This article is mentioned in:

Introduction

DNA methylation at cytosines in CpG islands located in promoters is well known as one of the earliest molecular alteration occurring during carcinogenesis and specific for the malignant state (1). Over the past few years, there have been increasing evidences asserting the role of DNA methylation at promoter of genes encoding small non coding microRNAs (MIRs) that act as posttranscriptional regulators of gene expression (2,3). Aberrant expression of microRNAs regulated by DNA methylation is involved in many cellular processes such as DNA repair, cell cycle, apoptosis, through which they promote cell differentiation, proliferation, malignant transformation and tumorigenesis (4,5). For example, the down-regulation of MIR129-2 by DNA methylation regulates breast cancer cell proliferation and apoptosis (6). Moreover, MIR449c expression, which was significantly down-regulated by DNA methylation in osteosarcoma cancer, was negatively correlated with tumor size and tumor stages (7). In addition, integrating DNA methylation data with microRNA expression profile in various types of cancers including lung, colon and breast has been extensively explored by genome wide analysis recently (8,9).

Among the huge number of microRNA genes, the MIR34 gene family, which consists of three genes MIR34a, MIR34b and MIR34c, has been the focus of numerous studies in cancer research. All the three MIR34 genes are transcriptionally regulated by p53 protein, a regulator of cell cycle and apoptosis; therefore, they act as tumor suppressor genes by targeting many oncogenes related to proliferation, apoptosis and invasion (10,11). Numerous studies have demonstrated the direct link between dysregulations concerning MIR34 family and epigenetic and genetic mechanisms in cancers. For instance, MIR34a targets the proto-oncogene c-SRC to attenuate tumor growth in triple-negative breast cancer (12), or programmed death ligand 1 (PDL1) to modulate the tumor immune response in non small cell lung cancer (13). Stahlhut and Slack revealed that combinatorial action of MIR34a and microRNA let-7 effectively synergizes with erlotinib to suppress non-small cell lung cancer cell proliferation (14). MIR34b and MIR34c, which share a common primary transcript, function as metastasis suppressors in lung adenocarcinoma (15,16). A recent study on circulating MIR34s in 173 patients with triple-negative breast cancer indicated that MIR34a, MIR34b and MIR34c expression was respectively correlated with tumor grade (P=0.038), lymph node positivity (P=0.027) and distant metastasis (P<0.001) (17). Importantly, the aberrant low expression of MIR34s was associated with promoter methylation. Indeed, data integration from 104 studies on microRNAs revealed that MIR34s are silenced by DNA methylation in the highest number of cancer types (18). Epigenetic inactivation of the MIR34a was found in ovarian, colorectal, lung, kidney and breast cancer cell lines (19,20). The presence of MIR34b/c promoter methylation was significantly associated with the absence of its transcripts and with metastasis formation in primary tumors of colon, lung, head and neck, melanomas and breast cancers (21). Siemens et al (22) showed that MIR34a methylation is involved in the up-regulation of c-Met, Snail, and β-catenin proteins, which was associated with the metastasis distance of colon cancer cells to the liver. Patients after surgery of lung cancer with aberrant methylation of MIR34b/c had a high probability of recurrence and poor prognosis (P=0.026) (23). Furthermore, molecular events from negative surgical margin have been extremely investigated because of their predictive and prognostic values for tumor progression, local recurrence, metastasis and overall survival (24). Multi-platform analyses of DNA defects, epigenetics, and gene expression in cancer-adjacent tissues have extensively been performed recently to provide integrative data to the clinic (25,26). DNA methylation that has occurred at the primary tumor is believed to progressively spread outwards to surrounding tissues (27,28). Increased DNA methylation level in ductal carcinoma in situ is related with future development of invasive breast cancer and with the cancer metastasis distance (29,30). Currently, MIR34 methylation profile in normal adjacent and tumor tissues, and its correlation with clinicopathological features have been frequently reported to gastrointestinal cancer. For instance, MIR34 methylation occurs in colorectal normal adjacent (43.9%) and tumor tissues (79.3%) and correlated with positive lymph node (P=0.01) (31). Similarly, MIR34b/c methylation was considerably different between adjacent (22.7%) and tumors (70%) in gastric cancer (32). However, differences in MIR34 methylation profile in either non-cancerous or normal adjacent tissues as compared with breast and lung cancer tissues have been rarely described so far while both types of these cancers are the first and second common types of cancer and leading cause of cancer death all over the world (33). Therefore, investigating the methylation profile of the MIR34 genes in both types of cancer vs. normal adjacent tissues and non-cancerous tissues and moreover their association with the clinicopathological features would provide a comprehensive evaluation on the synergy of these potential methylation biomarkers for cancer diagnosis.

In this study, we investigated the methylation status at the promoter of the genes encoding MIR34a/b/c in breast cancer vs. normal adjacent tissues, as well as in non-cancerous lung diseases vs. lung cancer, with samples coming from Vietnamese patients. The objective is to evaluate the methylation profiles of these genes both individually and in an integrative manner in order to establish new integrative methylation biomarkers for cancer detection. Furthermore, the comparison of the methylation profiles of these genes in cancer vs. non-cancerous or normal adjacent tissues has highlighted the epigenetically concomitant changes of these genes in tissues that are physiologically different such as breast and lung.

Materials and methods

Sample collection

Surgically resected specimens from breast carcinomas and matched adjacent tissues were collected from 79 breast cancer patients having undergone mastectomy at the Department of Pathology, National Cancer Hospital K (Hanoi, Vietnam) between 2012 and 2013. The corresponding adjacent tissue samples were selected 3–5 cm away from the site at which the primary tumor was obtained. Breast tumor and corresponding adjacent tissues were snap-frozen in liquid nitrogen immediately after resection and examination by pathologists, and stored at −80°C until further used. Formalin-fixed, paraffin-embedded (FFPE) tissue specimens were collected from 95 lung cancer patients and 72 patients suffering from non-cancerous lung diseases (whose classification was examined by pathologists) at the Department of Pathology, 175 Hospital (Ho Chi Minh, Vietnam) during 2016. Informed consent was obtained from patients in written form and the study was approved by the guidelines of the VNU University of Science ethical committee in Vietnam (106-YS.06-2015.07).

Genomic DNAs extraction and bisulfite modification

Genomic DNAs were extracted from freshly frozen breast or FFPE lung tissues by using the QIAampDNA Mini kit or QIAamp DNA FFPE Tissue kit (Qiagen, Inc., Valencia, CA, USA), and treated with sodium bisulfite by using the EpiTect Bisulfite kit (Qiagen, Inc.). During the treatment, the unmethylated cytosines of the genomic DNAs were converted into uracils, but the methylated cytosines remained unchanged (34). Polymerase chain reaction (PCR) realized on native DNA using primer sets specific to methylated sequences was performed to confirm the accuracy of the primer sets. PCR realized on the bisulfite-treated DNA using primer sets specific to unmethylated sequences of the β-globin gene was performed to determine the efficiency of bisulfite conversion (35).

Methylation specific PCR (MSP)

The methylation status of the investigated genes was evaluated by using MSP to amplify bisulfite treated DNA with primers that distinguish methylated (M) and unmethylated (U) DNA (36). MIR34a gene locates on chromosome 1 and is transcribed from the minus strand. The MIR34a gene structure is described by Tarasov et al (37) and the CpG island in its promoter is indicated by Lodygin et al (19). MIR34b/c gene locates on chromosome 16 and is transcribed from the plus strand. The CpG island of MIR34b/c promoter locates in the upstream sequence of the BTG4 gene as described by Toyota et al (38). Based on these reports, we look for the sequences corresponding to MIR34a, MIR34b/c promoters and designed the MSP primer sets used in our study. The primers for detecting the methylation status of MIR34s were designed based on the primer designing tool for MSP method (http://www.urogene.org/methprimer/index1.html). The primer sequences, MSP conditions and amplicon lengths are shown in Table I. Bisulfite treated DNAs were subjected to single or nested PCR depending on the particular targeted genes. The MSP products were resolved by electrophoresis in 8% polyacrylamide gel, then stained with ethidium bromide and imaged with the UVP, LLC (Upland, CA, USA). DNA extracted from lymphocytes of healthy volunteers and treated with bisulfite was used as a positive control for unmethylation of the targeted genes in numerous reports in which the MSP method was also applied (23,36). Water with no DNA template was included in each PCR reaction as a control for contamination. All MSP reactions were performed in duplicate. The methylation status was confirmed by direct sequencing of the MSP products for a subset of samples from each assay.

Table I. MSP primers for analysis of MIR34a, MIR34b/c methylation.

Table I.

MSP primers for analysis of MIR34a, MIR34b/c methylation.

Primers	Sequence (5′-3′)	Amplicon size (bp)	MSP conditions
MIR34a EF570049.1
miR-34a-meF	TTTTGGGTAGGCGCGTTTCGC	Round 1: 147	94°C 5 min, 40 cycles of (94°C 30 sec, 60°C 10 sec, 72°C 15 sec), 72°C 5 min
miR-34a-meR	CCAATCCCGCCGAACACGAAA
miR-34a-meF	TTTTGGGTAGGCGCGTTTCGC	Round 2: 100	94°C 5 min, 40 cycles of (94°C 30 sec, 63°C 10 sec, 72°C 15 sec), 72°C 5 min
miR-34a-meR1	GCCCCCGCCTAAACTAACG
miR −34a-unF	GGTGGTGTTTTGTGATTTAGT GGTGGT	143	94°C 5 min, 40 cycles of (94°C 30 sec, 63°C 10 sec, 72°C 15 sec), 72°C 5 min
miR-34-unR	CAAAACCAATCCCACCAAACA CAAAATC
MIR34b/c BC021736
miR-34b/c-meF	TCGTTTCGTTTCGCGTTCGTT	93	94°C 1 min, 40 cycles of (94°C 30 sec, 66°C 30 sec, 72°C 30 sec), 72°C 5 min
miR-34b/c-meR	GCCGCTCTAAACGACCGAAT
miR-34b/c-unF	TTGTGGGGTTTTAAGGATGGTT	160	94°C 1 min, 40 cycles of (94°C 30 sec, 66°C
	GGTTGTTT		30 sec, 72°C 30 sec), 72°C 5 min
miR-34b/c-unR	CCCTTCACCTCCTCAACCCAAAC

[i] miR, microRNA; MSP, methylation specific polymerase chain reaction; F, forward; R, reverse; un, unmethylated sequences; me, methylated sequences.

Statistical analysis

Chi-square test was used to determine the difference in MIR34s methylation levels between cancer and non-cancerous/normal adjacent tissues. The Kappa statistic was used to assess the agreement between two dichotomous variables such as the concordance between the methylation status of genes analyzed two by two in a given tissue type or the concordance between the methylation status of individual gene in tumor and adjacent normal tissues. Chi-square test and Fisher's exact test was used to examine the association of the methylation status of individual or combined genes with clinicoathological characteristics. For all statistical analyses, a P<0.05 was considered to indicate a statistically significant difference. All analyses were done by using the STATA program version 12 (StataCorp LP, College Station, TX, USA; http://www.stata.com/).

Results

In order to assess the methylation status of MIR34 genes, we first set up an MSP assay and verified its specificity, since we have previously shown that false positive results from the MSP assay could be due to the MSP primers amplifying nonspecifically untreated genomic DNAs (35). Native DNAs were subjected to MSP analysis with the primer sets specific to the methylated status of the targeted sequences MIR34a and MIR34b/c. No MSP products were amplified from untreated DNAs extracted from lymphocytes of healthy donors (Fig. 1), confirming that the MSP primers were specific for the methylated targets and that false positive results have been avoided.

Figure 1. Representative analysis of methylation specific polymerase chain reaction products showing the detection of unmethylated sequences (Un) and methylated ones (Me) of the (A) MIR34a, (B) MIR34b/c genes from breast tumor (BC) and lung tumor (LC) tissues. BL, Treated bisulfite DNA isolated from blood lymphocytes of healthy volunteers; NB, Untreated bisulfite DNA isolated from blood lymphocytes of healthy volunteers; (−), Negative control without DNA templates; L, DNA ladders. MSP product sizes of the methylated sequences of MIR34a and MIR34b/c are 100 and 93 bp, respectively.

Genomic DNAs were subsequently treated with bisulfite and then subjected to the MSP assays. Representative results of the MSP reactions were illustrated in Fig. 1. The MSP products specific to methylated sequences of the MIR34 promoters were directly sequenced. The results showed that all cytosines in the CpG sites remained cytosines and the cytosines alone were converted to thymidines (data not shown), indicating the completely conversion of genomic DNA by bisulfite treatment.

The MSP analysis revealed that methylation of MIR34 promoters occurred in all analyzed tissues (breast cancer and adjacent tissues as well as in lung cancer and non-cancerous tissues). Among 79 pairs of matched breast cancer and adjacent tissues, MIR34a methylation occurred with the frequency of 49.37% in cancer tissue, which is significantly higher than its frequency of 30.38% in normal adjacent tissue (P=0.015). These frequencies for MIR34b/c methylation were 59.49 and 62.03%, respectively, with no significant difference. The methylation frequencies of MIR34a and MIR34b/c in lung cancer (48.42 and 56.84%) were similar to those in non-cancerous lung diseases (47.22 and 51.39%) (Table II).

Table II. Methylation profile of the MIR34 genes in breast and lung cancers.

Table II.

Methylation profile of the MIR34 genes in breast and lung cancers.

	Number of methylated cases (%)
Tissue	miRa	P-value	miRb/c	P-value
Breast cancer		0.015a		0.745
Tumor (n=79)	39 (49.37)		47 (59.49)
	[38.34; 60.39]		[48.67; 70.32]
Normal adjacent tissue (n=79)	24 (30.38)		49 (62.03)
	[20.24; 40.52]		[51.32; 72.73]
Lung cancer		0.878		0.483
Tumor (n=95)	46 (48.42)		54 (56.84)
	[38.37; 58.47]		[46.88; 66.80]
Pulmonary diseases (n=72)	34 (47.22)		37 (51.39)
	[35.69; 58.75]		[39.84; 62.93]

a Significant (P<0.05). The methylation status was indicated as (+) for methylated and (−) for unmethylated. miRa, MIR34a; miRb/c, MIR34b/c. Numbers in parentheses, when not preceded by ‘n=’, indicate the methylation frequency. Numbers in brackets indicate the 95% confidence interval of the methylation frequency. miR, microRNA.

As assessed by the calculation of the Kappa coefficient, the methylation status of MIR34a showed a significant concordance with that of MIR34b/c in breast cancer tissue but not in normal adjacent tissues (OR=2.12, 95% CI: 1.04–4.28, P=0.04). On the contrary, a significant concordance of the methylation status of both MIR34a and MIR34b/c genes was observed in lung cancer as well as in non-cancerous pulmonary diseases (P=0.0001; <0.0001) (Table II). Additionally, the methylation status of each gene promoter was also analyzed in association with clinicopathological features such as the histological tumor type, the tumor grade and the metastasis status (Table III). For breast cancer, the results showed that the methylation frequency of MIR34a was significantly associated with tumor type IDC (P=0.02). The univariate logistic analysis indicated that MIR34a was more methylated in the IDC type than in the other carcinoma types (OR=6.17, 95% CI: 1.25–30.32, P=0.03). However, no significant differences in the methylation frequency of the MIR34b/c gene were associated with clinical features of breast cancer patients such as the tumor grade and the metastasis status, nor with the patient' age. As far as lung cancer and non-cancerous pulmonary diseases are concerned, there was no significant association of the methylation frequency of MIR34a and MIR34b/c with any clinical features nor with the patient' age or sex.

Table III. Association of the methylation status of the MIR34s genes with the clinicopathologicalcharacteristics of the 79 breast cancer, 95 lung cancer and 72 non-cancerous pulmonary disease patients.

Table III.

Association of the methylation status of the MIR34s genes with the clinicopathologicalcharacteristics of the 79 breast cancer, 95 lung cancer and 72 non-cancerous pulmonary disease patients.

A, Breast cancer
		miR34a			miR34b/c
Feature	No. of patients	Un	Me	P-value	Un	Me	P-value
Histological tumor type	79			0.015b			0.274
IDC	67	30	37		25	42
ILC	5	3	2		2	3
Other	7	7	0		5	2
Tumor grade	65			0.999			0.382
Grade 1	3	1	2		0	3
Grade 2	54	24	30		22	32
Grade 3	8	4	4		2	6
Metastasis	79			0.934a			0.753a
No	51	26	25		20	31
Yes	28	14	14		12	16
Age, years	79			0.749a			0.192a
<50	29	14	15		9	20
≥50	50	26	24		23	27
B, Lung cancer
		miR34a			miR34b/c
Feature	No. of patients	Un	Me	P-value	Un	Me	P-value
Histological tumor type	95			0.809			0.786
NSCLC	72	38	34		30	42
SCLC	1	0	1		0	1
Other	22	11	11		11	11
Stage	79			0.739			0.311
I	2	1	1		0	2
II	28	17	11		11	17
III	49	25	24		25	24
Sex	94			0.877a			0.961a
Female	21	21	20		18	23
Male	28	28	25		23	30
Age, years	86			0.999			0.999
<50	10	5	5		4	6
≥50	76	41	35		35	41
EGFR mutation	44			0.480			0.484
No	11	3	8		4	7
Yes	33	15	18		16	17
C, Lung diseases
		miR34a			miR34b/c
Feature	No. of patients	Un	Me	P-value	Un	Me	P-value
Diagnosis	71			0.768			0.306
Aspergillus	9	3	6		4	5
Tuberculosis	16	8	8		8	8
Pneumonia	22	11	11		8	14
Pulmonary gas pressures	17	10	7		9	8
Benign tumors	3	2	1		2	1
Other diseases	4	3	1		4	0
Sex	72			0.554a			0.118a
Female	25	12	13		9	16
Male	47	26	21		26	21
Age, years	70			0.863			0.863
<50	46	24	22		22	24
≥50	24	12	12		12	12

{ label (or @symbol) needed for fn[@id='tfn3-mmr-18-02-2476'] } P-values were calculated by the Fisher's test

a P-values were calculated by the Chi-square test

b P<0.05. IDC, invasive ductal carcinoma; ILC, invasive lobular carcinoma; NSCLC, non-small cell lung cancer; SCLC, small cell lung cancer; Me, methylated status; Un, unmethylated status; miR, microRNA.

Discussion

Over the past few years, there have been increasing evidences asserting the role of small non coding microRNA genes in different cellular processes promoting cell differentiation, proliferation, malignant transformation and tumorigenesis (4,5). Among the huge number of microRNA genes, the MIR34 genes have been extensively focused on because they play a key role as tumor suppressors in cancer (10,11). Currently, clinical trial on cancer therapy based on MIR34a has already shown antitumor activity in refractory advanced solid tumor (39). Therefore, investigating the aberrant expression of the MIR34 family in cancer has been being an attractive subject. The down regulation of all the three members of the MIR34 family via promoter methylation, the correlation between MIR34 methylation with cancer type, grade, metastasis and survival, as well as the aberrant expression of MIR34 targeted genes have been extensively reported in multiple types of cancers including breast and lung cancers (12,17,19,40). However, an integrative comparison of MIR34 methylation between both type of cancers vs. normal tissues adjacent to breast cancer or non-cancerous pulmonary disease tissues has rarely been described so far, while both types of these cancers are the first and second common types of cancer (33). From a more general standpoint over the literature, the difference in MIR34s methylation frequency among non-cancerous, cancer and normal adjacent tissues has been only explored in several types of cancer such as prostate, colon, gastric and skin cancer (19,31,32). In this study, we revealed that MIR34 methylation was frequently found not only in breast cancer but also in normal tissue adjacent to tumor, with the lowest frequency being around 30% (Table II). Interestingly, MIR34a methylation occurred with significantly higher frequency in breast cancer than in adjacent tissues (Table II), and showed a concordance with MIR34b/c methylation only in breast cancer tissues (Table III). Concerning lung cancer, we showed here that methylation of MIR34a and MIR34b/c occurs in non-cancerous lung disease tissues with similar frequency than in lung cancer (Table II), suggesting their role in cancerous and non-cancerous lung disease onset and progression. Indeed, it is worth noting that no MIR34a methylation and a tiny frequency of MIR34b/c methylation have been detected in normal tissue adjacent to tumor of lung cancer (16,40,41). In addition, the contribution of MIR methylation to the pathogenesis of pulmonary fibrosis has been described previously (42). In our study, the concomitant methylation of MIR34a and MIR34b/c in breast cancer, lung cancer and non-cancerous lung disease tissues but not in normal tissue adjacent to breast cancer (Table II) emphasizes the role of MIR34 methylation in human diseases including cancers. Recently, Piletič and Kunej have reviewed that epigenetic regulation of 63 MIR genes including MIR34s was strongly correlated with 21 human diseases including 11 types of cancers (43).

Interestingly, MIR34a methylation was significantly correlated with tumor type IDC that consists of about 85% of all breast cancer types (Table III). Aberrant methylation of MIR34a has been found to have significant relation with the tumor grade from triple negative breast cancers or type II ovarian cancer (17,44). However, we did not find any association between MIR34a methylation and breast tumor grade or lymph metastasis (Table III), even if this latter has been frequently reported in various cancer types such as colon, gastric and esophageal carcinomas (22,31,45). Similarly, there were no association of MIR34a methylation with clinicopathological features of lung cancer as shown in our study (Table III), as also shown in a previous work from Wang and colleagues (23). These observations suggested that the aberrant MIR34a methylation is preferentially associated with the development of different types of cancer. This could be supported by some other findings such as the strong association of MIR34a methylation with p53 mutation in Li-Fraumeni syndrome, a highly penetrant cancer predisposition syndrome while on the contrary, no association with p53 mutation was found in ovarian cancer (44,46).

On the contrary to MIR34a, MIR34b/c methylation did not differ from breast cancer to adjacent tissues as well as from lung cancer to non-cancerous tissues although it occurred in all investigated tissues in this study. Furthermore, no significant difference in MIR34b/c methylation was found associated with clinicopathological features of neither breast nor lung cancer. There were number of previous reports showing that MIR34b/c methylation has a strong association with histologic type, pathologic stage and distance metastasis of breast and lung cancer (17,21,40,47). However, it is worth noting that these conclusions have not always been consistent, since other studies did not detect any correlation of MIR34b/c methylation with tumor metastasis nor with clinicopathological features in lung, gastric and colon cancers (16,31,32). The inconsistence of our result with previous studies may be explained by the difference concerning the tumor stage of analyzed samples. In our study, breast samples at grade 3 represented 12% [while it was 32% in the study by Zeng et al (17)], and lung cancer samples at stage IV represented 52% [while no sample of this stage was analyzed in the study by Kim et al (40)]. In addition, there are limitations inherent to our study design that should be noted. The statistical analysis was limited to small samples. Moreover, the clinicopathological characteristics concerning hormone phenotypes ER/PR/HER2 presented some missing data. In our future studies, increasing number of fully characterized samples will be analysed to determine the correlation between MIR34 promoter methylation and subtypes of cancers.

To summarize, this study has chosen the non quantitative MSP method for the preliminary analysis of MIR34 methylation, a method that has been widely used in numerous studies (48) given its simplicity, high sensitivity and low cost. We have shown that the methylation frequently and concomitantly occurred at the promoters of MIR34 gene family in breast, lung cancer and pulmonary diseases. The encouraging results now prompt us to quantitatively investigate the correlation between MIR34 promoter methylation and the silencing of their expression, as well as with the expression level of the mRNAs targeted by MIR34s. In long term, this would allow optimizing detection techniques that are suitable for moderately equipped laboratories in developing countries, using MIR methylation markers in clinical applications for diagnosis of human disease including cancers.

Acknowledgements

The authors would like to thank Doan H. Van, Nguyen T. Duc and Thieu M. Thu at the Biomedical Lab, Faculty of Biology, VNU University of Science, Hanoi, Vietnam.

Funding

This study was financially supported by the Ministry of Science and Technology, Vietnam (grant no. 106-YS.06-2015.07).

Availability of data and materials

The datasets used and/or analyzed during the current study are available on reasonable request addressed to the corresponding author.

Authors' contributions

VTTL conceived, planned the experiments and wrote the manuscript. VLT contributed to the statistical analysis and manuscript writing. PATD carried out the statistical analysis. HVS and NLT contributed to sample preparation. NTT and NTP carried out the experiments.

Ethics approval and consent to participate

Informed consent for using tissue materials for scientific purposes and publication was obtained from patients in written form and the study was approved by the guidelines of the VNU University of Science ethical committee in Vietnam (no. 9/2016/108/HDTN, VNU University of Science, Hanoi, Vietnam).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References