Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
June-2018 Volume 17 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2018 Volume 17 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of TYR mutations in patients with oculocutaneous albinism

  • Authors:
    • Wan Sun
    • Yanjie Shen
    • Shan Shan
    • Liyun Han
    • Yang Li
    • Zheng Zhou
    • Zilin Zhong
    • Jianjun Chen
  • View Affiliations / Copyright

    Affiliations: Department of Ophthalmology, Shanghai Tenth People's Hospital, Tongji Eye Institute, Tongji University School of Medicine, Shanghai 200092, P.R. China, National Laboratory of Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, P.R. China
  • Pages: 8409-8413
    |
    Published online on: April 13, 2018
       https://doi.org/10.3892/mmr.2018.8881
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Oculocutaneous albinism (OCA) is a set of autosomal recessive disorders characterized by hypopigmented hair, skin and eyes. Homozygous or compound heterozygous mutations in the tyrosinase (TYR) gene can cause OCA1, which is the most common and severe subtype of albinism. In the present study, 17 patients with non‑syndromic OCA were enrolled from eight provinces of China and were non‑consanguineous, with the exception of Patient 4000301. Total genomic DNA was isolated from peripheral blood. Screening was performed for the whole exons and their flanking regions of the TYR gene using Sanger sequencing and the pathogenicity of variants was predicted using in silico analysis. In total, 12 TYR mutations were identified in 10 patients, respectively. Of these, two patients carried homozygous mutations and eight patients carried compound heterozygous mutations. Among the 12 TYR mutations, two missense mutations c.1198T>G (p.W400G) and c.819G>T (p.Q273H) were novel. The results of the present study expand the mutation spectrum of the TYR gene, which may further assist in the prenatal examination and genetic diagnosis of OCA.

Introduction

Oculocutaneous albinism (OCA) is a set of autosomal recessive disorders characterized by a reduction or complete absence of melanin in the skin, hair and eyes. The affected individuals present with signs and symptoms including photophobia, nystagmus, poor visual acuity and iris transillumination (1,2). No effective therapy for OCA has been found previously. The worldwide prevalence of all known forms of OCA is estimated to be 1:17,000 (3). In the Chinese Han population of Shandong, the prevalence is ~1:18,000 and 3.80% of the population are carriers (4).

To date, mutations in at least 16 genes have been reported to be responsible for OCA (5). The nosology of OCA is based on classification with genetic defects in molecules, comprising 12 syndromic OCA genes and seven non-syndromic OCA genes or loci, including OCA1 (MIM 203100), OCA2 (MIM 203200), OCA3 (MIM 203290), OCA4 (MIM 606574), OCA5 (MIM 615312), OCA6 (MIM 113750) and OCA7 (MIM 615179).

Mutations in both alleles of the tyrosinase (TYR) gene can cause OCA1, which is characterized by a complete or incomplete lack of melanin. OCA1 is the most predominant subtype in the Chinese Han population (5). OCA2, associated with mutations in the OCA2 gene, is the most common type of albinism in the black African population (6). OCA3 is rare in Asiatic populations associated with tyrosinase-related protein 1 (TYRP1). OCA4, OCA6 and OCA7 are caused by mutations in SLC45A2, SLC24A5 and C10 or f11, respectively. OCA5 is a novel genetic cause mapped to chromosome 4q24 (7).

As TYR mutations are responsible for 70.1% of cases of OCA in the Chinese population (5), the present study performed direct sequencing of TYR in 17 patients with OCA, which revealed 12 mutations in 10 patients, respectively, including two novel mutations c.1198T>G (p.W400G) and c.819G>T (p.Q273H).

Patients and methods

Patients and clinical data

A total of 17 patients with OCA were enrolled in the present study, including 6 women and 11 men, who were from 8 provinces of China (Beijing, Jiangsu, Hebei, Liaoning, Jilin, Guangdong, Sichuan and Hunan). An additional 200 unrelated healthy volunteers served as a control group. Routine screenings and complete ophthalmological examinations were performed on all participants following the provision of signed informed consent. The typical clinical features of OCA, including hypopigmented hair, skin and eyes, nystagmus, photophobia, poor vision and foveal hypoplasia, were observed in all patients. None of the patients had any other systemic diseases. The Institutional Review Board of the Tongji Eye Institute of Tongji University School of Medicine (Shanghai, China) approved the study, and all procedures were performed in accordance with the tenets of the Declaration of Helsinki.

Genetic analysis

Genomic DNA was extracted from peripheral leukocytes using the Tiangen RelaxGene Blood DNA system (Tiangen Biotech, Co., Ltd., Beijing, China) according to the manufacturer's protocol. The primers (Table I) were designed for all five exons and splice junction sites of the TYR gene using Primer3 software (version 0.4.0; http://bioinfo.ut.ee/primer3-0.4.0/). All exons and flank regions of TYR were amplified using polymerase chain reaction (PCR). A total of 25 µl PCR mixture contain 40 ng genomic DNA, 1 mM each forward and reverse primers and 12.5 µl 2X Taq PCR MasterMix (Tiangen Biotech Co., Ltd.). PCR was performed on C1000 Touch Thermal Cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) using Touchdown PCR program with 35 cycles of amplification: 95°C for 30 sec; 64–57°C for 30 sec beginning at 64°C and decreasing by 0.5°C each cycle for 14 cycles, until finishing at a final annealing temperature of 57°C for 21 cycles and at 72°C for 40 sec.

Table I.

Primers for amplification and sequence analysis of human TYR.

Table I.

Primers for amplification and sequence analysis of human TYR.

PrimerPrimer sequence (5′-3′)
TYR-EXON1A-F CCAGTTCCTGCAGACCTTGT
TYR-EXON1A-R TCATTTGGCCATAGGTCCCT
TYR-EXON1B-F GGGACCAAACTGCACAGAGA
TYR-EXON1B-R GGCTGCAATGAGTGTTCAGG
TYR-EXON2-F TGATGGATTTCTCAGAACATATCCCT
TYR-EXON2-R ACAACACATATTCTTGGTCAACTCA
TYR-EXON3-F TGGGATAATCACATAGGTTTTCAGT
TYR-EXON3-R GGTGACAACCTGATCACAGACA
TYR-EX0N4-F CCATGTCTCCAGATTTTAATATATGCC
TYR-EX0N4-R CACTTTCAGGATTTAAAGTGTTCAGGA
TYR-EXON5-F GCCTTCAAACCCAGGTGTCT
TYR-EXON5-R GGAACCTGGACATTACTTTGAGT

[i] TYR, tyrosinase; F, forward; R, reverse.

The PCR products were sequenced using an ABI3730 automated sequencer (PE Biosystems, Foster City, CA, USA). Benign polymorphisms were excluded using the database of the 1000 Genomes Project (http://www.1000genomes.org/) and the dbSNP National Center for Biotechnology Information database (http://www.ncbi.nlm.nih.gov/projects/SNP/). The albinism database (http://www.ifpcs.org/albinism/) and reported literature were then used to determine whether the mutations had been previously reported as pathogenic. To predict the pathogenicity of TYR variants in the present study, in silico analysis was performed with Sorting Intolerant From Tolerant (SIFT; http://sift.jcvi.org/), Polymorphism Phenotyping (PolyPhen)-2 (http://genetics.bwh.harvard.edu/pph2/), I-Mutant (http://folding.biofold.org/i-mutant/i-mutant2.0.html) and Human Splicing Finder (HSF) 3.0 (http://www.umd.be/HSF3/HSF.shtml), respectively. The conservation of the amino acid substitutions were assessed by multiple sequence alignment with sequences from Homo sapiens (NP_000363.1), Canis lupus familiaris (NP_001002941.1), Bos taurus (NP_851344.1), Mus musculus (NP_035791.1), Rattus norvegicus (NP_001101005.1), Gallus gallus (NP_989491.1), Danio rerio (NP_571088.1), Xeno pustropicalis (NP_001096518.1) and Bacillus megaterium (UniProtKB:B2ZB02). The crystal structure of protein data bank (PDB): 5I3B (TYR from Bacillus megaterium with configuration B of hydroquinone inhibitor in the active site) was used to predict and improve understanding of the potential impact of the novel mutation (8).

Results

In the present study, 17 patients were diagnosed with non-syndromic OCA based on the routine screenings and complete ophthalmological examination. The parents of all patients were unaffected, which is consistent with the pattern of autosome recessive inheritance. Using PCR combined with Sanger sequencing, a total of 12 mutations were found in TYR, including 10 previously reported mutations associated with OCA1 and two novel mutations (Fig. 1 and Table II). Patient 4000101 was a compound heterozygote for mutations c.1A>G (p.M1?) and c.896G>A (p.R299H) in the TYR gene. Patient 4000201 was a compound heterozygote for mutations c.1198T>G (p.W400G) and c.896G>A (p.R299H). Patient 4000301, from a consanguineous family, was a homozygote for mutation c.929_930insC (p.R311Kfs*7). Patient 4000701 was compound heterozygous for c.929_930insC (p.R311Kfs*7) and c.896G>A (p.R299H). Patient 4000801 was a homozygote for c.819G>T (p.Q273H). Patient 4000901 was a compound heterozygote for mutations c.758G>A (p.G253E) and c.896G>A (p.R299H). Patient 4001101 was a compound heterozygote for mutations c.231_232insGGG (p.R77_E78insG) and c.230G>A (p.R77Q), and c.230G>A was confirmed in the unaffected family member of patient 4001101 (Fig. 1). Patient 4001301 carried mutations c.346C>T (p.R116*) and c.832C>T (p.R278*), patient 4001501 carried mutations c.896G>A (p.R299H) and c.70T>C (p.C24R), and patient 4001701 carried the mutation c.231-232insGGG (p.R77_E78insG) and the splicing mutation c.1037-7T>A.

Figure 1.

Sequence electropherograms of TYR mutations and wild-type TYR identified in patients with OCA. Arrows indicate mutations in the index patients, respectively. The asterisk indicates novel mutations associated with OCA for the first time. Individual 4001102 (Patient 4001101's brother) was unaffected, whose sequence electropherogram results were used to confirm the c.230G>A (p.R77Q) mutation identified in Patient 4001101. OCA, oculocutaneous albinism; TYR, tyrosinase.

Table II.

Summary of TYR mutations in the present study.

Table II.

Summary of TYR mutations in the present study.

Mutation 1Mutation 2


PatientGenderClinical diagnosisGeneNucleotide changeAmino acid changeNucleotide changeAmino acid changeProvince
4000101FOCATYRc.1A>Gp.M1?c.896G>Ap.R299HJilin
4000201MOCATYRc.1198T>Gp.W400Gc.896G>Ap.R299HJiangsu
4000301MOCATYRc.929_930insCp.R311Kfs*7c.929_930insCp.R311Kfs*7Jiangsu
4000701MOCATYRc.929_930insCp.R311Kfs*7c.896G>Ap.R299HGuangdong
4000801MOCATYRc.819G>Tp.Q273Hc.819G>Tp.Q273HGuangdong
4000901FOCATYRc.758G>Ap.G253Ec.896G>Ap.R299HSichuan
4001101FOCATYR c.231_232insGGGp.R77_E78insGc.230G>Ap.R77QSichuan
4001301MOCATYRc.346C>Tp.R116*c.832C>Tp.R278*Hunan
4001501MOCATYRc.70T>Cp.C24Rc.896G>Ap.R299HBeijing
4001701MOCATYR c.231_232insGGGp.R77_E78insGc.1037-7T>A–Jiangsu

[i] OCA, oculocutaneous albinism; TYR, tyrosinase; M, male; F, female.

Among the mutations identified, two mutations c.819G>T (p.Q273H) and c.1198T>G (p.W400G) were novel, and their pathogenicity were predicted via in silico analysis. The SIFT and PolyPhen-2 scores for the c.819G>T (p.Q273H) mutation were 0.030 and 0.981, respectively, which predicted that the mutation was ‘probably damaging’. The I-Mutant online server predicted that the mutation may decrease protein stability with a reliability index (RI) of 6. The c.1198T>G mutation in the TYR gene was not detected in the 200 normal controls enrolled in the present study, nor was it present within the dbSNP database, the 1000 Genomes Project or the albinism database (http://www.ifpcs.org/albinism/). This mutation, resulting in the conversion from tryptophan to glycine at codon 400, was predicted to be ‘probably damaging’ with a score of 0.99 by PolyPhen2 and a score of 0 by SIFT, and it was predicted that the protein stability may decrease with an RI of 9 by the I-Mutant online server. Multiple sequence alignment showed that residues W241, I237 and H245 in the TYR protein of Bacillus megaterium are highly conserved across species, and correspond to W400, I393 and H404 in the human TYR protein, respectively (Fig. 2A). The crystal structure of wild-type TYR (PDB ID: 5I3B) showed that W241 interacts with I237 and H245, and this interaction may be impaired when W241 is substituted by amino acid G (Fig. 2B).

Figure 2.

Effect of the identified mutation found in W400 of TYR. (A) Alignment of multiple TYR amino acid sequences across species. The amino acid of W400 (shaded gray) was completely conserved from bacteria to humans. The amino acid residue W241 interacts with I237 and H245 in TYR of Bacillus megaterium. The asterisk indicates the three residues. (B) Analysis of the crystal structure of TYR (from PDB ID: 5I3B) and the predicted structure of W241G from Bacillus megaterium. (Left, wild-type; right, predicted structure of bacterial W241G mutant to determine the effect of human W400G. Comparison of the structures between the wild-type and the mutant showed W241 interacted with I237 and H245 in the wild-type, whereas this substitution in W241G disrupted this interaction, possibly impairing TYR structure. TYR, tyrosinase.

Discussion

TYR is a glycoprotein containing four regions, a signal sequence (SP; amino acid residues 1–18), an intramelanosomal domain (IMD; residues 19–476) with a binuclear copper binding site, a single α-helical trans-membrane domain (STMD; residues 477–497), and a flexible C-terminal domain (CTD; residues 498–529), as shown in Fig. 3A (9). There are three key enzymes, TYR, TYRP1 and dopachrome tautomerase, which are important in melanin biosynthesis (10). Among these, a defect in TYR can lead to the complete or partial lack of melanin as TYR catalyzes the critical first and second reactions in the conversion of TYR to melanin (11). The human TYR gene located on chromosome 11q14.3 is composed of five exons encoding a copper binding protein with a molecular weight of ~75 kDa. In the present study, mutation analysis of the TYR gene was performed in 17 patients with OCA, which identified 12 mutations as the cause of OCA in 10 of the patients with OCA. Of these mutations, 10 mutations were clustered in exon 1 and exon 2, which are the mutation hotspots of TYR in the Chinese Han population (5). For the additional two mutations, one mutation c.1198T>G (p.W400 G) was located in exon 4 and another mutation IVS2-7T>A was located in intron 2 (Fig. 3B). In Chinese patients with OCA1, missense mutations of TYR have been found to account for almost 62.5% of all reported TYR mutations, whereas the insertion and deletion mutations account for 25% (12).

Figure 3.

Diagrams of the linear location of identified TYR mutations. (A) Locations of the identified mutations of the genomic DNA in TYR. The asterisk indicates novel mutations associated with oculocutaneous albinism for the first time. (B) Schematic diagram showing the location of the identified mutations in TYR protein. SP, signal peptide; IMD, intramelanosomal domain; STMD, single trans-membrane domain; CTD, C-terminal domain; TYR, tyrosinase.

Of the 12 mutations identified in the present study, 10 mutations were reported as causative for OCA in previous literature. Among these 10 mutations, R299H was the most frequent mutation in the present study (5/12). R299H is the most frequent mutation in Chinese, Caucasian, Korean, and Christian Arab populations, and this mutation may affect the function of TYR by disrupting copper binding and different substitutions occurring in R299 (5,13–15). c.231-232insGGG is another frequent mutation in the Chinese OCA1 population, resulting in an insertion of glycine residue between R77 and E78 (13). Mutation c.230G>A, resulting in an amino acid change from arginine to glutamine at position 77, has been reported in the Japanese, Korean, Chinese, German and Pakistani populations (16). The mutation c.929_930insC, resulting in a truncated polypeptide, is the most frequent mutation allele in far East Asian OCA1 populations (13,17). The missense mutation c.1A>G (p.M1?) has been found in British and Chinese patients with OCA1, and this may alter codons initiating translation to M31, resulting in a skipping of the putative SP (18,19). The splicing mutation IVS2-7T>A is frequently found in patients with OCA1 worldwide and can result in pathological splicing sites (19–22).

It is the first time, to the best of our knowledge, that the additional two mutations c.819G>T (p.Q273H) and c.1198T>G (p.W400G) identified in the present study have been associated with OCA. In the in silico analysis, c.819G>T (p.Q273H) was predicted to be pathogenic, although it has been reported as rs748669377 with a frequency of 1:120,054 in the Exome Aggregation Consortium (http://exac.broadinstitute.org/). In addition, HSF 3.0 predicted that this mutation may result in disruption of the wild-type donor site, most likely affecting splicing. However, its exact mechanism requires further investigation for confirmation. The other novel mutation c.1198T>G (p.W400G) occurred at the same amino acid position as another pathogenic mutation c.1199G>T (p.W400L). The amino acid residue W400 locating in the IMD of the human TYR protein, was found to be highly conserved from bacteria to humans (Fig. 2A). Residues W241, I237 and H245 in the TYR protein of Bacillus megaterium corresponded with W400, I393 and H404 in the human TYR protein, respectively (Fig. 2A). Structural analysis of wild-type TYR from Bacillus megaterium (PDB: 5I3B) showed that W241 interacts with I237 and H245, and the predicted structure of the mutated protein shows that this substitution disrupted hydrogen bonds in these two amino acids, impairing the spatial conformation of TYR (Fig. 2B).

In conclusion, mutation analysis of the TYR gene in 17 patients with non-syndromic OCA revealed that 12 mutations of TYR may have caused OCA in 10 patients. Among these mutations, two novel mutations c.1198T>G (p.W400G) and c.819G>T (p.Q273H) were identified, expanding on the mutation spectrum of TYR in OCA. This may assist in the prenatal examination and genetic diagnosis of OCA, and offers novel insight into the molecular mechanism of OCA1.

Acknowledgements

This study was supported by the National Key Basic Research Program of China (973 Program; grant no. 2015CB964601), the National Natural Science Foundation of China (grant no. 81371062). Professor Jianjun Chen was supported by the Thousand Youth Talents Program of China.

References

1 

Kamaraj B and Purohit R: Mutational analysis of oculocutaneous albinism: A compact review. Biomed Res Int. 2014:9054722014. View Article : Google Scholar : PubMed/NCBI

2 

Summers CG: Albinism: Classification, clinical characteristics, and recent findings. Optom Vis Sci. 86:659–662. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Gronskov K, Brøndum-Nielsen K, Lorenz B and Preising MN: Clinical utility gene card for: Oculocutaneous albinism. Eur J Hum Genet. 22:2014. View Article : Google Scholar : PubMed/NCBI

4 

Gong Y, Shao C, Zheng H, Chen B and Guo Y: Study on genetic epidemiology of albinism. Yi Chuan Xue Bao. 21:169–172. 1994.(In Chinese). PubMed/NCBI

5 

Wei A, Wang Y, Long Y, Wang Y, Guo X, Zhou Z, Zhu W, Liu J, Bian X, Lian S and Li W: A comprehensive analysis reveals mutational spectra and common alleles in Chinese patients with oculocutaneous albinism. J Invest Dermatol. 130:716–724. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Grønskov K, Ek J and Brondum-Nielsen K: Oculocutaneous albinism. Orphanet J Rare Dis. 2:432007. View Article : Google Scholar : PubMed/NCBI

7 

Kausar T, Bhatti MA, Ali M, Shaikh RS and Ahmed ZM: OCA5, a novel locus for non-syndromic oculocutaneous albinism, maps to chromosome 4q24. Clin Genet. 84:91–93. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Deri B, Kanteev M, Goldfeder M, Lecina D, Guallar V, Adir N and Fishman A: The unravelling of the complex pattern of tyrosinase inhibition. Sci Rep. 6:349932016. View Article : Google Scholar : PubMed/NCBI

9 

Lai X, Soler-Lopez M, Wichers HJ and Dijkstra BW: Large-scale recombinant expression and purification of human tyrosinase suitable for structural studies. PLoS One. 11:e01616972016. View Article : Google Scholar : PubMed/NCBI

10 

Yamaguchi Y and Hearing VJ: Melanocytes and their diseases. Cold Spring Harb Perspect Med. 4:pii: a017046. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Sánchez-Ferrer A, Rodríguez-López JN, García-Cánovas F and García-Carmona F: Tyrosinase: A comprehensive review of its mechanism. Biochim Biophys Acta. 1247:1–11. 1995. View Article : Google Scholar : PubMed/NCBI

12 

Liu J, Choy KW, Chan LW, Leung TY, Tam PO, Chiang SW, Lam DS, Pang CP and Lai TY: Tyrosinase gene (TYR) mutations in Chinese patients with oculocutaneous albinism type 1. Clin Exp Ophthalmol. 38:37–42. 2010. View Article : Google Scholar : PubMed/NCBI

13 

Tsai CH, Tsai FJ, Wu JY, Lin SP, Chang JG, Yang CF and Lee CC: Insertion/deletion mutations of type I oculocutaneous albinism in chinese patients from Taiwan. Hum Mutat. 14:5421999. View Article : Google Scholar : PubMed/NCBI

14 

Tripathi RK, Strunk KM, Giebel LB, Weleber RG and Spritz RA: Tyrosinase gene mutations in type I (tyrosinase-deficient) oculocutaneous albinism define two clusters of missense substitutions. Am J Med Genet. 43:865–871. 1992. View Article : Google Scholar : PubMed/NCBI

15 

Park SK, Lee KH, Park KC, Lee JS, Spritz RA and Lee ST: Prevalent and novel mutations of the tyrosinase gene in Korean patients with tyrosinase-deficient oculocutaneous albinism. Mol Cells. 7:187–191. 1997.PubMed/NCBI

16 

Shah SA, Raheem N, Daud S, Mubeen J, Shaikh AA, Baloch AH, Nadeem A, Tayyab M, Babar ME and Ahmad J: Mutational spectrum of the TYR and SLC45A2 genes in Pakistani families with oculocutaneous albinism, and potential founder effect of missense substitution (p. Arg77Gln) of tyrosinase. Clin Exp Dermatol. 40:774–780. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Park SH, Chae H, Kim Y and Kim M: Molecular analysis of Korean patients with oculocutaneous albinism. Jpn J Ophthalmol. 56:98–103. 2012. View Article : Google Scholar : PubMed/NCBI

18 

Liu N, Kong XD, Shi HR, Wu QH and Jiang M: Tyrosinase gene mutations in the Chinese Han population with OCA1. Genet Res (Camb). 96:e142014. View Article : Google Scholar : PubMed/NCBI

19 

Breimer LH, Winder AF, Jay B and Jay M: Initiation codon mutation of the tyrosinase gene as a cause of human albinism. Clin Chim Acta. 227:17–22. 1994. View Article : Google Scholar : PubMed/NCBI

20 

Ko JM, Yang JA, Jeong SY and Kim HJ: Mutation spectrum of the TYR and SLC45A2 genes in patients with oculocutaneous albinism. Mol Med Rep. 5:943–948. 2012. View Article : Google Scholar : PubMed/NCBI

21 

King RA, Pietsch J, Fryer JP, Savage S, Brott MJ, Russell-Eggitt I, Summers CG and Oetting WS: Tyrosinase gene mutations in oculocutaneous albinism 1 (OCA1): Definition of the phenotype. Hum Genet. 113:502–513. 2003. View Article : Google Scholar : PubMed/NCBI

22 

Goto M, Sato-Matsumura KC, Sawamura D, Yokota K, Nakamura H and Shimizu H: Tyrosinase gene analysis in Japanese patients with oculocutaneous albinism. J Dermatol Sci. 35:215–220. 2004. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Sun W, Shen Y, Shan S, Han L, Li Y, Zhou Z, Zhong Z and Chen J: Identification of TYR mutations in patients with oculocutaneous albinism. Mol Med Rep 17: 8409-8413, 2018.
APA
Sun, W., Shen, Y., Shan, S., Han, L., Li, Y., Zhou, Z. ... Chen, J. (2018). Identification of TYR mutations in patients with oculocutaneous albinism. Molecular Medicine Reports, 17, 8409-8413. https://doi.org/10.3892/mmr.2018.8881
MLA
Sun, W., Shen, Y., Shan, S., Han, L., Li, Y., Zhou, Z., Zhong, Z., Chen, J."Identification of TYR mutations in patients with oculocutaneous albinism". Molecular Medicine Reports 17.6 (2018): 8409-8413.
Chicago
Sun, W., Shen, Y., Shan, S., Han, L., Li, Y., Zhou, Z., Zhong, Z., Chen, J."Identification of TYR mutations in patients with oculocutaneous albinism". Molecular Medicine Reports 17, no. 6 (2018): 8409-8413. https://doi.org/10.3892/mmr.2018.8881
Copy and paste a formatted citation
x
Spandidos Publications style
Sun W, Shen Y, Shan S, Han L, Li Y, Zhou Z, Zhong Z and Chen J: Identification of TYR mutations in patients with oculocutaneous albinism. Mol Med Rep 17: 8409-8413, 2018.
APA
Sun, W., Shen, Y., Shan, S., Han, L., Li, Y., Zhou, Z. ... Chen, J. (2018). Identification of TYR mutations in patients with oculocutaneous albinism. Molecular Medicine Reports, 17, 8409-8413. https://doi.org/10.3892/mmr.2018.8881
MLA
Sun, W., Shen, Y., Shan, S., Han, L., Li, Y., Zhou, Z., Zhong, Z., Chen, J."Identification of TYR mutations in patients with oculocutaneous albinism". Molecular Medicine Reports 17.6 (2018): 8409-8413.
Chicago
Sun, W., Shen, Y., Shan, S., Han, L., Li, Y., Zhou, Z., Zhong, Z., Chen, J."Identification of TYR mutations in patients with oculocutaneous albinism". Molecular Medicine Reports 17, no. 6 (2018): 8409-8413. https://doi.org/10.3892/mmr.2018.8881
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team