Open Access

UBE2T promotes proliferation and regulates PI3K/Akt signaling in renal cell carcinoma

  • Authors:
    • Peng Hao
    • Bo Kang
    • Yapeng Li
    • Wenqi Hao
    • Feihong Ma
  • View Affiliations

  • Published online on: June 3, 2019     https://doi.org/10.3892/mmr.2019.10322
  • Pages: 1212-1220
  • Copyright: © Hao et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Renal cell carcinoma (RCC) is a common malignant tumor globally. The overall survival of patients with RCC is poor; one important factor is tumor heterogeneity. Ubiquitin‑conjugating enzyme E2T (UBE2T) has been reported to act as an oncogene in various types of cancer; however, its role in RCC has yet to be investigated. In the present study, UBE2T was demonstrated via reverse transcription‑quantitative PCR analysis to be significantly upregulated in RCC samples and cell lines compared with in normal tissue and cells. Additionally, UBE2T expression was significantly associated with late tumor stage and high grade in patients with RCC, and patients with high UBE2T expression exhibited poor prognosis compared with patients with low expression. Following knockdown of UBE2T in 786‑O cells using RNA interference technology, the proliferation and colony formation of cells were inhibited as determined by an MTT assay and crystal violet staining, respectively; however, the migration and invasion of 786‑O cells were not affected, as determined by wound‑healing assay and Transwell assays, respectively. Xenograft RCC tumor growth in vivo was also significantly suppressed. The expression levels of two mesenchymal cell markers, N‑cadherin and vimentin, were reduced following UBE2T knockdown, whereas E‑cadherin and fibronectin levels were increased as determined by western blotting, indicating that epithelial‑mesenchymal transition was suppressed. In addition, the phosphorylation levels of PI3K, Akt and mTOR were notably decreased following UBE2T knockdown, but were increased when UBE2T was overexpressed. Wortmannin, an Akt inhibitor, reversed the UBE2T overexpression‑induced increase in the phosphorylation of PI3K, Akt and mTOR. Similarly, the UBE2T overexpression‑induced promotion of 786‑O cell proliferation was also attenuated by wortmannin. In conclusion, UBE2T promoted the proliferation of RCC cells by regulating PI3K/Akt signaling, suggesting it may be a novel target for the treatment of patients with RCC.

Introduction

Renal cell carcinoma (RCC) is among the top 10 most lethal types of cancer and is the cause of >10,000 cases of mortality every year (1). According to the most recent statistics published by the American Cancer Society, ~65,340 individuals were predicted to be diagnosed with RCC in 2018, whereas the estimated mortality rate was ~14,970 cases (1). Patients with RCC frequently encounter recurrence and/or metastasis in late stages, leading to poor clinical outcome despite the improved treatments for RCC currently in use (2,3). The 5-year survival rate for patients with kidney cancer with distant metastasis is only 12%, whereas it is 67% for patients with localized cancer (1). At present, ~16% of patients are diagnosed with distant metastasis (1); however, there is no agreement regarding the molecular mechanisms underlying RCC. Next-generation sequencing technology has identified dozens of gene mutations associated with various type of cancer; however, only mutations of certain driver genes serve dominant roles in the development and progression of cancer (4). A number of genes associated with RCC have been identified, but the heterogeneity of the condition increases the importance of identifying novel genes and further understanding the molecular mechanisms underlying RCC (5,6).

Ubiquitin-conjugating enzyme E2T (UBE2T) is a member of the ubiquitin-proteasome family; this family is an efficient protein-modification system that serves important roles in almost all cell behaviors, including DNA replication, cell proliferation, differentiation, apoptosis and angiogenesis (7,8). UBE2T has been reported to bind to FA complementation group L protein via its UBC domain, promoting the formation of the Fanconi anemia (FA) core complex and activating the FA signaling pathway (911). In addition, UBE2T has been reported to cause FA, increasing the risk of acute myeloid leukemia or head/neck squamous carcinomas (1113). Additionally, UBE2T has been identified to act as an oncogene in numerous types of cancer. For example, UBE2T promotes cell proliferation, invasion and metastasis in nasopharyngeal carcinoma (14), and induces the ubiquitination of p53 in hepatocellular carcinoma, promoting cell growth (15). Elevated expression of UBE2T also serves an oncogenic role in prostate cancer (16). Knockdown of UBE2T suppresses the proliferation and invasion of osteosarcoma and gastric cancer cells (17,18). Furthermore, cell cycle arrest and apoptosis are induced by UBE2T silencing in bladder cancer (19). In breast cancer, UBE2T overexpression results in the degradation of BRCA1 and poor clinical outcome (20). Furthermore, UBE2T is overexpressed in lung cancer and is involved in resistance to chemotherapeutic drugs (2123). At present, the role of the UBE2T gene in the development and progression of RCC is yet to be investigated.

This study aimed to identify the role of UBE2T in RCC; therefore, the expression of UBE2T was detected in RCC tissues and cells, and its clinical relevance to RCC was analyzed. Furthermore, the effects of UBE2T knockdown on the proliferation, colony formation and invasion of RCC cells were studied in vitro, and in vivo in a nude mouse model. Additionally, the effects of UBE2T knockdown on the phosphorylation of PI3K, Akt and mTOR were investigated via western blot analysis.

Materials and methods

Clinical samples and ethics statement

A total of 52 fresh surgical tissues and matched adjacent normal tissues from patients (15–62 years old, 36 males and 16 females) diagnosed with RCC were collected from June 2014 to July 2016 at the Department of Urology Surgery of First Affiliated Hospital of Jiamusi University, flash frozen in liquid nitrogen and stored at −80°C. Patients that did not receive chemotherapy or radiotherapy prior to surgery were selected for this study. Completed signed clinical information was collected. The pathological stage of patients was established based on the TNM classification system from the WHO (24). Total RNA and protein were extracted and stored at −80°C, and used for reverse transcription-quantitative PCR (RT-qPCR) and western blotting, respectively. Patients were separated into high- and low-expression groups for survival analysis based on their levels of UBE2T expression; a fold change >2 in expression in tumor tissue compared with in normal tissue was considered high, whereas a fold change ≤2 was considered low.

Written informed consent was obtained from all patients. All experiments were approved by the Institutional Review Board of The First Affiliated Hospital of Jiamusi University.

Cell culture and transfection of small interfering RNA (siRNA)

Human renal cancer cell lines (786-O, ACHN and OSRC-2) and a non-cancer cell line (293) were purchased (Cell Bank of the Chinese Academy of Sciences) and cultured in RPMI-1640 medium (Hyclone; GE Healthcare Life Sciences) with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.) in a humidified atmosphere with 5% CO2. at 37°C. siRNA fragments targeting human UBE2T (siUBE2T; sequence, 5′-GCAACTGTGTTGACCTCTATT-3′) and negative control (siNC; sequence, 5′-GCTTCGGATACGTTTCCTAAT-3′) were synthesized (Shanghai Telebio Biomedical Co., Ltd.) and transfected into 786-O cells (1×105) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The dosage of siRNA used was 1.0 µM, and the interval between transfection and subsequent experiments was 6 h.

Construction of a UBE2T overexpression plasmid (oeUBE2T) and transfection

The coding sequence for UBE2T (synthesized by Synbio Technologies) was transferred into vector pcDNA3.1 (Invitrogen; Thermo Fisher Scientific, Inc.) using EcoRI and NotI restriction enzymes. Subsequently, ~1.5 µg of the recombined plasmid pcDNA3.1-UBE2T or empty vector pcDNA3.1 were transfected into 786-O cells (1×105) using Lipofectamine® 2000. After culturing for 48 h, total protein was extracted from the treated cells, stored at −80°C and used for western blotting.

Cell proliferation assay

siUBE2T- or siNC-transfected 786-O cells were seeded into a 96-well plate at 1,000 cells/well. Following incubation for 48 h at 37°C, the culture medium was replaced and 20 µl MTT reagent (5 mg/ml; Sigma-Aldrich; Merck KGaA) was added. After a further 4 h at 37°C, supernatants were removed and 200 µl DMSO was added. The absorbance was detected at a wavelength of 490 nm using a microplate reader. Wortmannin (5 nM; Sigma-Aldrich; Merck KGaA) was used to treat 786-O cells transfected with siUBE2T, siNC or oeUBE2T for 24 h at 37°C.

Colony formation assay

siUBE2T-or siNC-transfected 786-O cells were seeded in a 60-mm dish at 2,000 cells/dish. After 2 weeks at 37°C, 100% methanol was used to fix the colonies for 2 min at room temperature. Crystal violet staining solution (Sangon Biotech Co., Ltd.) was used to stain the fixed colonies for 15 min at room temperature. The number of stained colonies was counted under a Nikon microscope (magnification, ×100; Nikon Corporation); five fields were selected randomly for evaluation.

Transwell assay

siUBE2T-or siNC-transfected 786-O cells were seeded into the upper chambers of Transwell inserts (8.0-µm pore size; BD Biosciences) with or without Matrigel matrix at 5×104 cells/well in DMEM containing 2% FBS. DMEM containing 20% FBS (500 µl) was placed in the lower chambers. Following incubation for 48 h at 37°C, the cells in the bottom of each chamber were fixed with 100% methanol for 5 min at room temperature and stained with 0.1% crystal violet staining solution for 15 min at room temperature. Five fields were selected randomly and images were captured. Subsequently, the cell number was counted under a Nikon microscope (magnification, ×100; Nikon Corporation).

RT-qPCR

Total RNA was extracted from tissues and cell lines using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and was treated with RNase-free DNase (Promega Corporation). Total RNA (1 µg) was used for synthesis of first strand of cDNA using a reverse transcription kit (Takara Biotechnology Co., Ltd.). The protocol used was as follows: 42°C for 50 min. qPCR was performed using a Hifair III One Step RT-qPCR SYBR Green kit (Yeasen Biotech Co., Ltd.) using a Stepone Real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). qPCR was conducted as follows: 95°C for 5 min, then 40 cycles of 95°C for 10 sec and 60°C for 30 sec. GAPDH was used as the internal control. The relative expression of each gene was calculated using the 2−∆∆Cq method, in which ∆Cq=Cq(gene of interest)-Cq(GAPDH) (25). The primers used are presented in Table I.

Table I.

The primers for RT-qPCR for each gene.

Table I.

The primers for RT-qPCR for each gene.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
UBE2T CGAGCTCGTAGAAATATTAGGTGGA TCATCAGGGTTGGGTTCTGAC
GAPDH GAGAAGGCTGGGGCTCATTT AGTGATGGCATGGACTGTGG

[i] UBE2T, ubiquitin-conjugating enzyme E2T.

Western blot analysis

Total protein was extracted using a Nuclear and Cytoplasmic Protein Extraction kit (Beyotime Institute of Biotechnology) and quantified via the BCA method using an Enhanced BCA Protein Assay kit (Beyotime Institute of Biotechnology). Proteins (20 µg/lane) were separated via 10% SDS-PAGE and transferred onto PVDF membranes. Membranes were blocked with 5% nonfat milk at room temperature for 1 h. Subsequently, the PVDF membranes were incubated with primary antibodies at 4°C for 12 h, followed by washing with 0.05% TBS-Tween-20 three times. The primary antibodies used during the study were specific for phosphorylated (p)-AKT (1:500; cat. no. ab38449; Abcam), p-PI3K (1:500; cat. no. ab138364; Abcam), p-mTOR (1:2,000; cat. no. ab109268; Abcam), total AKT (1:2,000; cat. no. ab179463; Abcam), total PI3K (1:2,000; cat. no. ab180967; Abcam), total mTOR (1:1,000; cat. no. ab2732; Abcam), UBE2T (1:1,000 cat. no. ab140611; Abcam), fibronectin (1:1,000; cat. no. ab45688; Abcam), E-cadherin (1:600; cat. no. 14472; Cell Signaling Technology, Inc.), N-cadherin (1:1,000; cat. no. 4061; Cell Signaling Technology, Inc.), vimentin (1:500; cat. no. 3932; Cell Signaling Technology, Inc.) and GAPDH (1:1,000; cat. no. 5174; Cell Signaling Technology, Inc.). PVDF membranes were then incubated with secondary antibodies for 1 h at 37°C, followed by washing with TBS three times. The secondary antibodies included horseradish peroxidase-conjugated sheep anti-mouse IgG (1:1,000; cat. no. HAF007; R&D Systems, Inc.) and anti-rabbit IgG (1:1,000; HAF008; R&D Systems, Inc.). Finally, the membranes were analyzed using an ECL Chemiluminescence Detection kit (Beyotime Institute of Biotechnology). PhotoShop CS6 software was used to quantify protein expression following western blotting (Adobe Systems, Inc.).

In vivo antitumor growth assay

A total of 16 BALB/c-nu mice (age, 7 weeks; weight, 20–25 g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. and were allocated into two groups: siUBE2T and siNC, with 8 mice/group. Animals were maintained at a constant temperature of 25°C with ~50% humidity, under a regular 12:12-h light/dark photoperiod with food and water available ad libitum. Animals were inoculated into the right flank with 3×106 cancer cells following transfection for 24 h with siUBE2T or siNC and monitored every day for 35 days. Tumor volume was calculated twice a week using the following equation: V = (LxW2)/2, where V is the tumor volume, L is the length and W is the width of the tumor. The study was approved by the Animal Research Ethics Committee of The First Affiliated Hospital of Jiamusi University. On day 35, all mice were euthanized according to the protocols approved by the Ethics Committee. All the experiments on mice were performed within the guidelines of the Institutional Animal Care and Use Committee of The First Affiliated Hospital of Jiamusi University.

Statistical analysis

All experiments were repeated at least three times, and the data are presented as the means ± standard deviation. Differences between the groups were compared using one-way ANOVA followed by Tukey's post hoc test. χ2 test was used to analyze associations between UBE2T expression and the clinicopathological factors of patients with RCC. The Kaplan-Meier method and log-rank test were used to analyze the association between UBE2T expression and the survival of patients with RCC. P<0.05 was considered to indicate a statistically significant difference.

Results

UBE2T exhibits clinical significance in RCC

To investigate the role of UBE2T in RCC, a total of 52 RCC tissues and adjacent normal tissues were collected, and the expression of UBE2T was determined via RT-qPCR. As presented in Fig. 1A, UBE2T was overexpressed in tumor tissues compared with adjacent normal controls. The mean mRNA expression of UBE2T in tumor tissues was four-fold that in the adjacent controls. Additionally, UBE2T expression was notably increased at the mRNA and protein levels in RCC cell lines compared within 293 cells (Fig. 1B and C). Pathological association analysis revealed that UBE2T expression was associated with TNM grade (P=0.001) and pathological stage (P=0.001) in patients with RCC (Table II). Furthermore, Kaplan-Meier analysis indicated that the survival rate of patients with RCC with high UBE2T expression was significantly decreased compared with patients with low UBE2T expression (18.2 vs. 42.1%; P=0.01; Fig. 1D). These data suggested that UBE2T exhibited clinical relevance for RCC and was associated with poor prognosis.

Table II.

Association of UBE2T expression with clinicopathological factors in renal cell carcinoma.

Table II.

Association of UBE2T expression with clinicopathological factors in renal cell carcinoma.

UBE2T expression

FactorLow (n=19)High (n=33)P-value
Sex 0.477
  Male  919
  Female1014
TNM stage 0.001
  I/II14  8
  III/IV  525
Grade 0.001
  G1+G21610
  G3+G4  323

[i] UBE2T, ubiquitin-conjugating enzyme E2T.

UBE2T regulates cell proliferation and colony formation in RCC

To investigate the function of UBE2T in RCC, 786-O cells were transfected with siUBE2Tor siNC. As presented in Fig. 2A and B, UBE2T was successfully knocked down at the mRNA and protein level in 786-O cells following siRNA transfection; the knockdown efficiency was >70%. The proliferation rate of 786-O cells was significantly decreased by ~65% following knockdown of UBE2T (Fig. 2C). The ability to form colonies was also inhibited; as presented in Fig. 2D and E, the number of siUBE2T-treated 786-O cell colonies was significantly decreased compared with the control. Conversely, the migration and invasion of 786-O cells was not significantly affected by UBE2T (Fig. 3A-D). In conclusion, the results indicated that UBE2T contributed to the proliferation and growth, but not migration of 786-O cells.

UBE2T regulates the expression of epithelial-mesenchymal transition (EMT) markers in RCC

EMT is an important process during the transformation of normal cells into tumor cells (26). Typical molecular markers of epithelial cells are E-cadherin and fibronectin, whereas N-cadherin and vimentin are frequently used markers of mesenchymal cells (27,28). As presented in Fig. 4A and B, the expression of E-cadherin and fibronectin was notably increased in 786-O cells following UBE2T knockdown; conversely, the levels of N-cadherin and vimentin were reduced. The results indicated that UBE2T may participate in the EMT process in RCC.

UBE2T is critical for the activation of PI3K/Akt/mTOR signaling in RCC

PI3K/Akt and the mTOR signaling pathway serve important roles in embryonic development; however, these two signaling pathways are frequently overactivated in tumors (29,30). In the present study, it was demonstrated that the levels of PI3K, Akt and mTOR phosphorylation were markedly decreased following UBE2T knockdown in 786-O cells (Fig. 5A). Conversely, the levels of total PI3K and total AKT were not altered; however, total mTOR expression was notably decreased. Wortmannin, a specific Akt inhibitor, did not further reduce the phosphorylation levels of PI3K, Akt and mTOR following UBE2T knockdown. Additionally, the cell proliferation rate in the siUBE2T-transfected group was not significantly different to that in the siUBE2T/wortmannin or siNC/wortmannin groups (Fig. 5B). Conversely, oeUBE2T transfection upregulated the expression of UBE2T compared with the control, and increased the levels of p-PI3K, p-Akt and p-mTOR compared with siNC (Fig. 5A); however, the effects on phosphorylation were reversed by wortmannin, which also significantly decreased cell proliferation even when UBE2T was overexpressed in 786-O cells (Fig. 5B). Therefore, these data suggested that UBE2T was involved in regulation of the activation of the PI3K/Akt and mTOR signaling pathways in 786-O cells.

UBE2T knockdown suppresses xenograft tumor growth in vivo

As presented in Fig. 6A, tumor growth was significantly suppressed following UBE2T knockdown. The mean tumor volume in si-UBE2T mice was significantly decreased compared with the control on day 35 (1,412.5 mm3 vs. 620 mm3; P<0.05). In addition, the mean tumor weight was significantly decreased following UBE2T knockdown (0.26 g vs. 0.75 g; P<0.05; Fig. 6B). Therefore, it was suggested that UBE2T contributed to xenograft tumor growth in vivo.

Discussion

RCC is a common malignant tumor characterized by poor prognosis, late diagnosis, frequent recurrence and heterogeneity (13). The primary therapy for patients with RCC is surgical removal followed by chemotherapy or radiotherapy; however, traditional therapeutics have not improved the quality of life of patients with RCC (31,32). Therefore, there is a requirement for further investigation into RCC. At present, a series of genes have been reported to serve important roles during the tumorigenesis of RCC; however, the critical genes vary between each report (33,34), potentially due to the heterogeneity of RCC.

To the best of our knowledge, the present study is the first to indicate that UBE2T may be a potential candidate predictive factor in RCC. As aforementioned, UBE2T was overexpressed in clinical tumor tissues and was negatively associated with the survival of patients with RCC. The levels of UBE2T were significantly associated with pathological characteristics such as tumor stage and grade. These data suggested the clinical relevance of UBE2T in RCC. This was consistent with a previous study in which UBE2T was reported to be an independent predictive factor in gastric cancer (35). A larger cohort of clinical RCC samples is required to further validate this finding. UBE2T was also reported to be upregulated in tumor cell lines compared with that in control cells. UBE2T knockdown was reported to inhibit cell proliferation and colony formation in 786-O cells in vitro. In vivo, UBE2T contributed to tumor growth. Tumor cells possess the ability to undergo potentially unlimited proliferation (36). Therefore, it was hypothesized that UBE2T served an important role in the progression of RCC. This was consistent with previous findings; for example, previous studies identified that UBE2T overexpression promotes cell proliferation and metastasis in gastric cancer (18,35). Metastasis is another characteristic of cancer (36); however, in the present study, UBE2T expression did not appear to affect the migration and invasion of 786-O cells.

EMT is an important process during the transformation of normal cells to cancer cells, which has been reported to promote the progression of various types of cancer (37). EMT is typically associated with cell migration and invasion in cancer cells; however, in the present study, altered expression of EMT markers was observed in the absence of changes in migration or invasion following siUBE2T transfection. Common molecular markers in EMT include E-cadherin, N-cadherin, vimentin and fibronectin. In the study, the expression of the epithelial markers E-cadherin and fibronectin was upregulated following UBE2T knockdown; whereas the mesenchymal markers N-cadherin and vimentin were downregulated, suggesting that UBE2T regulated the expression of EMT markers. UBE2T may regulate the ubiquitin level of EMT markers in RCC, leading to differential degradation; however, further research is necessary to determine the exact role of UBE2T in EMT in RCC. In conclusion, UBE2T promoted the proliferation but not metastasis of RCC cells, and it may be involved in EMT processes in RCC.

In the present study, it was demonstrated that UBE2T was involved in RCC; however, the mechanisms underlying the effects of UBE2T on cell proliferation in RCC remain unclear. PI3K/Akt is a very important signaling pathway during embryonic development, which frequently induces positive effects on cell growth or proliferation. It has been reported to be overactivated in tumors, with increased phosphorylation of PI3K and Akt acting as the critical event (38). In the present study, the phosphorylation levels of PI3K and Akt were increased following UBE2T overexpression and decreased following UBE2T knockdown. These findings suggested that UBE2T may regulate PI3K/Akt signaling in RCC. Wortmannin, a specific inhibitor of Akt, was demonstrated to downregulate the phosphorylation levels of PI3K and Akt even when UBE2T was overexpressed in 786-O cells. The proliferation-promoting role of UBE2T was also suppressed by wortmannin. These data further supported the hypothesis that UBE2T regulated PI3K/Akt signaling in RCC.

Hu et al reported that UBE2T activated the Akt/glycogen synthase kinase 3β/β-catenin signaling pathway in nasopharyngeal carcinoma (14). UBE2T was also demonstrated to promote cell proliferation via the regulation of PI3K/Akt signaling in osteosarcoma (17). Therefore, it was predicted that UBE2T may activate PI3K/Akt signaling in RCC, as was observed. Additionally, the phosphorylation levels of mTOR were regulated by UBE2T in 786-O cells. mTOR is an important signaling molecule during cell growth (39), which has been demonstrated to crosstalk with PI3K/Akt signaling in cancer cells; for example, PI3K/Akt/mTOR signaling was reported to exhibit positive effects during tumorigenesis in medulloblastoma and thyroid cancer (38,40). Ubiquitin conjugating enzyme E2C (UBE2C) is another member of the ubiquitin-proteasome family that possesses similar functions to UBE2T (41). UBE2C was reported to induce EMT via the PI3K/Akt signaling pathway (42). Activation of PI3K/Akt/mTOR signaling has been revealed to promote EMT in numerous types of cancer (4345). As aforementioned, UBE2T was observed to be involved in the expression of EMT-associated markers in RCC. Therefore, based on the aforementioned studies and reported findings, it was hypothesized that UBE2T promoted proliferation and EMT in RCC by activating the PI3K/Akt/mTOR signaling pathway; however, further study is required to determine the molecular interactions between UBE2T and the PI3K/Akt/mTOR signal pathway.

In conclusion, to the best of our knowledge, this study is the first to report that UBE2T promoted tumorigenesis in RCC by regulating the PI3K/Akt/mTOR signaling pathway. Therefore, UBE2T may be a novel target in the treatment of RCC.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

FHM designed and guaranteed the integrity of the whole study, and reviewed the manuscript. PH participated in the design of the study and performed the majority of the experiments. BK was involved in the statistical analysis of all data. YPL conducted the study of the literature, participated in the design of major experiments and edited the manuscript. WQH was involved in the collection and analysis of clinical data, and drafted and revised the manuscript.

Ethics approval and consent to participate

The present study was approved by the Institutional Review Board of First Affiliated Hospital of Jiamusi University and written informed consent was obtained from each patient. Animal experiments were approved by the Animal Research Ethics Committee of The First Affiliated Hospital of Jiamusi University.

Patient consent for publication

Each patient provided consent for the publication of any data.

Competing interests

The authors declare that they have no competing interests.

References

1 

Siegel RL, Miller KD and Jemal A: Cancer statistics, 2018. CA Cancer J Clin. 68:7–30. 2018. View Article : Google Scholar : PubMed/NCBI

2 

Rini BI, Campbell SC and Escudier B: Renal cell carcinoma. Lancet. 373:1119–1132. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Bhatt JR and FinelliI A: Landmarks in the diagnosis and treatment of renal cell carcinoma. Nat Rev Urol. 11:517–525. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Kamps R, Brandao RD, Bosch BJ, Paulussen AD, Xanthoulea S, Blok MJ and Romano A: Next-generation sequencing in oncology: Genetic diagnosis, risk prediction and cancer classification. Int J Mol Sci. 18:E3082017. View Article : Google Scholar : PubMed/NCBI

5 

Mirza Z, Schulten HJ, Farsi HM, Al-Maghrabi JA, Gari MA, Chaudhary AG, Abuzenadah AM, Al-Qahtani MH and Karim S: Impact of S100A8 expression on kidney cancer progression and molecular docking studies for kidney cancer therapeutics. Anticancer Res. 34:1873–1884. 2014.PubMed/NCBI

6 

Brugarolas J: Molecular genetics of clear-cell renal cell carcinoma. J Clin Oncol. 32:1968–1976. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Alpi AF, Chaugule V and Walden H: Mechanism and disease association of E2-conjugating enzymes: Lessons from UBE2T and UBE2L3. Biochem J. 473:3401–3419. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Machida YJ, Machida Y, Chen Y, Gurtan AM, Kupfer GM, D'Andrea AD and Dutta A: UBE2T is the E2 in the fanconi anemia pathway and undergoes negative autoregulation. Mol Cell. 23:589–596. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Alpi A, Langevin F, Mosedale G, Machida YJ, Dutta A and Patel KJ: UBE2T, the fanconi anemia core complex, and FANCD2 are recruited independently to chromatin: A basis for the regulation of FANCD2 monoubiquitination. Mol Cell Biol. 27:8421–8430. 2007. View Article : Google Scholar : PubMed/NCBI

10 

Richman KA, Lach FP, Abhyankar A, Donovan FX, Sanborn EM, Kennedy JA, Sougnez C, Gabriel SB, Elemento O, Chandrasekharappa SC, et al: Deficiency of UBE2T, the E2 ubiquitin ligase necessary for FANCD2 and FANCI ubiquitination, causes FA-T subtype of fanconi anemia. Cell Rep. 12:35–41. 2015. View Article : Google Scholar : PubMed/NCBI

11 

Mamrak NE, Shimamura A and Howlett NG: Recent discoveries in the molecular pathogenesis of the inherited bone marrow failure syndrome fanconi anemia. Blood Rev. 31:93–99. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Hira A, Yoshida K, Sato K, Okuno Y, Shiraishi Y, Chiba K, Tanaka H, Miyano S, Shimamoto A, Tahara H, et al: Mutations in the gene encoding the E2 conjugating enzyme UBE2T cause fanconi anemia. Am J Hum Genet. 96:1001–1007. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Alter BP: Fanconi anemia and the development of leukemia. Best Pract Res Clin Haematol. 27:214–221. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Hu W, Xiao L, Cao C, Hua S and Wu D: UBE2T promotes nasopharyngeal carcinoma cell proliferation, invasion, and metastasis by activating the AKT/GSK3β/β-catenin pathway. Oncotarget. 7:15161–15172. 2016.PubMed/NCBI

15 

Liu LP, Yand M, Peng QZ, Li MY, Zhang YS, Guo YH, Chen Y and Bao SY: UBE2T promotes hepatocellular carcinoma cell growth via ubiquitination of p53. Biochem Biophys Res Commun. 493:20–27. 2017. View Article : Google Scholar : PubMed/NCBI

16 

Wen M, Kwon Y, Wang Y, Mao JH and Wei G: Elevated expression of UBE2T exhibits oncogenic properties in human prostate cancer. Oncotarget. 6:25226–25239. 2015. View Article : Google Scholar : PubMed/NCBI

17 

Wang Y, Leng H, Chen H, Wang L, Jiang N, Hua X and Yu B: Knockdown of UBE2T inhibits osteosarcoma cell proliferation, migration, and invasion by suppressing the PI3K/Akt signaling pathway. Oncol Res. 24:361–369. 2016. View Article : Google Scholar : PubMed/NCBI

18 

Luo C, Yao Y, Yu Z, Zhou H, Guo L, Zhang J, Cao H, Zhang G, Li Y and Jiao Z: UBE2T knockdown inhibits gastric cancer progression. Oncotarget. 8:32639–32654. 2017.PubMed/NCBI

19 

Gong YQ, Peng D, Ning XH, Yang XY, Li XS, Zhou LQ and Guo YL: UBE2T silencing suppresses proliferation and induces cell cycle arrest and apoptosis in bladder cancer cells. Oncol Lett. 12:4485–4492. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Ueki T, Park JH, Nishidate T, Kijima K, Hirata K, Nakamura Y and Kataqiri T: Ubiquitination and downregulation of BRCA1 by ubiquitin-conjugating enzyme E2T overexpression in human breast cancer cells. Cancer Res. 69:8752–8760. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Ramaekers CH, van den Beucken T, Meng A, Kassam S, Thoms J, Bristow RG and Wouters BG: Hypoxia disrupts the fanconi anemia pathway and sensitizes cells to chemotherapy through regulation of UBE2T. Radiother Oncol. 101:190–197. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Perez-pena J, Corrales-sanchez V, Amir E, Pandiella A and Ocana A: Ubiquitin-conjugating enzyme E2T (UBE2T) and denticleless protein homolog (DTL) are linked to poor outcome in breast and lung cancers. Sci Rep. 7:175302017. View Article : Google Scholar : PubMed/NCBI

23 

Hao J, Xu A, Xie X, Hao J, Tian T, Gao S, Xiao X and He D: Elevated expression of UBE2T in lung cancer tumors and cell lines. Tumour Biol. 29:195–203. 2008. View Article : Google Scholar : PubMed/NCBI

24 

Lopez-Beltran A, Scarpelli M, Montironi R and Kirkali Z: 2004 WHO classification of the renal tumors of the adults. Eur Urol. 49:798–805. 2006. View Article : Google Scholar : PubMed/NCBI

25 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

26 

Chen T, You Y, Jiang H and Wang ZZ: Epithelial-mesenchymal transition (EMT): A biological process in the development, stem cell differentiation, and tumorigenesis. J Cell Physiol. 232:3261–3272. 2017. View Article : Google Scholar : PubMed/NCBI

27 

Figiel S, Vasseur C, Bruyere F, Rozet F, Maheo K and Fromont G: Clinical significance of epithelial-mesenchymal transition markers in prostate cancer. Hum Pathol. 61:26–32. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Scanlon CS, Van Tubergen EA, Inglehart RC and D'Silva NJ: Biomarkers of epithelial-mesenchymal transition in squamous cell carcinoma. J Dent Res. 92:114–121. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Tian T, Li XY and Zhang JH: mTOR signaling in cancer and mTOR inhibitors in solid tumor targeting therapy. Int J Mol Sci. 20:7552019. View Article : Google Scholar :

30 

Faes S and Dormond O: PI3K and AKT: Unfaithful partners in cancer. Int J Mol Sci. 16:21138–21152. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Berquist SW, Yim K, Ryan ST, Patel SH, Eldefrawy A, Cotta BH, Bradshaw AW, Meagher MF, Bindayi A, McKay RR, et al: Systemic therapy in the management of localized and locally advanced renal cell carcinoma: Current state and future perspectives. Int J Urol. Apr 3–2019.(Epub ahead of print). View Article : Google Scholar : PubMed/NCBI

32 

Wiechno P, Kucharz J, Sadowska M, Michalski W, Sikora-Kupis B, Jonska-Gmyrek J, Poniatowska G, Nietupski K, Ossolinski K and Demkow T: Contemporary treatment of metastatic renal cell carcinoma. Med Oncol. 35:1562018. View Article : Google Scholar : PubMed/NCBI

33 

Hsieh JJ, Purdue MP, Signoretti S, Swanton C, Albiges L, Schmidinger M, Heng DY, Larkin J and Ficarra V: Renal cell carcinoma. Nat Rev Dis Primers. 3:170092017. View Article : Google Scholar : PubMed/NCBI

34 

D'Avella C, Abbosh P, Pal SK and Geynisman DM: Mutations in renal cell carcinoma. Urol Oncol. Nov 23–2018.(Epub ahead of print). View Article : Google Scholar

35 

Yu H, Xiang P, Pan Q, Huang Y, Xie N and Zhu W: Ubiquitin-conjugating enzyme E2T is an independent prognostic factor and promotes gastric cancer progression. Tumour Biol. 37:11723–11732. 2016. View Article : Google Scholar : PubMed/NCBI

36 

Hanahan D and Weinberg RA: Hallmarks of cancer: The next generation. Cell. 144:646–674. 2011. View Article : Google Scholar : PubMed/NCBI

37 

Brabletz T, Kalluri R, Nieto MA and Weinberg RA: EMT in cancer. Nat Rev Cancer. 18:128–134. 2018. View Article : Google Scholar : PubMed/NCBI

38 

Dimitrova V and Arcaro A: Targeting the PI3K/Akt/mTOR signaling pathway in medulloblastoma. Curr Mol Med. 15:82–93. 2015. View Article : Google Scholar : PubMed/NCBI

39 

Cargnello M, Tcherkezian J and Roux PP: The expanding role of mTOR in cancer cell growth and proliferation. Mutagenesis. 30:169–176. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Manfredi GI, Dicitore A, Gaudenzi G, Caraglia M, Persani L and Vitale G: PI3K/Akt/mTOR signaling in medullary thyroid cancer: A promising molecular target for cancer therapy. Endocrine. 48:363–370. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Xie C, Powell C, Yao M, Wu J and Dong Q: Ubiquitin-conjugating enzyme E2C: A potential cancer biomarker. Int J Biochem Cell Biol. 47:113–117. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Wang R, Song Y, Liu X, Wang Q, Wang Y, Li L, Kang C and Zhang Q: UBE2C induces EMT through Wnt/βcatenin and PI3K/Akt signaling pathways by regulating phosphorylation levels of aurora-a. Int J Oncol. 50:1116–1126. 2017. View Article : Google Scholar : PubMed/NCBI

43 

Jin Y, Xu K, Chen Q, Wang B, Pan J, Huang S, Wei Y and Ma H: Simvastatin inhibits the development of radioresistant esophageal cancer cells by increasing the radiosensitivity and reversing EMT process via the PTEN-PI3K/AKT pathway. Exp Cell Res. 362:362–369. 2018. View Article : Google Scholar : PubMed/NCBI

44 

Rumman M, Jung KH, Fang Z, Yan HH, Son MK, Kim SJ, Kim J, Park JH, Lim JH, Hong S and Hong SS: HS-173, a novel PI3K inhibitor suppresses EMT and metastasis in pancreatic cancer. Oncotarget. 7:78029–78047. 2016. View Article : Google Scholar : PubMed/NCBI

45 

Zhang GW, Tian X, Li Y, Wang ZQ, Li XD and Zhu CY: Down-regulation of ETS2 inhibits the invasion and metastasis of renal cell carcinoma cells by inducing EMT via the PI3K/Akt signaling pathway. Biomed Pharmacother. 104:119–126. 2018. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

August-2019
Volume 20 Issue 2

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Hao P, Kang B, Li Y, Hao W and Ma F: UBE2T promotes proliferation and regulates PI3K/Akt signaling in renal cell carcinoma. Mol Med Rep 20: 1212-1220, 2019.
APA
Hao, P., Kang, B., Li, Y., Hao, W., & Ma, F. (2019). UBE2T promotes proliferation and regulates PI3K/Akt signaling in renal cell carcinoma. Molecular Medicine Reports, 20, 1212-1220. https://doi.org/10.3892/mmr.2019.10322
MLA
Hao, P., Kang, B., Li, Y., Hao, W., Ma, F."UBE2T promotes proliferation and regulates PI3K/Akt signaling in renal cell carcinoma". Molecular Medicine Reports 20.2 (2019): 1212-1220.
Chicago
Hao, P., Kang, B., Li, Y., Hao, W., Ma, F."UBE2T promotes proliferation and regulates PI3K/Akt signaling in renal cell carcinoma". Molecular Medicine Reports 20, no. 2 (2019): 1212-1220. https://doi.org/10.3892/mmr.2019.10322