J, Dejong CH and Damink Olde SW: New insights in intestinal ischemia-reperfusion injury: Implications for intestinal transplantation. Curr Opin Organ Transplant. 18:298–303. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Salvadori M, Rosso G and Bertoni E: Update on ischemia-reperfusion injury in kidney transplantation: Pathogenesis and treatment. World J Transplant. 5:52–67. 2015.PubMed/NCBI

7 

Menke J, Sollinger D, Schamberger B, Heemann U and Lutz J: The effect of ischemia/reperfusion on the kidney graft. Curr Opin Organ Transplant. 19:395–400. 2014. View Article : Google Scholar : PubMed/NCBI

8 

Friedewald JJ and Rabb H: Inflammatory cells in ischemic acute renal failure. Kidney Int. 66:486–491. 2004. View Article : Google Scholar : PubMed/NCBI

9 

Ysebaert DK, De Greef KE, De Beuf A, Van Rompay AR, Vercauteren S, Persy VP and De Broe ME: T cells as mediators in renal ischemia/reperfusion injury. Kidney Int. 66:491–496. 2004. View Article : Google Scholar : PubMed/NCBI

10 

Thurman JM: Triggers of inflammation after renal ischemia/reperfusion. Clin. Immunol. 123:7–13. 2007.

11 

Garcia-Criado FJ, Eleno N, Santos-Benito F, Valdunciel JJ, Reverte M, Lozano-Sánchez FS, Ludeña MD, Gomez-Alonso A and López-Novoa JM: Protective effect of exogenous nitric oxide on the renal function and inflammatory response in a model of ischemia-reperfusion. Transplantation. 66:982–990. 1998. View Article : Google Scholar : PubMed/NCBI

12 

Shingu C, Koga H, Hagiwara S, Matsumoto S, Goto K, Yokoi I and Noguchi T: Hydrogen-rich saline solution attenuates renal ischemia-reperfusion injury. J Anesth. 24:569–574. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Wang F, Yu G, Liu SY, Li JB, Wang JF, Bo LL, Qian LR, Sun XJ and Deng XM: Hydrogen-rich saline protects against renal ischemia/reperfusion injury in rats. J Surg Res. 167:e339–e344. 2011. View Article : Google Scholar : PubMed/NCBI

14 

Pearson G, Robinson F, Gibson Beers T, Xu BE, Karandikar M, Berman K and Cobb MH: Mitogen-activated protein (MAP) kinase pathways: Regulation and physiological functions. Endocr Rev. 22:153–183. 2001. View Article : Google Scholar : PubMed/NCBI

15 

Terada Y, Inoshita S, Kuwana H, Kobayashi T, Okado T, Ichijo H and Sasaki S: Important role of apoptosis signal-regulating kinase 1 in ischemic acute kidney injury. Biochem Biophys Res Commun. 364:1043–1049. 2007. View Article : Google Scholar : PubMed/NCBI

16 

El-Mas MM, El-Gowelli HM, Ghazal AR, Harraz OF and El-Din Mohy MM: Facilitation of central imidazoline I(1)-site/extracellular signal-regulated kinase/p38 mitogen-activated protein kinase signalling mediates the hypotensive effect of ethanol in rats with acute renal failure. Br J Pharmacol. 158:1629–1640. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Irving EA and Bamford M: Role of mitogen- and stress-activated kinases in ischemic injury. J Cereb Blood Flow Metab. 22:631–647. 2002. View Article : Google Scholar : PubMed/NCBI

18 

Kaminska B: MAPK signalling pathways as molecular targets for anti-inflammatory therapy-from molecular mechanisms to therapeutic benefits. Biochim Biophys Acta. 1754:253–262. 2005. View Article : Google Scholar : PubMed/NCBI

19 

Guining Wei: Evodia rutaecarpa. Shen Nong's Herbal Classic Beijing: Military Medical Science Press; pp. 902015

20 

Hou X, Yu Z, Xu Z, Wang Y and Dai F: Determination of the Contents of Evodiamine and Rutaecarpine in 34 Species of Evodia Rutaecarpa by HPLC. J Shenyang Pharm Univ. 17:334–337. 2000.

21 

Yu Q, Guo C and Cheng Z: Current advances in the study on rutaecarpine. Yaoxue Shijian Zazhi. 25:353–357. 2007.

22 

Hu CP and Li YJ: Research progress in pharmacological actions of evodiamine and rutaecarpine. Zhongguo Yaolixue Tongbao. 19:1084–1087. 2003.

23 

Lee SH, Son JK, Jeong BS, Jeong TC, Chang HW, Lee ES and Jahng Y: Progress in the studies on rutaecarpine. Molecules. 13:272–300. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Mutlu G, Abbasoğlu L, Doğru-Abbasoğlu S, Solakoğlu S and Bulut M: Morphologic changes and lipid peroxidation in renal tissues of young rats following intestinal ischemia-reperfusion. Pediatr Surg Int. 18:337–340. 2002. View Article : Google Scholar : PubMed/NCBI

25 

McWhinnie DL, Thompson JF, Taylor HM, Chapman JR, Bolton EM, Carter NP, Wood RF and Morris PJ: Morphometric analysis of cellular infiltration assessed by monoclonal antibody labeling in sequential human renal allograft biopsies. Transplantation. 42:352–358. 1986. View Article : Google Scholar : PubMed/NCBI

26 

Yang S, Chou WP and Pei L: Effects of propofol on renal ischemia/reperfusion injury in rats. Exp Ther Med. 6:1177–1183. 2013.PubMed/NCBI

27 

Trof RJ, Di Maggio F, Leemreis J and Groeneveld AB: Biomarkers of acute renal injury and renal failure. Shock. 26:245–253. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Di Grande A, Giuffrida C, Carpinteri G, Narbone G, Pirrone G, Di Mauro A, Calandra S, Noto P, Le Moli C, Alongi B and Nigro F: Neutrophil gelatinase-associated lipocalin: A novel biomarker for the early diagnosis of acute kidney injury in the emergency department. Eur Rev Med Pharmacol Sci. 13:197–200. 2009.PubMed/NCBI

29 

Makris K and Spanou L: Acute kidney injury: Definition, pathophysiology and clinical phenotypes. Clin Biochem Rev. 37:85–98. 2016.PubMed/NCBI

30 

Oguz E, Yilmaz Z, Ozbilge H, Baba F, Tabur S, Yerer MB and Hekimoglu A: Effects of melatonin on the serum levels of pro-inflammatory cytokines and tissue injury after renal ischemia reperfusion in rats. Ren Fail. 37:318–322. 2015. View Article : Google Scholar : PubMed/NCBI

31 

McCullough JW, Renner B and Thurman JM: The role of the complement system in acute kidney injury. Semin Nephrol. 33:543–556. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Gutteridge JM and Halliwell B: The measurement and mechanism of lipid peroxidation in biological systems. Trends Biochem Sci. 15:129–135. 1990. View Article : Google Scholar : PubMed/NCBI

33 

Tábara LC, Poveda J, Martin-Cleary C, Selgas R, Ortiz A and Sanchez-Niño MD: Mitochondria-targeted therapies for acute kidney injury. Expert Rev Mol Med. 16:e132014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang C, Hao Z, Zhou J, Zhang L, Sun Y and Liang C: Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response. Mol Med Rep 16: 922-928, 2017.
APA
Wang, C., Hao, Z., Zhou, J., Zhang, L., Sun, Y., & Liang, C. (2017). Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response. Molecular Medicine Reports, 16, 922-928. https://doi.org/10.3892/mmr.2017.6631
MLA
Wang, C., Hao, Z., Zhou, J., Zhang, L., Sun, Y., Liang, C."Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response". Molecular Medicine Reports 16.1 (2017): 922-928.
Chicago
Wang, C., Hao, Z., Zhou, J., Zhang, L., Sun, Y., Liang, C."Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response". Molecular Medicine Reports 16, no. 1 (2017): 922-928. https://doi.org/10.3892/mmr.2017.6631
Copy and paste a formatted citation
x
Spandidos Publications style
Wang C, Hao Z, Zhou J, Zhang L, Sun Y and Liang C: Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response. Mol Med Rep 16: 922-928, 2017.
APA
Wang, C., Hao, Z., Zhou, J., Zhang, L., Sun, Y., & Liang, C. (2017). Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response. Molecular Medicine Reports, 16, 922-928. https://doi.org/10.3892/mmr.2017.6631
MLA
Wang, C., Hao, Z., Zhou, J., Zhang, L., Sun, Y., Liang, C."Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response". Molecular Medicine Reports 16.1 (2017): 922-928.
Chicago
Wang, C., Hao, Z., Zhou, J., Zhang, L., Sun, Y., Liang, C."Rutaecarpine alleviates renal ischemia reperfusion injury in rats by suppressing the JNK/p38 MAPK signaling pathway and interfering with the oxidative stress response". Molecular Medicine Reports 16, no. 1 (2017): 922-928. https://doi.org/10.3892/mmr.2017.6631
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team