Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
October-2020 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2020 Volume 22 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis

  • Authors:
    • Yirixiati Aihaiti
    • Xiadiye Tuerhong
    • Jin‑Tao Ye
    • Xiao‑Yu Ren
    • Peng Xu
  • View Affiliations / Copyright

    Affiliations: Department of Joint Surgery, Xi'an Jiaotong University Affiliated Hong Hui Hospital, Xi'an Jiaotong University Health Science Center, Xi'an, Shaanxi 710000, P.R. China, Department of Breast Surgery, Xinjiang Medical University Affiliated Tumor Hospital, Urumqi, Xinjiang 830011, P.R. China, Department of Orthopedics, Xi'an Jiaotong University Second Affiliated Hospital, Xi'an, Shaanxi 710004, P.R. China
  • Pages: 3513-3524
    |
    Published online on: August 3, 2020
       https://doi.org/10.3892/mmr.2020.11406
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Rheumatoid arthritis (RA) and osteoarthritis (OA) are the two most common debilitating joint disorders and although both share similar clinical manifestations, the pathogenesis of each is different and remains relatively unclear. The present study aimed to use bioinformatic analysis to identify pivotal genes and pathways involved in the pathogenesis of RA. Microarray datasets from patients with RA and OA were obtained from the Gene Expression Omnibus (GEO) database and differentially expressed genes (DEGs) were identified using GEO2R software; Gene Ontology analysis and pathway enrichment were analyzed using the Database for Annotation, Visualization and Integrated Discovery and the Kyoto Encylopedia for Genes and Genomes, respectively; and protein‑protein interaction networks of DEGs were constructed using the Search Tool for the Retrieval of Interacting Genes database, and module analysis and pathway crosstalk of the PPI network was visualized using plugins of Cytoscape. In addition, the prediction of target mRNAs for differentially expressed microRNAs (DEMs) was performing using the starBase database and the identified pivotal genes were verified using reverse‑transcription quantitative PCR in synovial tissue from patients with RA. A total of 566 DEGs were identified in GSE55457, GSE55235 while 23 DEMs were identified in the GSE72564 dataset. Upregulated DEGs were found to be mostly enriched in the ‘Cytokine‑cytokine receptor interaction’ pathway, whereas downregulated DEGs were discovered to be enriched in the ‘PPAR signaling pathway’. The top 25 DEGs were mostly enriched in the ‘Chemokine signaling pathway’. In addition, six of the miRNA target genes were selected as potential biomarkers and a total of 24 genes were selected as potential hub genes. Experimental validation demonstrated that the expression levels of Cytotoxic T‑Lymphocyte Associated Protein 4 (CTLA4), Zeta‑chain‑associated protein kinase 70 (ZAP70) and LCK proto‑oncogene (LCK) were significantly increased, whereas HGF expression levels were decreased in RA synovial tissue. In conclusion, these findings suggest that the identified DEGs and pivotal genes in the present study may further enhance our knowledge of the underlying pathways in the pathogenesis of RA. These genes may also serve as diagnostic biomarkers and therapeutic targets for RA; however, further experimental validation is necessary following the bioinformatic analysis to determine our conclusions.

Introduction

Rheumatoid arthritis (RA) and osteoarthritis (OA), which are the two most common chronic inflammatory joint diseases that culminate in joint deformity and disability worldwide, both result from persistent inflammatory disorders (1). Both RA and OA involve the destruction of articular cartilage, which eventually results in joint dysfunction (2); however, the pathogenesis of the two diseases is different and remains largely unknown. RA is a systemic autoimmune disease that involves multiple pathways and is characterized by hyperplasia of the synovium, formation of pannus, angiogenesis and T cell infiltration (3); the tumorigenic-like growth of the synovium causes progressive destruction of the bone and articular cartilage (4). Rheumatoid arthritis fibroblast-like synoviocytes (RAFLS) are the most important components of RA synovial tissue and serve an important role in joint destruction through the secretion of various proteases and cytokines (5); the secretion of pro-inflammatory mediators is the main cause of the persistent pain in RA (6). In addition, the contributory role of rheumatoid factor (RF) and anti-citrullinated peptide antibodies (ACPA) in the deterioration of joins have also been investigated (7). ACPA leads to production of pro-inflammatory cytokines and differentiation of osteoclasts (8). Moreover, systemic appearance of ACPA precedes the onset of RA by a number of years (9). OA is a chronic degenerative disease, which is characterized by articular cartilage damage, osteophyte formation and subchondral bone sclerosis. OA is affected by multiple factors, such as age, gender, trauma history, obesity, heredity and joint deformity (10). It is widely accepted that synovitis is associated with symptoms such as joint pain and swelling, and may promote cartilage degradation (11).

microRNAs (miRNAs) are a class of small non-coding RNAs of ~18–25 nucleotides in length, which are highly conserved throughout evolution and serve as important post-transcriptional regulators of gene expression. Each miRNA prevents the transcription of numerous downstream genes by incompletely binding to the 3′ untranslated region of target mRNAs, whereas complete complementary base-pairing leads to the degradation of mRNAs (12). miRNAs play roles in almost all aspects of cancer biology including cell cycle, programmed cell death, tumorigenesis, angiogenesis, invasion and migration (13). Abnormal expression levels of miRNAs are also involved in the pathogenesis of RA, and their different functions in the synovium, synovial fluid and serum have been reported in past decade. MiR-16, miR-146a/b, miR-150, miR-155, and miR-223 were overexpressed in both the periphery and RA joints (14). miRNA expression levels also differ depending on the stage and activity of the disease (15). Serum miR-22 and miR-103a may predict RA development (16). Serum miR-223 levels have been associated with RA activity and disease relapse (17).

Microarray datasets for RA and OA synovial tissue samples provide a unique perspective for understanding the molecular mechanisms of the diseases (18) and facilitate the identification of potential target genes and pathways for targeted therapy. Due to the complexity of the genome, most of the genes thought to be involved in the pathogenesis of RA remain to be identified; thus, the present study aimed to investigate the molecular mechanisms and potential therapeutic targets of RA using bioinformatics analysis. Microarray data from the Gene Expression Omnibus (GEO) database was obtained and used to identify differentially expressed genes (DEGs) and differentially expressed miRNAs (DEMs) in RA compared with patients with OA. In addition, Gene Ontology (GO) analysis and Kyoto Encylopedia of Genes and Genomes (KEGG) pathway analysis was used to predict the functional enrichment of DEGs. Selected genes obtained from the bioinformatic analysis were subsequently experimentally verified in vitro. These findings may help identify potential diagnostic biomarkers and therapeutic targets of RA.

Materials and methods

Microarray data

Microarray datasets GSE55457, GSE55235 (19) and GSE72564 were downloaded from the GEO database (http://www.ncbi.nlm.nih.gov/geo), a public database containing gene expression profiles, chips and microarrays. GSE55457 and GSE55235 were composed of gene expression data using Affymetrix Human Genome U133A Array platform, whereas GSE72564 was performed using the Qiagen Human miRNome miScript miRNA PCR array platform. The GSE55457 dataset comprised the gene expression data of 10 synovial tissue samples from normal donors (ND), 13 synovial tissue samples from patients with RA and 10 synovial tissue samples from patients with OA; the GSE55235 dataset comprised the gene expression data of 10 synovial tissue samples from NDs, 10 synovial tissue samples from patients with RA and 10 synovial tissue samples for patients with OA; and the GSE72564 comprised of gene expression data of FLSs isolated from 4 patients with RA and 4 patients with OA, which were cultivated for 4 passages.

Identification of DEGs and DEMs

The DEGS in RA and OA samples of the three datasets were identified using GEO2R software (https://www.ncbi.nlm.nih.gov/geo/geo2r/). The cut-off values for DEG selection in the GSE55457 and GSE55235 datasets were P<0.05 and |log FC| >1.5. The expression of non-coding RNA is different from coding RNA. The number of DEMs is too small under the cut-off criteria of DEG. Thus P<0.05 and |log FC|>1 were used for the GSE72564 dataset. The hierarchical clustering of DEGs was performed using MeV 4.9.0 software (20). The intersections of DEGs in different microarrays were visualized using VENNY 2.1.0 software (21).

GO and KEGG pathway analysis of DEGs

To determine the biological processes, molecular functions and significantly altered metabolic pathways enriched by DEGs, DEGs were subjected to functional term enrichment analysis using The Database for Annotation, Visualization and Integrated Discovery (DAVID 6.8; http://david.abcc.ncifcrf.gov/) for GO enrichment analysis (P<0.05) and signaling pathway enrichment analysis using the KEGG database (P<0.05).

PPI network and module analysis

A protein-protein interaction (PPI) network of the DEGs was constructed using the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING 11.0; http://string-db.org/) database (22), with a threshold combined score of >0.4 identified as significant, to determine the molecular mechanisms that discriminate between RA and OA pathology. Cytoscape v3.7.2 (23) was used to visualize the PPI network. In the PPI network, the edges represent the predicted functional interactions, while the network nodes represent the proteins. The degree of the node was defined as the number of interactions with other nodes. The highest degree means the most ‘popular’ gene in the PPI network. Hub genes were defined as nodes with ≥25 degrees. Interrelation analysis between the hub genes and pathways was determined using the Cytoscape plug-in ClueGO (24). The molecular complex detection (MCODE) (25) plug-in of Cytoscape was used to detect pivotal modules that may represent molecular complexes in the PPI network, using a degree cut-off value of 10 and node number >4, which was presented using Cytoscape. KEGG pathway analysis of DEGs in modules was subsequently performed using DAVID.

miRNA and target mRNA network construction

Target mRNAs of DEMs were identified using starBase v2.0 (26) and target genes were predicted using five programs: microT v5.0 (27), miRmap (28), RNA22 (29), PicTar (30) and TargetScan 7.2 (31). Genes predicted by ≥3 databases were identified as target genes for the DEMs. Subsequently, the intersection genes of MCODE network and miRNA/mRNA networks were integrated to investigate the potential interactions between DEGs and DEMs.

Patient samples

All experiments involving patient samples were approved by the Clinical Research Ethics Committee of Xi'an Jiaotong University (approval no. XJTULAC-2018454). Written informed consent was obtained from all participants. Human synovium biopsies were obtained from patients with RA and OA undergoing total knee arthroplasty at Xi'an Honghui Hospital from March 2018 to April 2019, who fulfilled the diagnostic criteria of the American College of Rheumatology and had a Disease Activity Score 28-joint assessment of ≥3 (32). Synovial tissue of patients with OA were obtained as the controls. The clinicopathological features of the patients are presented in Table SI.

Reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from synovial tissues using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Total RNA (5 µg) was reverse transcribed into cDNA using the RevertAid First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.). Total RNA and primer were mixed and incubated at 65°C for 5 min. Reaction buffer RiboLock, dNTP MIX and RevertAid were mixed gently and centrifuged briefly. The mixture was incubated at 40°C for 60 min, 25°C for 5 min, finally heating at 70°C for 5 min for termination and stored at −20°C. qPCR was subsequently performed using a ChamQ Universal SYBR qPCR Master mix (Vazyme Biotech Co., Ltd.) according to the manufacturer's protocol, in a volume of 10 µl, and an Agilent StrataGene Mx3000P QPCR system (Agilent Technologies, Inc.). The following primer pairs used for the qPCR are listed in Table I. The following thermocycling conditions were used for the qPCR: Initial denaturation at 95°C for 10 min; and 45 cycles at 95°C for 10 sec, 60°C for 15 sec and 72°C for 30 sec. Expression levels were quantified using the 2−ΔΔCq method (33) and normalized to ACTB.

Table I.

Primers used for reverse transcription-quantitative PCR.

Table I.

Primers used for reverse transcription-quantitative PCR.

GenePrimer sequence (5′→3′)
PI3CGF: CACCCAAAAGCATATCCTAAGC
R: TAATGCAGAACATCATCGTCC
LCKF: GTGTGTGAGAACTGCCATTATC
R: GATTGGAGCCTTCGTAGGTAAC
ZAP70F: AGAGCTCTGCGAGTTCTACTC
R: TCTCGCAGGCAGTCGAAGA
LEPF: CATCAAGACAATTGTCACCAGG
R: GTCGTTGGATATTTGGATCACG
HGFF: AATCCACTCATTCCTTGGGATT
R: TCCCATTTACAACTCGCAATTG
CTLA4F: CAGTTAGTTCGGGGTTGTTTTT
R: TTTTCACATTCTGGCTCTGTTG
SERPINE1F: AACGTGGTTTTCTCACCCTAT
R: CAATCTTGAATCCCATAGCTGC
SDC1F: AAGATATCACCTTGTCACAGCA
R: GTTCTGGAGACGTGGGAATAG
NPY1RF: GAGGCGATGTGTAAGTTGAATC
R: ACCCAAATCACAGCAATACCTA
ACTBF: AAGGATTCCTATGTGGGCGAC
R: CGTACAGGGATAGCACAGCC

[i] F, forward; R, reverse. PI3CG, phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic sub-unit γ; LCK, LCK proto-oncogene Src family tyrosine kinase; ZAP70, ζ chain of T cell receptor-associated protein kinase 70; LEP, leptin; HGF, hepatocyte growth factor; CTLA4, cytotoxic T-lymphocyte associated protein 4; SERPINE1, serpin family E member 1; SDC, syndecan 2; NPY1R, neuropeptide Y receptor Y1; ACTB, β-actin.

Statistical analysis

Statistical analysis was performed using SPSS 20.0 software (IBM Corp.) and GraphPad Prism 7.0 software (GraphPad Software, Inc.). The experimental data are presented as the mean ± SD. Statistical differences between two groups were determined using a Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

Identification of DEGs and DEMs

According to the cut-off criteria (P<0.05 and |logFC|>1.5), data from each microarray was separately analyzed using GEO2R to identify DEGs in RA compared with OA (RA-OA). A total of 428 DEGs were identified in the GSE55457 dataset and 289 DEGs in the GSE55235 dataset (Fig. 1B). MeV software was used for hierarchical clustering and to generate expression heat maps (Fig. 1A). To investigate the identified DEGs, DEGs shared between the two datasets and the genes found to be independently expressed were selected (Fig. 1B). These 566 genes identified in the two datasets were defined as DEGs, and consisted of 280 upregulated DEGs (uDEGs) and 286 downregulated DEGs (dDEGs). In addition, 6 miRNAs were observed to be downregulated and 17 miRNAs were upregulated in the GSE72564 dataset (Table II).

Figure 1.

Identification of DEGs in RA and OA using datasets obtained from the Gene Expression Omnibus database. (A) Hierarchical clustering analysis and heat map of DEGs identified in the GSE55235 and GSE55457 datasets. Red indicates higher expression levels and green indicates lower expression levels. The blue and pink bar represents OA and RA samples, respectively. (B) Overlapping DEGs in the GSE55457 and GSE55235 datasets were identified. RA, rheumatoid arthritis; OA, osteoarthritis; DEGs, differentially expressed genes.

Table II.

Identification of the differentially expressed microRNAs in the GSE72564 dataset obtained from the Gene Expression Omnibus database.

Table II.

Identification of the differentially expressed microRNAs in the GSE72564 dataset obtained from the Gene Expression Omnibus database.

miRNA IDP-valueLog, fold change
hsa-miR-6700.001811.5375
hsa-miR-26a0.003652.0325
hsa-miR-21160.007451.8950
hsa-miR-6530.01371−1.2775
hsa-miR-190a0.022221.1625
hsa-miR-22760.02301−1.8875
hsa-miR-548b0.023361.5025
hsa-miR-5790.025511.2850
hsa-miR-4960.02800−1.0725
hsa-miR-13050.029611.7775
hsa-miR-30c0.029951.6525
hsa-miR-20b0.033231.1150
hsa-miR-42620.033941.1850
hsa-miR-42630.03396−1.0450
hsa-miR-5020.034501.1650
hsa-miR-12580.035401.4250
hsa-miR-7080.036722.1575
hsa-miR-11930.04084−1.4750
hsa-miR-12990.042561.6225
hsa-miR-2180.046712.7450
hsa-miR-3460.04710−1.0200
hsa-miR-31160.047841.1275
hsa-miR-499a0.049411.4275

[i] miR, microRNA.

GO term enrichment analysis and KEGG pathway analysis

To determine the functions of the identified DEGs, all DEGs were subjected to functional term enrichment analysis using DAVID; uDEGs were mostly enriched in biological process (BP), such as ‘Immune response’, ‘Chemokine-mediated signaling pathway’ and ‘Inflammatory response’, cellular component (CC), such as ‘External side of plasma membrane’ and ‘Plasma membrane’ and molecular function (MF), such as ‘Chemokine activity’ and ‘Transmembrane signaling receptor activity’. dDEGs were significantly enriched in BP, such as ‘Cell adhesion’ and ‘Chemical synaptic transmission’, CC, such as ‘Extracellular region’, ‘Extracellular space’ and ‘Extracellular matrix’ and MF, such as ‘Heparin binding’ and ‘Growth factor activity’ (Fig. 2A). The most significantly enriched signaling pathways of the uDEGs were identified as ‘Cytokine-cytokine receptor interaction’, ‘Chemokine signaling pathway’, ‘Hematopoietic cell lineage’, ‘Primary immunodeficiency’ and ‘Cell adhesion molecules (CAMs)’ (Fig. 2B). Only six downregulated pathways fulfiled the condition of P<0.05; these were ‘PPAR signaling pathway’, ‘Regulation of lipolysis in adipocytes’, ‘Dilated cardiomyopathy’, ‘Arrhythmogenic right ventricular cardiomyopathy (ARVC)’ and’ ECM-receptor interaction’ (Fig. 2B).

Figure 2.

GO analysis and KEGG pathway analysis of DEGs. Red bars indicate upregulated genes and green bars indicate downregulated genes. (A) GO functional term enrichment analysis of DEGs (top 5 in each category). (B) KEGG signaling pathway enrichment analysis of DEGs (top 10 in each category). DEG, differentially expressed genes; GO, Gene Ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

PPI network construction and module screening

The PPI network of DEGs, constructed using STRING and visualized using Cytoscape, consisted of 481 nodes and 1,728 edges (Fig. 3). The top 25 nodes with the highest degree were selected. Pathway crosstalk analysis of the top 22 nodes identified was performed through performing KEGG pathway analysis in ClueGO (Fig. 4), with P<0.05 as the cut-off criterion. A total of 17 of these 23 genes were found to be involved in inflammatory processes (Table III), with 11 identified as chemokines and their receptors, which are abundant in the peripheral blood and in the local inflamed joints of RA (34). Thus, five different hub genes were selected for further experimental validation: Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit γ (PIKC3G), lymphocyte-specific kinase (LCK), leptin (LEP), cytotoxic T-lymphocyte antigen (CTLA4) and ζ chain of T cell receptor associated protein kinase 70 (ZAP70). Module analysis was performed using the MCODE plug-in of Cytoscape and a total of 6 modules were selected using the previously mentioned criterion from the whole PPI network (Fig. 5). KEGG pathway enrichment analysis of these genes were performed using DAVID and the pathway analysis demonstrated that the selected genes in the modules were mostly enriched in the ‘Chemokine signaling pathway’, ‘Primary immunodeficiency’, ‘Proteoglycans in cancer’, ‘Wnt signaling pathway’ and ‘Asthma’ (Fig. 5).

Figure 3.

PPI and modules analysis of DEGs using the Search Tool for the Retrieval of Interacting Genes/Proteins database and Cytoscape software. A total of 6 modules were selected using a degree cut-off value of 10 and node number >4. Upregulated genes are marked in red and downregulated genes are marked in green. PPI, protein-protein interaction; DEGs, differentially expressed genes.

Figure 4.

Pathway crosstalk analysis of the top 25 nodes identified. Upregulated genes are marked in red and downregulated genes are marked in green. Pathway crosstalk analysis of the genes with highest degree was identified through performing KEGG pathway analysis in ClueGO. LCK, LCK proto-oncogene; ZAP70, ζ chain of T cell receptor-associated protein kinase 70; IL7R, interleukin 7 receptor; PTPRC, protein tyrosine phosphatase receptor type C; CXCL13, C-X-C motif chemokine ligand 13; LEP, leptin; CCL21, C-C motif chemokine ligand 21; CXCR4, C-X-C motif chemokine receptor 4; CXCL2, C-X-C motif chemokine ligand 2; PIK3CG, phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit γ; CXCL10, C-X-C motif chemokine ligand; STAT1, signal transducer and activator of transcription 1; CXCL9, C-X-C motif chemokine ligand 9; CXCL11, C-X-C motif chemokine ligand 11; CXCL8, C-X-C motif chemokine ligand 8; CCL20, C-C motif chemokine ligand 20; CCL5, C-C motif chemokine ligand 5; CXCL5, C-X-C motif chemokine ligand; CXCL1, C-X-C motif chemokine ligand; CTLA4, cytotoxic T-lymphocyte-associated protein 4; VEGF, vascular endothelial growth factor.

Figure 5.

Kyoto Encylopedia of Genes and Genomes pathway analysis of 5 of the top 25 genes identified. Six modules were selected. Ordinate represented-log (P-value) and the size of bubble represent the number of genes in each pathway.

Table III.

Hub genes with highest degree in protein-protein interaction networks and intersected genes in molecular complex detection analysis and microRNA/target genes.

Table III.

Hub genes with highest degree in protein-protein interaction networks and intersected genes in molecular complex detection analysis and microRNA/target genes.

Gene symbol (name)DegreePredicted expression level
CXCL8 (C-X-C motif chemokine ligand 8)78Upregulated
VEGFA (vascular endothelial growth factor A)64Upregulated
CXCR4 (C-X-C motif chemokine receptor 4)51Upregulated
PIK3CG (phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit γ)50Upregulated
CCL5 (C-C motif chemokine ligand 5)49Upregulated
LCK (LCK proto-oncogene, Src family tyrosine kinase)48Upregulated
LEP (leptin)43Downregulated
CXCL9 (C-X-C motif chemokine ligand 9)41Upregulated
CXCL10 (C-X-C motif chemokine ligand 10)41Upregulated
CXCL1 (C-X-C motif chemokine ligand 1)36Upregulated
ZAP70 (ζ chain of T cell receptor associated protein kinase 70)35Upregulated
CCL20 (C-C motif chemokine ligand 20)32Upregulated
IL7R (interleukin 7 receptor)31Upregulated
CXCL11 (C-X-C motif chemokine ligand 11)31Upregulated
CXCL13 (C-X-C motif chemokine ligand 13)30Upregulated
CXCL2 (C-X-C motif chemokine ligand 2)30Upregulated
HGF (hepatocyte growth factor)33Downregulated
CTLA4 (cytotoxic T-lymphocyte associated protein 4)29Upregulated
SERPINE1 (Serpin family E member 1)28Upregulated
CD69 (CD69 molecule)28Upregulated
SDC1 (syndecan 1)24Upregulated
CXCL3 (C-X-C motif chemokine ligand 3)23Upregulated
NPY1R (neuropeptide Y receptor Y1)22Downregulated
miRNA/mRNA network construction

The target genes were predicted using starBase and compared with DEGs to identify pivotal target mRNAs as potential biomarkers. Only the intersection was selected and visualized using Cytoscape (Fig. 6). The MCODE results and the miRNA/mRNA network were analyzed and a total of 6 genes were chosen as candidate genes (Table II), consisting of two dDEGs [hepatocyte growth factor (HGF) and neuropeptide Y receptor Y1 (NPY1R) and four uDEGs [CD69, serpin family E member 1 (SERPINE1), syndecan 1 (SDC1) and C-X-C motif chemokine ligand3 (CXCL)3].

Figure 6.

miRNA/mRNA network. Differentially expressed miRNAs are presented as blue diamonds. Upregulated DEGs are presented in red and downregulated DEGs are marked in green. DEGS, differentially expressed genes; miR/miRNA, microRNA.

Experimental validation

RT-qPCR was performed to verify the expression levels of the 9 candidate genes in OA and RA synovial tissue. The expression levels of CTLA4, ZAP70, LCK, PIK3CG, SERPINE1, SDC1, NPY1R in RA tissue compared with OA tissue were observed to be consistent with the predictions (Fig. 7). In addition, the experimental validation found that CTLA4, ZAP70 and LCK expression levels were significantly increased, whereas HGF expression levels were significantly decreased in RA synovial tissue compared with OA synovial tissue (P<0.05; Fig. 7).

Figure 7.

Reverse transcription-quantitative PCR results of the expression levels of identified candidate genes in samples from OA vs. RA. Expression levels of each gene was normalized to ACTB. *P<0.05, **P<0.01 vs. OA. OA, osteoarthritis; RA, rheumatoid arthritis. PI3KCG, phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic sub-unit γ; LCK, LCK proto-oncogene Src family tyrosine kinase; ZAP70, ζ chain of T cell receptor-associated protein kinase 70; LEP, leptin; HGF, hepatocyte growth factor; CTLA4, cytotoxic T-lymphocyte-associated protein 4; SERPINE1, serpin family E member 1; SDC1, syndecan 1; NPY1R, neuropeptide Y receptor Y1.

Discussion

Microarray and bioinformatic analysis is widely used to investigate the causes and underlying mechanisms of different types of disease (35), and gene expression profiling of rheumatoid arthritis (RA) has been conducted in numerous previous studies. Orange et al (36) Used RNA-seq of synovial tissue along with histologic analysis identified three distinct molecular subtypes of RA that correlated with specific clinical phenotypes.

In the present study, genome-wide transcriptomic datasets from the GEO database were used to identify DEGs in patients with RA or osteoarthritis (OA). Combining the data from the GSE55457 and GSE55235 dataset revealed that 566 genes were differentially expressed between OA and RA samples (280 genes were upregulated and 286 genes were downregulated). In addition, six miRNAs were found to be downregulated and 17 miRNAs were upregulated in the GSE72564 dataset.

GO functional term enrichment analysis indicated that upregulated (u)DEGs were mostly enriched in BP such as ‘Immune response’, CC such as ‘External side of plasma membrane’ and MF such as ‘Chemokine receptor activity’, whereas downregulated (d)DEGs were significantly enriched in ‘cell adhesion’ at the BP level, ‘Extracellular region’ at CC level and ‘heparin binding’ at the MF level. These findings are consistent with the previous studies that reported that immune responses and chemokine activity were vital processes for RA development and progression (37,38). KEGG signaling pathway enrichment analysis indicated that uDEGs were mostly enriched in ‘Cytokine-cytokine receptor interaction’ and ‘Chemokine signaling pathway’. A diverse range of cytokines have been observed to have important roles in the pathophysiological processes of RA, such as interleukin (IL)-1, IL-17 and tumor necrosis factor (TNF)-α (39). In fact, the development of therapeutic agents, such as rituximab and infliximab, which are targeted agents against cytokines or their receptors, have significantly increased the success rate for the treatment of the disease (40). The dDEGs were found to be enriched in the ‘PPAR signaling pathway’ and ‘Regulation of lipolysis in adipocytes’. Peroxisome proliferator activated receptors (PPARs) are transcription factors that belong to the nuclear receptor family (41) and they have been reported to inhibit the expression of matrix metalloproteinases (MMP) and the release of pro-inflammatory cytokines when exposed to IL-1β (42). Decreased PPAR activationmay promote FLSs proliferation and expression levels of c-Myc, Cyclin D1, MMP-1 and MMP-9 (43).

In addition, based on the PPI network constructed of the DEGs, the top 25 nodes with the highest degree were selected and pathway interactions of these genes were analyzed using ClueGO; this revealed that 17 of these genes were involved in the inflammatory process. Some of these genes identified in the present study have previously been attributed to the pathogenesis of RA; for example, 11 of them were chemokines and their receptors, including C-X-C motif chemokine ligand 1 (CXCL1), CXCL2, CXCL3, C-X-C motif chemokine receptor 4 (CXCR4), C-C motif chemokine ligand 5 (CCL5), CXCL8, CXCL9, CXCL10, CXCL11, CXCL13 and CCL20. Chemokines are divided into four classes depending on the location of the conserved cysteine in the protein molecule: C-X-C, C-C, C-X-3-C and X-C (44). Chemokines and their receptors control hemostasis during recirculation and promote the recruitment of immune cells during inflammation (45). Of note, the role of multiple chemokines and growth factors, such as vascular endothelial growth factor, in angiogenesis and the inflammatory response has been reported in RA (46). CXCL8, also known as IL-8, is the most commonly studied chemokine of the CXC subfamily and the expression levels of CXCL8 have been closely associated to the symptoms and disease activity of patients with RA (47). CCL20, also known as liver and activation-regulated chemokine, is one of the few known chemokine ligands that only pairs with a sole receptor, CCR6 (45). CCL20 is able to recruit CCR6+ mononuclear cells to the synovial fluid of patients with RA and has been found to be significantly neutralized with the addition of an anti-CCL20 antibody (48). CCL20 has also been reported to activate osteoblast proliferation and osteoclast differentiation, which may be maintain bone homeostasis in RA bone destruction (49). Furthermore, the blockade of inflammatory cytokines through biological agents, such as infliximab, inhibited the production of CCL20 (50). CCL5 is found to serve a positive role in leukocyte recruitment during inflammation (51). In addition, human RAFLS treated with CCL5 demonstrated significantly increased expression levels of MMP-1 and MMP-13, which resulted in the degradation of type I collagenase (52). The CXC subfamily are the predominant chemotactic cytokines of the neutrophils; CXCL10 and its receptor CXCR3, have been found to promote FLS invasion and joint erosion by increasing the expressing levels of receptor activator of nuclear factor-κ B ligand (RANKL) in CD4+ T cells in RA (53,54). Notably, it has been suggested that serum concentrations of CXCL9 and CXCL10 may also serve as sensitive biomarkers for RA (55).

PIK3CG has been demonstrated to serve an important role in proliferation, apoptosis and adhesion (56). In hTNF-α transgenic mice, reduced MMP-3 expression levels and invasive properties were observed in synovial fibroblasts in the absence of PIK3γ (57). In line with this observation, the pharmacological inhibition of PIK3CG was discovered to effectively alleviate chronic inflammation in RA (58). Thus, it is thought that the full therapeutic potential of selective PIK3γ inhibitors remains to be investigated.

LCK is a member of the Src family of protein tyrosine kinases (59), which is only expressed in T cells and natural killer (NK) cells, and is involved in T cell receptor-mediated T cell proliferation and differentiation (60). In the present study, LCK was observed to be significantly over-expressed in RA synovial tissue and the overexpression of LCK has been found to contribute to numerous autoimmune diseases, such as inflammatory bowel diseases and type I diabetes (59). Selective LCK inhibitors have been developed and have reported potential upon their application in inflammatory disorders, including RA (60). In addition, previous bioinformatical analysis indicated that LCK expression was increased in RA (61), which is consistent with what was observed in the present study, in which the aberrant expression of LCK was experimentally validated.

Leptin is one of the most important hormones and cytokines secreted by adipose tissue and the past decade of research has proven that leptin controls body weight by inhibiting food intake (62). As a cytokine, Leptin modulates inflammatory responses and the immune system by promoting Th1 cell activation and the production of pro-inflammatory cytokines, such as IL-6, IL-2 and TNF-α (63,64); however, the expression levels and role of Leptin in the pathogenesis of RA remains unclear. Some previous studies have observed higher expression levels of Leptin in the serum, synovial fluid and synovial tissue from patients with RA, which suggested that Leptin expression levels are related to disease activity (65,66). In contrast, other studies have reported no change in the expression levels of leptin and no correlation with disease activity (67), because the individual characteristics of patients such as age, race and body weight were inconsistent (66). Thus, further investigations on Leptin will help determine its mechanism of action and its potential as a treatment option in RA.

ZAP70, also known as SRK, encodes an enzyme belonging to the protein tyrosine kinase family. In a previous study, ZAP70+ B cells were identified as a biomarker of response to B cell depletion therapy in RA (68) and partial ZAP-70 deficiency was found to alter the balance between the activation and apoptotic processes of T cells (69). In the present study, ZAP70 was found to be significantly enriched in the NF-κB signaling pathway, which is a widely researched signaling pathway in RA. Meanwhile, CTLA-4 is a T cell surface glycoprotein, which helps prevent the development of autoimmune diseases through the inhibition of T cell activation (70).

The intersected genes in MCODE and target genes of miRNAs were selected for further experiment. In the present study, submodules in MCODE analysis were found to be associated with the ‘Chemokine signaling pathway’, ‘Primary immunodeficiency’, ‘Wnt signaling pathway’, ‘Asthma’ and ‘Proteoglycans in cancer’. HGF, SERPINE1, SDC1, NPY1R, CTLA4 and CXCL3 were selected as potential biomarkers. HGF has been discovered to stimulate hepatocyte proliferation, in addition to promoting proliferation, angiogenesis, anti-inflammatory and apoptotic processes in cells other than hepatocytes (71). SERPINE1 is a member of urokinase plasminogen activating system; increased expression levels of SERPINE1 have also been related to invasion and migration in head and neck cancer cells (72). Previous KEGG pathway analysis has indicated that SERPINE may be related to the HIF-1 signaling pathway, which alongside its downstream receptors, is activated in a hypoxic environment during RA (73); however, to the best of our knowledge, there are currently no studies published on the differential expression and function of SERPINE1 in the pathogenesis of RA. SDC1 is expressed in hepatocytes, epithelial cells and the endothelium, where it interacts with multiple chemokines and cytokines to regulate differentiation, migration and proliferation (74). In addition, SDC is a phenotypic marker and regulator of NKT17; in a previous study, SDC1 deficiency led to a significant expansion of NKT17 cells, which was detected by the increased expression levels of IL-17 (75). NPY1 is mediated by the NPY receptor subtypes 1R-6R (76). NPY accompanied with NPY1 receptor (NPY1R) and NPY2 receptor (NPY2R) are overexpressed in human OA cartilage, which results in chondrocyte hypertrophy and cartilage degradation (77). Increased expression levels of NPY1R have been found to regulate proliferation and metastasis in breast cancer (78). In the present study, NPY1R was discovered to be involved in the ‘regulation of lipolysis in adipocytes’ pathway.

The present study experimentally validated that PIK3CG, LCK, ZAP70, HGF, CTLA4, SERPINE1 exhibited consistent expression trends with the microarray datasets GSE55457 and GSE55235, whereas LEP, SDC-1 and NPY1R were downregulated, but PCR demonstrated them to be upregulated., which may be caused by disease activity and ethnic differences. LCK, ZAP70 and CTLA4 expression levels were observed to be overexpressed, whereas expression levels of HGF were significantly decreased in the RA synovium. Conversely, previous studies have reported significant increases in the expression levels of serum HGF in patients with RA (79), which is inconsistent with our findings. Therefore, further research is required to determine the role of HGF.

To conclude, transcriptome sequencing has been widely used for research into both cancer and autoimmune diseases. In the present study, bioinformatics methods were used to analyze the presence of DEGs in the synovial tissue of patients with RA compared with OA. The expression levels of LCK, ZAP70 and CTLA4 were found to be overexpressed, whereas HGF expression levels were significantly decreased in RA. These genes and their related signaling pathways may provide diagnostic biomarkers and future therapeutic targets for RA; however, only CTLA4, ZAP70, LCK and HGF were validated to be significantly differentially expressed in the synovial tissue of patients with RA, which indicated that experimental validation is necessary following bioinformatics analysis.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

The present study was supported by a grant from the National Natural Science Foundation of China (grant no. 81772410).

Availability of data and materials

The datasets analyzed during the current study are available from the GEO database (www.ncbi.nlm.nih.gov/gds/) with the accession nos. GSE55457, GSE55235 and GSE72564.

Authors' contributions

YA, XT and PX designed the experiments and wrote the manuscript; JTY collected the data and XYR performed the experimental validation and statistical analysis. YA wrote the manuscript All authors read and approved the final version and agreed to be accountable for all aspects of the work.

Ethics approval and consent to participate

The present study was approved by the Clinical Research Ethics Committee of Xi'an Jiaotong University (approval no. XJTULAC-2018454). Clinical information in this study was collected after obtaining written informed consent from all patients.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

RA

rheumatoid arthritis

OA

osteoarthritis

DEGs

differentially expressed genes

DEMs

differentially expressed microRNAs

GEO

Gene Expression Omnibus

GO

Gene Ontology

DAVID

The Database for Annotation, Visualization and Integrated Discovery

PPI

protein-protein interaction

STRING

Search Tool for the Retrieval of Interacting Genes

References

1 

Zhang Q, Dehaini D, Zhang Y, Zhou J, Chen X and Zhang L, Fang RH, Gao W and Zhang L: Neutrophil membrane-coated nanoparticles inhibit synovial inflammation and alleviate joint damage in inflammatory arthritis. Nat Nanotechnol. 13:3513–1190. 2018. View Article : Google Scholar

2 

Kikuchi H, Shimada W, Nonaka T, Ueshima S and Tanaka S: Significance of serine proteinase and matrix metalloproteinase systems in the destruction of human articular cartilage. Clin Exp Pharmacol Physiol. 23:885–889. 1996. View Article : Google Scholar : PubMed/NCBI

3 

Blits M, Jansen G, Assaraf YG, van de Wiel MA, Lems WF, Nurmohamed MT, van Schaardenburg D, Voskuyl AE, Wolbink GJ, Vosslamber S and Verweij CL: Methotrexate normalizes up-regulated folate pathway genes in rheumatoid arthritis. Arthritis Rheum. 65:2791–2802. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Scott DL, Wolfe F and Huizinga TW: Rheumatoid arthritis. Lancet. 376:1094–1108. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Xing R, Yang L, Jin Y, Sun L, Li C, Li Z, Zhao J and Liu X: Interleukin-21 induces proliferation and proinflammatory cytokine profile of fibroblast-like synoviocytes of patients with rheumatoid arthritis. Scand J Immunol. 83:64–71. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Zaga-Clavellina V, Parra-Covarrubias A, Ramirez-Peredo J, Vega-Sanchez R and Vadillo-Ortega F: The potential role of prolactin as a modulator of the secretion of proinflammatory mediators in chorioamniotic membranes in term human gestation. Am J Obstet Gynecol. 211:48.e1–e6. 2014. View Article : Google Scholar

7 

Mateen S, Zafar A, Moin S, Khan AQ and Zubair S: Understanding the role of cytokines in the pathogenesis of rheumatoid arthritis. Clin Chim Acta. 455:161–171. 2016. View Article : Google Scholar : PubMed/NCBI

8 

Kurowska W, Kuca-Warnawin EH, Radzikowska A and Maslinski W: The role of anti-citrullinated protein antibodies (ACPA) in the pathogenesis of rheumatoid arthritis. Cent Eur J Immunol. 42:390–398. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Sokolove J, Bromberg R, Deane KD, Lahey LJ, Derber LA, Chandra PE, Edison JD, Gilliland WR, Tibshirani RJ, Norris JM, et al: Autoantibody epitope spreading in the pre-clinical phase predicts progression to rheumatoid arthritis. PLoS One. 7:e352962012. View Article : Google Scholar : PubMed/NCBI

10 

Zhang W, Zhong B, Zhang C, Luo C and Zhan Y: miR-373 regulates inflammatory cytokine-mediated chondrocyte proliferation in osteoarthritis by targeting the P2X7 receptor. FEBS Open Bio. 8:325–331. 2018. View Article : Google Scholar : PubMed/NCBI

11 

Scanzello CR and Goldring SR: The role of synovitis in osteoarthritis pathogenesis. Bone. 51:249–257. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Trachana V, Ntoumou E, Anastasopoulou L and Tsezou A: Studying microRNAs in osteoarthritis: Critical overview of different analytical approaches. Mech Ageing Dev. 171:15–23. 2018. View Article : Google Scholar : PubMed/NCBI

13 

Lee YS and Dutta A: MicroRNAs in cancer. Annu Rev Pathol. 4:199–227. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Churov AV, Oleinik EK and Knip M: MicroRNAs in rheumatoid arthritis: Altered expression and diagnostic potential. Autoimmun Rev. 14:1029–1037. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Evangelatos G, Fragoulis GE, Koulouri V and Lambrou GI: MicroRNAs in rheumatoid arthritis: From pathogenesis to clinical impact. Autoimmun Rev. 18:1023912019. View Article : Google Scholar : PubMed/NCBI

16 

Lin J, Huo R, Xiao L, Zhu X, Xie J, Sun S, He Y, Zhang J, Sun Y, Zhou Z, et al: A novel p53/microRNA-22/Cyr61 axis in synovial cells regulates inflammation in rheumatoid arthritis. Arthritis Rheumatol. 66:49–59. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Dunaeva M, Blom J, Thurlings R and Pruijn G: Circulating serum miR-223-3p and miR-16-5p as possible biomarkers of early rheumatoid arthritis. Clin Exp Immunol. 193:376–385. 2018. View Article : Google Scholar : PubMed/NCBI

18 

Galligan CL, Baig E, Bykerk V, Keystone EC and Fish EN: Distinctive gene expression signatures in rheumatoid arthritis synovial tissue fibroblast cells: Correlates with disease activity. Genes Immun. 8:480–491. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Woetzel D, Huber R, Kupfer P, Pohlers D, Pfaff M, Driesch D, Häupl T, Koczan D, Stiehl P, Guthke R and Kinne RW: Identification of rheumatoid arthritis and osteoarthritis patients by transcriptome-based rule set generation. Arthritis Res Ther. 16:R842014. View Article : Google Scholar : PubMed/NCBI

20 

Saeed AI, Sharov V, White J, Li J, Liang W, Bhagabati N, Braisted J, Klapa M, Currier T, Thiagarajan M, et al: TM4: A free, open-source system for microarray data management and analysis. Biotechniques. 34:374–378. 2003. View Article : Google Scholar : PubMed/NCBI

21 

Oliveros JC: Venny. An interactive tool for comparing lists with Venn's diagrams, 2007. https://bioinfogp.cnb.csic.es/tools/venny/index.html

22 

Szklarczyk D, Gable Al, Lyon D, Junge A, Wyder S, Huerta-Cepas J, Simonovic M, Doncheva NT, Morris JH, Bork P, et al: STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 47(D1): D607–D613. 2019. View Article : Google Scholar : PubMed/NCBI

23 

Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B and Ideker T: Cytoscape: A software environment for integrated models of biomolecular interaction networks. Genome Res. 13:2498–2504. 2003. View Article : Google Scholar : PubMed/NCBI

24 

Bindea G, Mlecnik B, Hackl H, Charoentong P, Tosolini M, Kirilovsky A, Fridman WH, Pagès F, Trajanoski Z and Galon J: ClueGO: A Cytoscape plug-in to decipher functionally grouped gene ontology and pathway annotation networks. Bioinformatics. 25:1091–1093. 2009. View Article : Google Scholar : PubMed/NCBI

25 

Bader GD and Hogue CW: An automated method for finding molecular complexes in large protein interaction networks. BMC Bioinformatics. 4:22003. View Article : Google Scholar : PubMed/NCBI

26 

Li JH, Liu S, Zhou H, Qu LH and Yang JH: starBase v2.0: Decoding miRNA-ceRNA, miRNA-ncRNA and protein-RNA interaction networks from large-scale CLIP-Seq data. Nucleic Acids Res. 42((Database Issue)): D92–D97. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Paraskevopoulou MD, Georgakilas G, Kostoulas N, Vlachos IS, Vergoulis T, Reczko M, Filippidis C, Dalamagas T and Hatzigeorgiou AG: DIANA-microT web server v5.0: Service integration into miRNA functional analysis workflows. Nucleic Acids Res. 41((Web Server Issue)): W169–W173. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Vejnar CE and Zdobnov EM: MiRmap: Comprehensive prediction of microRNA target repression strength. Nucleic Acids Res. 40:11673–11683. 2012. View Article : Google Scholar : PubMed/NCBI

29 

Loher P and Rigoutsos I: Interactive exploration of RNA22 microRNA target predictions. Bioinformatics. 28:3322–3323. 2012. View Article : Google Scholar : PubMed/NCBI

30 

Krek A, Grün D, Poy MN, Wolf R, Rosenberg L, Epstein EJ, MacMenamin P, da Piedade I, Gunsalus KC, Stoffel M and Rajewsky N: Combinatorial microRNA target predictions. Nat Genet. 37:495–500. 2005. View Article : Google Scholar : PubMed/NCBI

31 

Agarwal V, Bell GW, Nam JW and Bartel DP: Predicting effective microRNA target sites in mammalian mRNAs. Elife. 4:2015. View Article : Google Scholar

32 

Buckley L, Guyatt G, Fink HA, Cannon M, Grossman J, Hansen KE, Humphrey MB, Lane NE, Magrey M, Miller M, et al: 2017 American college of rheumatology guideline for the prevention and treatment of glucocorticoid-induced osteoporosis. Arthritis Rheumatol. 69:1521–1537. 2017. View Article : Google Scholar : PubMed/NCBI

33 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

34 

Elemam NM, Hannawi S and Maghazachi AA: Role of chemokines and chemokine receptors in rheumatoid arthritis. Immunotargets Ther. 9:43–56. 2020. View Article : Google Scholar : PubMed/NCBI

35 

Wu S, Wu F and Jiang Z: Identification of hub genes, key miRNAs and potential molecular mechanisms of colorectal cancer. Oncol Rep. 38:2043–2050. 2017. View Article : Google Scholar : PubMed/NCBI

36 

Orange DE, Agius P, DiCarlo EF, Robine N, Geiger H, Szymonifka J, McNamara M, Cummings R, Andersen KM, Mirza S, et al: Identification of three rheumatoid arthritis disease subtypes by machine learning integration of synovial histologic features and RNA sequencing data. Arthritis Rheumatol. 70:690–701. 2018. View Article : Google Scholar : PubMed/NCBI

37 

Wigerblad G, Bas DB, Fernades-Cerqueira C, Krishnamurthy A, Nandakumar KS, Rogoz K, Kato J, Sandor K, Su J, Jimenez-Andrade JM, et al: Autoantibodies to citrullinated proteins induce joint pain independent of inflammation via a chemokine-dependent mechanism. Ann Rheum Dis. 75:730–738. 2016. View Article : Google Scholar : PubMed/NCBI

38 

Firestein GS and Mcinnes IB: Immunopathogenesis of rheumatoid arthritis. Immunity. 46:183–196. 2017. View Article : Google Scholar : PubMed/NCBI

39 

Kuwabara T, Ishikawa F, Kondo M and Kakiuchi T: The role of IL-17 and related cytokines in inflammatory autoimmune diseases. Mediators Inflamm. 2017:39080612017. View Article : Google Scholar : PubMed/NCBI

40 

Siebert S, Tsoukas A, Robertson J and Mcinnes I: Cytokines as therapeutic targets in rheumatoid arthritis and other inflammatory diseases. Pharmacol Rev. 67:280–309. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Kwon EJ, Park EJ, Choi S, Kim SR, Cho M and Kim J: PPARγ agonist rosiglitazone inhibits migration and invasion by downregulating Cyr61 in rheumatoid arthritis fibroblast-like synoviocytes. Int J Rheum Dis. 20:1499–1509. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Fahmi H, Pelletier JP, Di Battista JA, Cheung HS, Fernandes JC and Martel-Pelletier J: Peroxisome proliferator-activated receptor gamma activators inhibit MMP-1 production in human synovial fibroblasts likely by reducing the binding of the activator protein 1. Osteoarthr Cartilage. 10:100–108. 2002. View Article : Google Scholar

43 

Li XF, Sun YY, Bao J, Chen X, Li YH, Yang Y, Zhang L, Huang C, Wu BM, Meng XM and Li J: Functional role of PPAR-γ on the proliferation and migration of fibroblast-like synoviocytes in rheumatoid arthritis. Sci Rep. 7:126712017. View Article : Google Scholar : PubMed/NCBI

44 

Zhebrun DA, Totolyan AA, Maslyanskii AL, Titov AG, Patrukhin AP, Kostareva AA and Gol'tseva IS: Synthesis of some CC chemokines and their receptors in the synovium in rheumatoid arthritis. Bull Exp Biol Med. 158:192–196. 2014. View Article : Google Scholar : PubMed/NCBI

45 

Lee AY and Körner H: CCR6 and CCL20: Emerging players in the pathogenesis of rheumatoid arthritis. Immunol Cell Biol. 92:354–358. 2014. View Article : Google Scholar : PubMed/NCBI

46 

Su CM, Hsu CJ, Tsai CH, Huang CY, Wang SW and Tang CH: Resistin promotes angiogenesis in endothelial progenitor cells through inhibition of MicroRNA206: Potential implications for rheumatoid arthritis. Stem Cells. 33:2243–2255. 2015. View Article : Google Scholar : PubMed/NCBI

47 

Kraan MC, Patel DD, Haringman JJ, Smith MD, Weedon H, Ahern MJ, Breedveld FC and Tak PP: The development of clinical signs of rheumatoid synovial inflammation is associated with increased synthesis of the chemokine CXCL8 (interleukin-8). Arthritis Res. 3:65–71. 2001. View Article : Google Scholar : PubMed/NCBI

48 

Tanida S, Yoshitomi H, Nishitani K, Ishikawa M, Kitaori T, Ito H and Nakamura T: CCL20 produced in the cytokine network of rheumatoid arthritis recruits CCR6+ mononuclear cells and enhances the production of IL-6. Cytokine. 47:112–118. 2009. View Article : Google Scholar : PubMed/NCBI

49 

Lisignoli G, Piacentini A, Cristino S, Grassi F, Cavallo C, Cattini L, Tonnarelli B, Manferdini C and Facchini A: CCL20 chemokine induces both osteoblast proliferation and osteoclast differentiation: Increased levels of CCL20 are expressed in subchondral bone tissue of rheumatoid arthritis patients. J Cell Physiol. 210:798–806. 2007. View Article : Google Scholar : PubMed/NCBI

50 

Kawashiri SY, Kawakami A, Iwamoto N, Fujikawa K, Aramaki T, Tamai M, Arima K, Kamachi M, Yamasaki S, Nakamura H, et al: Proinflammatory cytokines synergistically enhance the production of chemokine ligand 20 (CCL20) from rheumatoid fibroblast-like synovial cells in vitro and serum CCL20 is reduced in vivo by biologic disease-modifying antirheumatic drugs. J Rheumatol. 36:2397–2402. 2009. View Article : Google Scholar : PubMed/NCBI

51 

Luterek-Puszyńska K, Malinowski D, Paradowska-Gorycka A, Safranow K and Pawlik A: CD28, CTLA-4 and CCL5 gene polymorphisms in patients with rheumatoid arthritis. Clin Rheumatol. 36:1129–1135. 2017. View Article : Google Scholar : PubMed/NCBI

52 

Agere SA, Akhtar N, Watson JM and Ahmed S: RANTES/CCL5 induces collagen degradation by activating MMP-1 and MMP-13 expression in human rheumatoid arthritis synovial fibroblasts. Front Immunol. 8:13412017. View Article : Google Scholar : PubMed/NCBI

53 

Toyoda Y, Tabata S, Kishi J, Kuramoto T, Mitsuhashi A, Saijo A, Kawano H, Goto H, Aono Y, Hanibuchi M, et al: Thymidine phosphorylase regulates the expression of CXCL10 in rheumatoid arthritis fibroblast-like synoviocytes. Arthritis Rheumatol. 66:560–568. 2014. View Article : Google Scholar : PubMed/NCBI

54 

Laragione T, Brenner M, Sherry B and Gulko PS: CXCL10 and its receptor CXCR3 regulate synovial fibroblast invasion in rheumatoid arthritis. Arthritis Rheum. 63:3274–3283. 2011. View Article : Google Scholar : PubMed/NCBI

55 

Kuan WP, Tam LS, Wong CK, Ko FW, Li T, Zhu T and Li EK: CXCL 9 and CXCL 10 as Sensitive markers of disease activity in patients with rheumatoid arthritis. J Rheumatol. 37:257–264. 2010. View Article : Google Scholar : PubMed/NCBI

56 

Sasaki T, Irie-Sasaki J, Jones RG, Oliveira-dos-Santos AJ, Stanford WL, Bolon B, Wakeham A, Itie A, Bouchard D, Kozieradzki I, et al: Function of PI3Kgamma in thymocyte development, T cell activation, and neutrophil migration. Science. 287:1040–1046. 2000. View Article : Google Scholar : PubMed/NCBI

57 

Hayer S, Pundt N, Peters MA, Wunrau C, Kühnel I, Neugebauer K, Strietholt S, Zwerina J, Korb A, Penninger J, et al: PI3Kgamma regulates cartilage damage in chronic inflammatory arthritis. FASEB J. 23:4288–4298. 2009. View Article : Google Scholar : PubMed/NCBI

58 

Camps M, Rückle T, Ji H, Ardissone V, Rintelen F, Shaw J, Ferrandi C, Chabert C, Gillieron C, Françon B, et al: Blockade of PI3Kgamma suppresses joint inflammation and damage in mouse models of rheumatoid arthritis. Nat Med. 11:936–943. 2005. View Article : Google Scholar : PubMed/NCBI

59 

Kumar Singh P, Kashyap A and Silakari O: Exploration of the therapeutic aspects of Lck: A kinase target in inflammatory mediated pathological conditions. Biomed Pharmacother. 108:1565–1571. 2018. View Article : Google Scholar : PubMed/NCBI

60 

Farag AK, Elkamhawy A, Londhe AM, Lee KT, Pae AN and Roh EJ: Novel LCK/FMS inhibitors based on phenoxypyrimidine scaffold as potential treatment for inflammatory disorders. Eur J Med Chem. 141:657–675. 2017. View Article : Google Scholar : PubMed/NCBI

61 

Xiong Y, Mi BB, Liu MF, Xue H, Wu QP and Liu GH: Bioinformatics analysis and identification of genes and molecular pathways involved in synovial inflammation in rheumatoid arthritis. Med Sci Monitor. 25:2246–2256. 2019. View Article : Google Scholar

62 

Procaccini C, Pucino V, Mantzoros CS and Matarese G: Leptin in autoimmune diseases. Metabolism. 64:92–104. 2015. View Article : Google Scholar : PubMed/NCBI

63 

La Cava A: Leptin in inflammation and autoimmunity. Cytokine. 98:51–58. 2017. View Article : Google Scholar : PubMed/NCBI

64 

Batún-Garrido JAJ, Salas-Magaña M, Juárez-Rojop IE, Hernández-Núñez E and Olán F: Relationship between leptin concentrations and disease activity in patients with rheumatoid arthritis. Med Clin (Barc). 150:341–344. 2018.(In English, Spanish). View Article : Google Scholar : PubMed/NCBI

65 

Tian G, Liang JN, Wang ZY and Zhou D: Emerging role of leptin in rheumatoid arthritis. Clin Exp Immunol. 177:557–570. 2014. View Article : Google Scholar : PubMed/NCBI

66 

Toussirot É, Michel F, Binda D and Dumoulin G: The role of leptin in the pathophysiology of rheumatoid arthritis. Life Sci. 140:29–36. 2015. View Article : Google Scholar : PubMed/NCBI

67 

Toussirot E, Grandclément E, Gaugler B, Michel F, Wendling D, Saas P and Dumoulin G; CBT-506: Serum adipokines and adipose tissue distribution in rheumatoid arthritis and ankylosing spondylitis. A comparative study. Front Immunol. 4:4532013. View Article : Google Scholar : PubMed/NCBI

68 

Gremese E, Tolusso B, Fedele AL, Canestri S, Alivernini S and Ferraccioli G: ZAP-70+ B cell subset influences response to B cell depletion therapy and early repopulation in rheumatoid arthritis. J Rheumatol. 39:2276–2285. 2012. View Article : Google Scholar : PubMed/NCBI

69 

Kugyelka R, Prenek L, Olasz K, Kohl Z, Botz B, Glant TT, Berki T and Boldizsár F: ZAP-70 regulates autoimmune arthritis via alterations in T cell activation and apoptosis. Cells. 8(pii): E5042019. View Article : Google Scholar : PubMed/NCBI

70 

Romo-Tena J, Gómez-Martín D and Alcocer-Varela J: CTLA-4 and autoimmunity: New insights into the dual regulator of tolerance. Autoimmun Rev. 12:1171–1176. 2013. View Article : Google Scholar : PubMed/NCBI

71 

Molnarfi N, Benkhoucha M, Funakoshi H, Nakamura T and Lalive PH: Hepatocyte growth factor: A regulator of inflammation and autoimmunity. Autoimmun Rev. 14:293–303. 2015. View Article : Google Scholar : PubMed/NCBI

72 

Pavón MA, Arroyo-Solera I, Céspedes MV, Casanova I, León X and Mangues R: uPA/uPAR and SERPINE1 in head and neck cancer: Role in tumor resistance, metastasis, prognosis and therapy. Oncotarget. 7:57351–57366. 2016. View Article : Google Scholar : PubMed/NCBI

73 

Deng W, Feng X, Li X, Wang D and Sun L: Hypoxia-inducible factor 1 in autoimmune diseases. Cell Immunol. 303:7–15. 2016. View Article : Google Scholar : PubMed/NCBI

74 

Teng YH, Aquino RS and Park PW: Molecular functions of syndecan-1 in disease. Matrix Biol. 31:3–16. 2012. View Article : Google Scholar : PubMed/NCBI

75 

Jaiswal AK, Sadasivam M and Hamad ARA: Unexpected alliance between syndecan-1 and innate-like T cells to protect host from autoimmune effects of interleukin-17. World J Diabetes. 9:220–225. 2018. View Article : Google Scholar : PubMed/NCBI

76 

Bedoui S, Miyake S, Lin Y, Miyamoto K, Oki S, Kawamura N, Beck-Sickinger A, von Hörsten S and Yamamura T: Neuropeptide Y (NPY) suppresses experimental autoimmune encephalomyelitis: NPY1 receptor-specific inhibition of autoreactive Th1 responses in vivo. J Immunol. 171:3451–3458. 2003. View Article : Google Scholar : PubMed/NCBI

77 

Kang X, Qian Z, Liu J, Feng D, Li H, Zhang Z, Jin X, Ma Z, Xu M, Li F, et al: Neuropeptide Y acts directly on cartilage homeostasis and exacerbates progression of osteoarthritis through NPY2R. J Bone Miner Res. Feb 26–2020.(Epub ahead of print). View Article : Google Scholar

78 

Liu L, Xu Q, Cheng L, Ma C, Xiao L, Xu D, Gao Y, Wang J and Song H: NPY1R is a novel peripheral blood marker predictive of metastasis and prognosis in breast cancer patients. Oncol Lett. 9:891–896. 2015. View Article : Google Scholar : PubMed/NCBI

79 

Kara F, Yildirim A, Gumusdere M, Karatay S, Yildirim K and Bakan E: Association between hepatocyte growth factor (HGF) gene polymorphisms and serum HGF levels in patients with rheumatoid arthritis. Eurasian J Med. 46:176–185. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Aihaiti Y, Tuerhong X, Ye JT, Ren XY and Xu P: Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis. Mol Med Rep 22: 3513-3524, 2020.
APA
Aihaiti, Y., Tuerhong, X., Ye, J., Ren, X., & Xu, P. (2020). Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis. Molecular Medicine Reports, 22, 3513-3524. https://doi.org/10.3892/mmr.2020.11406
MLA
Aihaiti, Y., Tuerhong, X., Ye, J., Ren, X., Xu, P."Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis". Molecular Medicine Reports 22.4 (2020): 3513-3524.
Chicago
Aihaiti, Y., Tuerhong, X., Ye, J., Ren, X., Xu, P."Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis". Molecular Medicine Reports 22, no. 4 (2020): 3513-3524. https://doi.org/10.3892/mmr.2020.11406
Copy and paste a formatted citation
x
Spandidos Publications style
Aihaiti Y, Tuerhong X, Ye JT, Ren XY and Xu P: Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis. Mol Med Rep 22: 3513-3524, 2020.
APA
Aihaiti, Y., Tuerhong, X., Ye, J., Ren, X., & Xu, P. (2020). Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis. Molecular Medicine Reports, 22, 3513-3524. https://doi.org/10.3892/mmr.2020.11406
MLA
Aihaiti, Y., Tuerhong, X., Ye, J., Ren, X., Xu, P."Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis". Molecular Medicine Reports 22.4 (2020): 3513-3524.
Chicago
Aihaiti, Y., Tuerhong, X., Ye, J., Ren, X., Xu, P."Identification of pivotal genes and pathways in the synovial tissue of patients with rheumatoid arthritis and osteoarthritis through integrated bioinformatic analysis". Molecular Medicine Reports 22, no. 4 (2020): 3513-3524. https://doi.org/10.3892/mmr.2020.11406
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team