This article is mentioned in:

Introduction

Endometriosis is a progressive disease that critically impacts the physical and psychological health of females. Endometriosis may also lead to, or be a cause of, infertility. The symptoms of endometriosis can only be temporarily improved, and endometriosis has a high reoccurrence rate (1). Therefore, it is of great clinical significance and social value to develop drugs with novel mechanisms and improved efficacy for endometriosis treatment. Immunological tolerance is involved in the paroxysm of endometriosis, and would be induced because the ectopic endometrium is not eliminated by the immune system (2). Enhanced macrophage activity and attenuated cellular immune function are commonly observed in endometriosis, particularly including the dysfunction of the cytotoxic reaction mediated by T cells and natural killer cells. The factors released by macrophages, including prostaglandins, cytokines and growth factors, may induce ectopic endometrium growth. These results indicated that ectopic endometrial growth may be inhibited by decreasing macrophage activity (3).

PPARγ is involved in multiple physiological and pathological processes, including lipid metabolism, glucose metabolism, cell proliferation and differentiation, tumorigenesis, inflammation, and immune responses. Recently, the effects of PPARγ on gynecological disease have gained increasing amounts of attention. PPARγ is expressed in the endometrium (4), and activating PPARγ may lead to inflammatory inhibition and anti-angiogenesis effects (5). As endometriosis is associated with inflammation and angiogenesis, PPARγ may become a novel target for endometriosis treatment (6). Liu et al (7) reported that macrophage activity and proliferation was inhibited by PPARγ endogenous ligands in a dose-dependent manner (7). Additionally, the inhibitory effect of PPARγ activation on ectopic endometrial growth is associated with the inhibition of the activity and proliferation of macrophages within the endometriosis lesion (4). Rosiglitazone (RSG), a PPARγ agonist, not only inhibits the progress of endometriosis (8), but also reduces the symptoms (9).

The present study examine the effects of RSG on the development and progression of endometriosis in a rat model. The results presented here will allow for deeper understanding of the mechanism of endometriosis, its treatment, and the identification of improved clinical diagnostic markers.

Materials and methods

Ethic statements

All animal experiments were authorized by the Ethical Committee of The First Affiliated Hospital of Nanchang University and performed following the guidelines for the care and use of laboratory animals and the principles of laboratory animal care and protection.

Preparation of an endometriosis model in rats

Female rats (n=30; weight ~220 g; 3 months) were purchased from Hunan SJA Laboratory Animal Co., Ltd and housed in a specific pathogen-free environment that was automatically maintained at a temperature of 23±2°C, a relative humidity of 45–65%, and with a controlled 12 h light/dark cycle. The animals had free to access food and water. The endometriosis model was prepared as previously described (10). The estrous cycles of rats were confirmed by vaginal smears. The rats in estrus were anesthetized by isoflurane (5%) and fixed on the operating table. Iodophor was uniformly smeared over the abdomen, which was then cut open to locate the uterus. Two sides of the uterus were ligated, along with the vessels, by twine and ~1 cm was left in the middle. This 1-cm section of tissue was cut using scissors and placed in a sterile culture dish containing normal saline. The endometrium was removed using sterile microscopic tweezers and cut into fragments measuring 5×5 mm. These fragments were attached to the abdominal wall. The incision was stitched and smeared with iodophor. Rats were places onto heating pads to regain consciousness quickly.

Experimental groups

Following the induction of endometriosis, the rats were allowed to recover for 4 weeks, during which time they were not administered with any medication. Subsequently, 30 rats were divided into the following five experimental groups: Model, saline (equal volume of normal saline for each rat); 5 µM RSG; 10 µM RSG; and 20 µM RSG. The abdomen of each rat was cut open and the corresponding treatments were administered via one-time treatment by injection directly into endometriotic implant (100 µl) following anesthesia with isoflurane (5% induction, 2% maintenance). The wounds were stitched up and smeared with iodophor, and the animals were sacrificed 2 weeks after the administration through decapitation following anesthesia with isoflurane.

Hematoxylin & eosin (H&E) staining

Endometrium was collected from each animal and fixed in in 4% paraformaldehyde for ~1 week at 4°C. Subsequently, the tissues were washed with sterile water for a couple of hours. The tissue was dehydrated using 70, 80 and 90% ethanol solutions successively and mixed with equal quantities of ethanol and xylene. After 15 min incubation, the tissue was mixed with an equal quantity of xylene for 15 min. These steps were repeated until the tissue appeared transparent. The tissue was then embedded in paraffin at room temperature for 5 min and sectioned at a thickness of 10 µm, and stained with H&E for 3 min at room temperature. Images were acquired using an inverted microscope (magnification, ×200; Olympus Corporation).

Transmission electron microscopy

The endometrium was collected after the animals were executed and was fixed with 2.5% glutaraldehyde for over 2 h at room temperature and washed with 0.1 M phosphoric acid solution three times. Next, the tissues were fixed with 1% osmic acid for 2–3 h at room temperature and washed with 0.1 M phosphoric acid three times. The tissues were then washed with 50% ethyl alcohol, 70% ethyl alcohol, 90% ethyl alcohol, 90% ethyl alcohol and 90% acetone (v:v=1:1), and 90% acetone successively for 15–20 min. Next, the tissues were incubated with 100% acetone at room temperature three times for 15–20 min each. Acetone (100%) and the embedding solution were incubated with the tissues for 3–4 h at room temperature. Finally, the tissues were successively embedded in 0.01% epoxy resin at 37°C overnight, 45°C for 12 h, and 60°C for 48 h. The solid tissue was cut into ultrathin sections (100 nm) and the slides were stained with lead citrate and uranyl acetate at room temperature for 5 min. Ultrastructural endometrium changes were observed and images were captured using transmission electron microscopy (magnification: ×1,000; JEM-1230; JEOL, Ltd.).

Immunohistochemistry

The endometrium was separated and fixed in 4% paraformaldehyde for ~1 week at 4°C. The tissues were placed into a plate filled with pre-cooled normal saline. The tissue was embedded in paraffin, sectioned into 20 µm. The sections were blocking in 5% bovine serum albumin (Hyclone; Cytiva) at room temperature for 2 h and incubated with anti-cleaved caspase-3 antibody (dilution, 1:200; cat. no. ab32042; Abcam) and anti-VEGF antibody (dilution, 1:1,000; cat. no. bs-10853R; Bioss) at 4°C overnight. Samples were then washed with phosphate-buffered saline (PBS), and the slides were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (1:10,000; cat. no. A16104; Thermo Fisher Scientific, Inc.) at 37°C for 30 min. After washing with PBS, the slides were dyed with DAB agent for 5–10 min and re-dyed with hematoxylin for 3 min, both at room temperature. Images were obtained using an inverted microscope (magnification, ×200; Olympus Corporation).

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA from the collected endometrium cells was obtained using an RNA Extraction kit (Takara Biotechnology Co., Ltd.) and according to the manufacturer's protocols. Extracted RNA was quantified using a NanoDrop spectrophotometer (NanoDrop Technologies). cDNA was synthesized at 30°C for 10 min according to the instructions of the reverse transcriptase kit (CoWin Biosciences). SYBR Premix Ex Taq™ (Takara Biotechnology Co., Ltd.) and an Applied Bio-Rad CFX96 Sequence Detection system (Applied Biosystems) was used for real-time PCR. The cycling protocol was as follows: Pre-denaturation at 95°C for 10 min, 40 cycles of 95°C for 12 sec, 58°C for 30 sec and 72°C for 30 sec. PPARγ and MAT2A expression levels were determined by the threshold cycle (Ct), and relative expression levels were calculated using the 2−ΔΔCq method after normalization with reference to the expression of U6 small nuclear RNA (11). GAPDH expression levels were used as negative controls. Primer information is listed in Table I.

Table I. Primer sequences.

Table I.

Primer sequences.

Genes	Sequences (5′-3′)	Length of the primer (bp)	Length of the product (bp)	Annealing temperature (°C)
PPARγ F	CCCAGGTTTGCTGAATGTG	18	197	57.8
PPARγ R	TGTCTGTCTCCGTCTTCTTGAT	20
MAT2A F	TTGTGCCTGCGAAATACCT	19	102	57
MAT2A R	CCCCAACCGCCATAAGT	17
GAPDH F	CAATGACCCCTTCATTGACC	20	106	57.2
GAPDH R	GAGAAGCTTCCCGTTCTCAG	20

Western blot analysis

The Nuclear and Cytoplasmic Protein Extraction kit (Beyotime Institute of Biotechnology) was used to isolate proteins from the tissues. After determining the concentration using the BCA method, approximately 35 µg protein per lane was separated on 12% SDS-polyacrylamide gels. The separated proteins were transferred onto a polyvinylidene difluoride (PVDF) membrane (EMD Millipore). The membrane was blocked with 5% skimmed dry milk in TBST (Tris buffered saline/0.1% Tween-20, pH 7.4) for 1 h at room temperature and incubated overnight with primary rabbit anti-human antibodies against PPARγ (cat. no. AF6284; Affinity Biosciences; dilution 1:1,500) and MAT2A (cat. no. ab189208, Abcam; dilution 1:1,000). A horseradish peroxidase-conjugated antibody against rabbit IgG (cat. no. ZB-2305, OriGene Technologies, Inc.; dilution 1:5,000) was used as a secondary antibody. Blots were incubated with ECL reagents (Beyotime Institute of Biotechnology) and exposed using a Tanon 5200-multi to detect protein expression.

Statistical analysis

The data are expressed as the mean and standard deviation with six repeats. Statistically significant differences for continuous variables were determined using a one-way analysis of variance with the least significant difference test for normally distributed data. All testing was performed using GraphPad Prism 5 software (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

Effects of RSG on the pathological states of the endometrium

The endometriosis rat model in each group is shown in Fig. 1. Compared with the model group, the tumor weight in the RGS group was significantly decreased (vs. model; P<0.05). This decrease was more significant at 10 and 20 µM doses of RSG.

Figure 1. Endometriosis rat models in each treatment group. (A) Endometriosis-related morphological changes. (B) Representative images of tumors; scale bar, 8 mm. (C) Quantitative data of the tumor weight. *P<0.05, vs. model group.

To investigate the impact of RSG on the pathological changes of endometria extracted from experimental rats, H&E staining was performed. Three RSG dosages were used: 5, 10 and 20 µM. Transparent and red nodules were observed in the model group, and vasoganglion were present all over the nodules (Fig. 2). Columnar shaped endometrial epithelial hyperplasia was observed in the model and saline groups. Increased numbers of interstitial cells, with compact structure and abundant blood supply, were detected in model and NS groups. Compared with the model group, incomplete epithelial structure with sparse interstitial cells and loose structure was observed in the pathological images from RSG-treated groups. Inflammatory cells were involved in the tissues, and mainly included neutrophil granulocytes. The cells were filled with edema, with poor blood supply. The gland was filled with more vacuolar cells. These pathological results indicated that the endometrium was notably damaged by different RSG dosages.

Figure 2. Hematoxylin and eosin staining of ectopic endometrial tissue from rats in each group. Scale bar=100 µm; magnification, ×200 (n=6).

Effects of RSG on the physiological structure of the endometrium

To investigate the effects of RSG on the growth of the endometrium, the subcellular structure in the tissues was observed using transmission electron microscopy. The results demonstrated that the tissue structure was integrated in the model and saline-treated groups (Fig. 3). Numerous vacuoles were formed within the endometrial tissue and classical morphological changes in apoptotic cells were observed in the RSG-treated groups.

Figure 3. Transmission electron microscopy images of ectopic endometrial tissue from rats in each group. Arrows indicate pathological changes.

Effects of RSG on VEGF and caspase-3 expression levels in the endometrium

To further investigate the potential mechanism of RSG on endometriosis, VEGF and cleaved caspase-3 expression levels were assessed by immunohistochemistry. As shown in Fig. 4, compared with the model group, expression of VEGF in endometria from rats treated with different RSG dosages decreased significantly (vs. model; P<0.05) and caspase-3 expression increased (vs. model; P<0.05; Fig. 4).

Figure 4. Effects of RSG on VEGF and caspase-3 expression in the endometrium. (A) VEGF expression was detected by immunohistochemistry in ectopic endometrium tissue from rats in each group. (B) Caspase-3 expression was detected by immunohistochemistry in ectopic endometrial tissue from rats in each group. (C) Quantitative VEFG and caspase-3 expression. *P<0.05, vs. model group. RSG, rosiglitazone.

Effects of RSG on PPARγ and MAT2A expression levels in the endometrium

To investigate the effects of RSG on the endometriosis at the molecular level, the expression of MAT2A, a major clinical biomarker for endometriosis, was assessed using RT-qPCR and western blotting. Compared with the model group, the PPARγ expression in the endometria of rats treated with RSG increased significantly (vs. model, P<0.05; Fig. 5). These results indicated that RSG, which is a PPARγ agonist, may upregulate PPARγ expression in this tissue. By contrast, MAT2A expression was decreased in the endometrium of rats treated with RSG, compared with that observed in the model group (P<0.05).

Figure 5. Effects of RSG on PPARγ and MAT2A expression levels in the endometrium. (A) PPARγ and MAT2A expression levels in ectopic endometrial tissue from rats in each group were detected by reverse transcription-quantitative polymerase chain reaction. (B) PPARγ and MAT2A expression in ectopic endometrial tissue from rats in each group were detected by western blot analysis. *P<0.05, vs. model group. RSG, rosiglitazone.

Discussion

Numerous factors, including immunoreactions, inflammation and angiogenesis, contribute toward the development and progression of endometriosis (12). Therapeutically, the formation and progression of endometriosis may be inhibited by regulating these factors (13,14). Given the difficulties and limits to reflecting the integrity of biological processes, including endometriosis, in isolated cells, a rat endometriosis model was utilized in this study (10). This approach enabled the assessment of the general pattern of transplanted endometrial growth in the abdomen, and investigation of the optimal action time of drugs by observing the dynamic pathological and structural changes in the endometrium of the endometriosis animal model. SD rats were selected because of their fast reproductive cycle and high level of homology with humans. Endometriosis was established in rats by transplanting the endometrium to their abdominal wall. Clear endometriosis lesions, including protuberances, were observed in the abdomen. Along with variations in H&E staining results in the endometrium tissues, the results of the present study indicated that the endometriosis model was successfully established in SD rats.

PPARγ agonists are potential inhibitors of cell proliferation (15) and may induce apoptosis (16). PPARγ agonists also exert anti-angiogenesis properties by downregulating the expression of vascular growth factors (17). Research using the endometriosis animal model revealed that application of the RSG PPARγ agonist may significantly inhibit angiogenesis within the endometrium and shrink endometriosis lesions (8,18,19). In the present study, to investigate the impact of RSG on endometriosis, an endometriosis model was successfully established in rats. The results indicated that the size of the endometrium was diminished as the RSG concentration increased. The observation of pathological states and sub-cellular structure revealed numerous vacuoles and the classic morphological changes of apoptotic cells in the endometrium following RSG treatment. The degeneration of endometrium may be induced by PPARγ activation (20). Nenicu et al reported that the therapeutic effects of Telmisartan on endometriosis in mice were associated with angiotensin II receptor inhibition and PPARγ signal pathway activation (19). In a mouse model of endometriosis, the volume of the endometriosis injury site in mice treated with RSG was much smaller than that in model mice (21). Lebovic et al reported that the growth of ectopic endometrial tissue was significantly inhibited in baboons by oral administration of RSG (22). These reports indicated that the growth of ectopic endometrium may be suppressed by PPARγ activation. These results demonstrated that the PPARγ signal pathway was activated by treatment with RSG, which inhibited the expression of MAT2A.

Immune cells, adhesion molecules, extracellular matrix metalloproteinase and pro-inflammatory cytokines activate/alter the peritoneal microenvironment, creating conditions for differentiation, adhesion, proliferation and survival of ectopic endometrial cells (23–25). Meanwhile, angiogenesis is an important factor that induces the paroxysm of endometriosis. The establishment and maintenance of the blood supply between ectopic endometrium and surrounding are a precondition for the establishment of endometriosis. The factors involved in angiogenesis within ectopic endometrium include epidermal growth factor (EGF), vascular endothelial growth factor (VEGF), angiogenin-II and transformed growth factor β (TGFβ). Among these factors, VEGF is of great importance and may induce angiogenesis directly. VEGF is highly expressed in ectopic endometrial and mesenchymal cells (26) and VEGF expression in ectopic endometrial cells is significantly decreased by RSG treatment (27). RSG treatment also decreases the vessel density within the ectopic endometrium (21). In the present study, VEGF expression in ectopic endometrial tissues markedly declined following RSG treatment. Taken together, these results implied that the inhibition of ectopic endometrial growth by PPARγ activation may be associated with the decreased VEGF expression.

Caspase-3 is a key apoptotic protease in mammals, and serves a central role in the apoptotic cascade reaction pathway (28). Caspase-3 is activated when cells encounter apoptotic stimulants, which then activate other proteins in the apoptotic pathway to induce apoptosis (29). The therapeutic effects of cyclooxygenase-2 on endometriosis are associated with apoptosis mediated by caspase-3 activation (30). The ectopic endometrial cells refluxed to the pelvic cavity were still active because of the inhibition of ectopic endometrial cell apoptosis, which was beneficial to the plantation and growth of ectopic endometrium and induced endometriosis (31). In the present study, caspase-3 expression levels significantly increased following RSG treatment. These results indicated that the therapeutic effects of RSG on endometriosis may be associated with apoptosis in ectopic endometrial cells mediated by the activation of caspase-3. Nevertheless, the exact signaling pathways involved in RSG-induced apoptosis and more persuasive evidence to support the fact that angiogenesis should be tested in future.

In conclusion, RSG impacts the development and progression of endometriosis, likely by inhibiting angiogenesis and inducing apoptosis.

Acknowledgements

Not applicable.

Funding

The present study was supported by grants from the National Natural Science Foundation of China (grant no. 81560247).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

SZ, LZ, QL, XY, QM and MC performed the experiments and analyzed the data. SZ and QC designed the study and wrote the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

All animal experiments were authorized by the Ethical Committee of The First Affiliated Hospital of Nanchang University and performed following the guidelines for the care and use of laboratory animals and the principles of laboratory animal care and protection.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References