This article is mentioned in:

Introduction

Aganglionosis or Hirschsprung's disease (HD) is a congenial intestinal dynamic disorder characterized by intestinal submucosal and myenteric plexus parasympathetic ganglion cell loss, leading to persistent diseased colonic convulsions, and contractions in addition to the obstruction of intestinal contents (1–4). This disease is a colonic motor disorder with an incidence of 1:5,000 live births worldwide (5–7). In previous studies, the failure of neural crest stem cells (NCSCs) todifferentiate and migrate was demonstrated to be associated with the poor development of the enteric nervous system, and identified as the main cause of aganglionosis (8,9).

Bone morphogenetic proteins (BMPs) are among the most important proteins involved in the development of the enteric nervous system (8–12). BMP/Smad signalling serve a key role in NCSC migration at an early embryonic stage, while NCSC differentiation occurs during the middle embryonic stages (8,11). Eventually, BMP/Smad signalling determines the function of the intestinal nervous system (10–12). The current studies were designed to investigate the effects of the downregulation of BMP4 gene expression in NCSCs using a transgenic mouse model in which low expression level of the BMP4 gene was governed by RNAi-BMP genomic sequences (13–16). A series of pregnant mice at 6.5–14.5 days post coitum (dpc) with post-implantation staged mouse embryos were injected via the tail vein with the pSES-small interfering RNA (si)BMP4 plasmid to silence the BMP4 gene, and these procedures were applied to establish an animal model (14). One of the objectives of the present study was to expand current knowledge on the effect of BMP4 on NCSCs during the middle stage of embryo development. The current study also aimed to assess the neurodevelopmental abnormalities associated with the knockdown of BMP4.

Materials and methods

Animals and experimental groups

Balb/c mice (male 12, female 36; 8–12 weeks old; weight 14–18 g) were purchased from the Animal Center of Chongqing Medical University (Chongqing, China). The mice were kept in a specific pathogen-free facility room at the Chongqing Children's Hospital Animal Center (Chongqing, China), with 50±5% humidity and a temperature of 25±2°C. Food and water were provided ad libitum. Male and female mice were kept in single cages at a 1:2-1:4 ratio. A female mouse in which a vaginal plug was identified the next dawn was marked as 0.5 dpc and housed separately. The present study was approved by The Ethics Committee of Chongqing Medical University.

Tail vein injections

Pregnant mice were randomly divided into the following groups: Ringer's group (n=12), pSES group (n=12) and RNAi-BMP4 group (n=12); these were injected with 10 µl/g Ringer's solution, 50 ng/µl pSES empty vector and 50 ng/µl pSES-SiBMP4 vector, respectively. The pSES vectors bore a copy of the entire DsRed coding region, allowing fluorescent detection of the delivered plasmids. At 11.5 dpc, the solution (at a volume of 10 µl/g) was injected into the tail vein. A 31G needle was used and the injectionusually performed within 5±1 sec. Plasmids for siRNA were purchased from the Oncogene Laboratory, Biological Sciences Division, University of Chicago and contained the following 4 sites of RNAi to silence the BMP4 gene, lowercase is the gene match to the cutting site): (5′aGGTCCAGGAAGAAGAATAAtttt3′, mouse BMP4 simBMP4-site 1, sense strand; 3′aTTATTCTTCTTCCTGGACCtttt5′, mouse BMP4 simBMP4-site 1, antisense strand. 5′aGAGCCATGCTAGTTTGATAtttt3′, mouse BMP4 simBMP4-site 2, sense strand; 3′aTATCAAACTAGCATGGCTCtttt5′, mouse BMP4 simBMP4-site 2, antisense strand. 5′aGGGAAAAGCAACCCAATTAtttt3′, mouse BMP4 simBMP4-site 3, sense strand; 3′aTAATTGGGTTGCTTTTCCCtttt5′, mouse BMP4 simBMP4-site 3, antisense strand. 5′aGGGAAAAGCAACCCAATTAtttt3′, mouse BMP4 simBMP4-site 4, sense strand; 3′aTAATTGGGTTGCTTTTCCCtttt5′, mouse BMP4 simBMP4-site 4, antisense strand). At 1week [Ringer's group F1 mice (n=16), pSES group (n=18) and RNAi-BMP4 group (n=10)], 2 weeks [Ringer's group (n=15), pSES group (n=15) and RNAi-BMP4 group (n=12)]and 4 weeks [Ringer's group (n=21), pSES group (n=15) and RNAi-BMP4 group (n=7)] following birth, the F1 mice were sacrificed by cervical dislocation. Then, the target tissues were removed and rinsed in PBS at 4°C. Parts of the tissues were stored at −80°C and used for western blotting. The remaining samples were stored at 4–20°C in 4% paraformaldehyde.

Reverse transcriptase-semi-quantitative polymerase chain reaction (RT-sqPCR) detection of BMP4 and Smad4 genes

Total RNA was extracted from the colon using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. To generate cDNA, RT was performed with Prime Script RT Enzyme mix reverse transcriptase at 4°C (Invitrogen; Thermo Fisher Scientific, Inc.). Then, the cDNA samples were amplified by PCR using the following cycling conditions: 94°C for 5 min; followed by 39 cycles at 94°C for 30 sec; 58°C for 30 sec; 72°C for 30 sec; and a final step at 72°C for 5 min. Oligonucleotide primers were purchased from Invitrogen (Thermo Fisher Scientific, Inc.) as follows: BMP4 forward (F), GACTTCGAGGCGACACTTCT and reverse (R), CCTGGGATGTTCTCCAGATG; Smad4 F, CATTCCAGCCTCCCATTTCCAATC and R, CACATAGCCATCCACAGTCACAAC; β-actin F, AAGATGACCCAGATCATGTTTGAGACC and R, GCCAGGTCCAGACGCAGGAT. The amplified products were resolved in ethidium bromide-stained 2% agarose gels. Densitometry was performed using Quantity One software version 4.6.2. (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Western blotting analysis of BMP4

Protein extracts were prepared from the colon. Tissue samples were homogenized in RIPA lysis buffer and phenylmethanesulfonyl fluoride (Beyotime Institute of Biotechnology, Shanghai, China), and proteins were directly extracted according to the manufacturer's protocols. Protein concentrations were determined using a Micro Bicinchoninic Acid Protein Assay reagent (Beyotime Institute of Biotechnology). Protein samples were then diluted to obtain equal (50 µg) protein amounts and heated at 100°C in an equal volume of SDS loading buffer (Beyotime Institute of Biotechnology) for 10 min. Proteins were then separated by SDS-PAGE (5% spacer gel, 40 V, 50 min; 8% separating gel, 80 V, 70 min). Proteins were then electrophoretically transferred (Bio-Rad Laboratories, Inc.) onto polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA) for 1.5 h at 250 mA. To block non-specific binding, the membranes were incubated with 5% bovine serum albumin (Kang Yuan Biology, Tianjing, China) in Tris-buffered saline with Tween 20 (250 µl Tween20 in 500 ml PBS) at 37°C for 1.5 h. The membranes were then incubated overnight at 4°C with rabbit anti-BMP4 primary polyclonal antibody (GR49989-1; 1:400; Abcam, Cambridge, MA, USA) and β-actin (4AH240911; 1:150; 4A Biotech Co., Ltd., Beijing, China.). Next, the membranes were incubated at 4°C for 1 h with peroxidase-conjugated secondary anti-rabbit IgG (TA130015; 1:4,000; OriGene Technologies, Inc., Beijing, China), according to the manufacturer's protocol. The protein of interest was visualized using an enhanced chemiluminescence western blotting substrate (Boster Biological Technology, Pleasanton, CA, USA) and its relative expression was quantified using a Chemidoc XRS gel imaging system Quantity One software version 4.6.2. (Bio-Rad Laboratories, Inc.).

Immunohistochemistry

Colontissue was immediately fixed in 4% buffered formalin for 48 h, embedded in paraffin, and sectioned at 5 µm. Antigen retrieval was performed by boiling the sections in 0.01 M sodium citrate in 1L PBS (pH 7.4) followed by a 20 min incubation at room temperature, in 3% H2O2 for 20 min and blocked in 5% BSA (Kangyuan Biology, Tianjing, China) for 20 min at room temperature. Following incubation in 5% normal serum for 20 min at room temperature, sections were incubated with rabbit anti-BMP4 primary polyclonal antibody overnight at 4°C (GR49989-1, ab39973; 1:500; Abcam). Slides were then stained with goat anti-rabbit secondary antibody (PV-6001, 1:1,500 dilution) from OriGene Technologies, Inc. (Beijing, China) for 1 h at room temperature. Detection was accomplished using a DAB kit (Beyotime Institute of Biotechnology, Shanghai, China). Positive staining was assessed by the degree of brown colour development. The integrated optical density of positive staining was measured by NIS-Elements Viewer version 4.0 (Nikon Corporation, Tokyo, Japan) using an Eclipse 55i microscope (×40; Nikon Corporation).

Statistical analysis

The RT-PCR and western blotting greyscale values were expressed as the mean ± standard deviation. The differences among groups were analysed by a one-way analysis of variance and t-tests implemented in SPSS software version 17.0 (SPSS, Inc., Chicago, IL, USA), followed by Student-Newman-Keuls-q test. P<0.05 was considered to indicate a statistically significant difference.

Results

BMP4 and downstream gene downregulation in F1 mouse colon is induced by administration of the siBMP4 plasmid to pregnant mice

PCR revealed that BMP4 and Smad4 miRNA in the colon was significantly lower in the RNAi-BMP4 group compared with the control and pSES groups at 7 days after birth (P<0.05; Fig. 1). A decrease in BMP4-Smad4 in mice may lead to aganglionosis (9–11). Western blotting results revealed that colon BMP4 in the RNAi-BMP4 group was significantly lower compared with the control and pSES groups (Fig. 2).

Figure 1. Semi-quantitative reverse transcriptase-polymerase chain reaction of the different groups of Balb/C mouse colons. Lane 1: Ringer's group, Lane 2: pSES group, Lane 3, RNAi-BMP4 group and M, marker. At the RNA level, the RNAi-BMP4-induced mice, in contrast with the control group, significantly downregulated the levels of BMP4 and Smad4 in the colon. *P<0.05. RNAi, RNA interference; BMP, bone morphogenetic protein.

Figure 2. Western blot analysis of different groups of colon BMP4. The electropherogram derived from the western blot analysis of neurodevelopmental deficits associated protein BMP4 in the colons of three mouse groups. Lane 1: Ringer's group; Lane 2: pSES group; Lane 3: RNAi-BMP4 group. At the level of protein, RNAi-BMP4-induced mice, in contrast to the control group, significantly downregulated the levels of BMP4 in the colon. *P<0.05. BMP, bone morphogenetic protein; RNAi, RNA interference.

Formation of aganglionosis in F1 mice is induced by transplacental administration of RNAi-BMP4 to pregnant mice at 11.5 days

Barriers to stool discharge and abdominal distention were observed in BMP4 knockdown old mice (n=35; 10 mice were sacrificed at 1 week). With a barium enema, giant colons were identified in 2-week-old mice from the RNAi-BMP4 group (n=23; 12 mice were sacrificed at 1 week). Then, 4-week-old mice died from cerebral ischaemia and were autopsied (n=7, some mice succumbed naturally). Unfortunately, the mouse rectum was so small that there was no suitable pressure probe. The spastic colon, transitional colonand giant colon were exposed (Fig. 3). With immunocytochemistry, a small number of glial-like cells were positive for BMP4 in the colon of BMP4 knockdown mice. Additionally, absence or dysplasia of neurons was observed in RNAi-BMP4 colons.

Figure 3. Colorectal shape was observed in the RNAi-BMP4 group, and immunohistochemistry staining of the colorectal region was performed in normal and RNAi-BMP4 tissues. (A) The barium enema form of a 3-week-old-mouse in the control group. (B) The barium enema form of a 3-week-old mouse in the RNAi-BMP4 group; the red arrow indicates the giant colon. (C) The mouse colon of the control group. (D) The mouse colon of the RNAi-BMP4 group. The black arrow indicates the spastic colon, the white arrow indicates the transitional colon, and the yellow arrow indicates the exposed giant colon. (E) In the colon of the control group, the expression of BMP4 was assayed by immunohistochemical staining. The Figure shows the normal neurons and nerve fibres. (F) The colon of the RNAi-BMP4 group, showing agenesis and absence of nerve fibres of neurons (magnification, ×200). RNAi, RNA interference; BMP, bone morphogenetic protein.

Discussion

There area number of ways to establish aganglionosis in animal models (17–19). The principle methodis to affect the migration, differentiation and proliferation of NCSCs or artificially destroy the intestinal nervous system with drugs (20). A high folic acid (FA) diet during pregnancy leads to a gradual increase in serum FA in pregnant mice and their offspring, causing aganglionosis in the offspring (21). The level of FA in the offspring reached the highest value with 160 mg/kg FA feeding. It has also been demonstrated that a 0.1% benzalkonium chloride enema may also be used to establish aganglionos is in animal models. Ethylnitrosourea (ENU) is a type of artificial synthesised compound that leads to random and single-base mutations in a variety of organisms (22,23). The offspring may end up with a severe mega colon phenotype due to ENU-induced mutations in C57BL/6 male mice. Trisomy 16 mice, which are likely to exhibit aganglionosis, are a type of genetic mouse model with clinical manifestations similar to those identified in the human trisomy 21 syndrome (24). This genetic mouse model, which does not express the endothelin 3 gene, is also known as piebald and spotted death mice and may develop defective intestinal aganglionic syndrome or congenital megacolon (25,26). However, at present, there is a lack of a genetic mouse models that exhibits HD gene knockdown with unmistakeable implementation.

NCSCs originate from cells of the neural crest that migrate in chains as they colonize the embryonic gut, eventually forming the myenteric and submucosal plexus (27–29). Failure of the neural crest cells to colonize the gut leads to aganglionosis in the sigmoid colon, a pathological condition called Hirschsprung's disease, also known as congenital megacolon, in humans (28,29). At present, the mechanism associated withthe signalling pathways that adjust NCSCs for migration to the intestinal tract and differentiation in the enteric nervous system remains unclear. The BMP signalling pathway mayinvolve the migration process of NCSCs to the intestinal tract, in addition to the proliferation and differentiation of intestinal ganglion cells (30–32). Studies have suggested that BMP signalling serves an important role in differentiating NCSCs into enteric ganglia (8–12). Therefore, an improved understanding of the signalling pathways regulated by NCSCs and associated with the mechanisms of action is important to investigate the pathogenesis of aganglionosis. BMPs contribute to the largest subgroup of the TGF-β super family and were originally identified by their ability to induce bone development (27,28,31). Additionally, BMPs are expressed in the nervous system through out its differentiation. The mechanisms by which these BMPs regulate the induction of the neuroectoderm, the CNS primordium, and finally the neural crest, which gives rise to the NCSCs, have been reviewed (11,33). Following neural tube closure, the most dorsal aspect of the tube becomes a signalling centre for BMPs, which directs the pattern of development of the dorsal spinal cord. Additionally, certain data suggested that BMP4 was a peripherally derived factor that may regulate the survival of motor neurons (34).

The RNAi phenomenon was identified in fungi and plants (15,35). The placenta is responsible for transport between the mother and foetus and is a tissue barrier of high permeability (14,16). The present study confirmed that plasmid vector injected into the tail vein of pregnant mice was able to be transferred to foetal mice through the blood-embryo barrier. The plasmid vector transfection of tissues and organs depends on the plasmid concentration, solvent volume, injection velocity, and weight of pregnant mice. The plasmid vector achieved good results when the injection concentrationswere 50 ng/µl and 10 µl/g, and when the injection time was 5 sec. The majority of human aganglionosis cases have revealed an association with decreased BMP-Smad4 (8,30,36). F1 mice that received transplacental RNAi-BMP4 at 11.5 days revealed disordered NCSCs. That is, the downregulation of BMP4 in the middle embryo stage possibly resulted in developmental problems in the peripheral nervous system. BMP4 was also involved in the TGF-β/BMP/Smad-mediated signalling cascade as a transcriptional repressor of Smad proteins.

In summary, knockdown by transplacental RNAi is a powerful technique to study the effect of signalling pathways on responding tissues at the middle embryonic stage (14,37). However, different genes regulate embryonic development through specific mechanisms, and different gene plasmids possess different transfection efficiencies. Thus, deciding the dose and when to intervene should be considered when exploring the function of a novel gene (38). The results presented here suggested that downregulation of the BMP4 transgene was an excellent prognostic factor of neurodevelopmental inactivity in mice. This approach may be used to make an aganglionosis mouse model. As the mouse colon is relatively short, it is planned to use rabbits to research colon gene expression in different regions in future studies.

Acknowledgements

This research was supported by National Natural Science Foundation of China (grant nos. 81370474 and 81600398).

References