Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Molecular Medicine Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 1791-2997 Online ISSN: 1791-3004
Journal Cover
April-2022 Volume 25 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2022 Volume 25 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML

  • Supplementary Files
    • Supplementary_Data.pdf
Article

Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis

  • Authors:
    • Rossella Salemi
    • Barbara Tomasello
    • Giuseppe Gattuso
    • Salvatore Santo Signorelli
    • Saverio Candido
  • View Affiliations / Copyright

    Affiliations: Department of Biomedical and Biotechnological Sciences, University of Catania, I‑95123 Catania, Italy, Department of Drug and Health, University of Catania, I‑95123 Catania, Italy, Department of Clinical and Experimental Medicine, University of Catania, I‑95123 Catania, Italy
  • Article Number: 136
    |
    Published online on: February 22, 2022
       https://doi.org/10.3892/mmr.2022.12652
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Inflammation is a protective response of the body to various injuries, which is strictly regulated by a variety of factors, including immune cells and soluble mediators. However, dysfunction of this defensive mechanism often results in inflammation‑driven diseases, such as deep vein thrombosis (DVT). The complex relationship between inflammatory cell activity and DVT has not been fully elucidated. The present study aimed to investigate the role of interleukin‑6 (IL6) signaling transduction in DVT. To this aim, the expression levels of transmembrane isoforms of the IL6 receptor (IL6R) and the glycoprotein 130 responsible for the IL6 cis‑signaling were evaluated in the peripheral blood mononuclear cells of patients with DVT and of healthy controls. The results indicated that leukocytes from patients with DVT exhibited overexpression of both IL6R and gp130 membrane isoforms and that these were strongly associated with the occurrence of DVT. Overall, the present findings indicated that IL6 cis‑signaling may have a direct involvement in the leukocyte activation in DVT and may serve as a predictive biomarker of DVT development.

Introduction

Deep vein thrombosis (DVT) is a pathological condition characterized by the obstruction of veins of the deep venous circle caused by a thrombotic plug that blocks the normal blood flow (1). The main causes of DVT are alterations in the blood flow, damage of the vessel wall and hypercoagulability of the blood (2). DVT and pulmonary embolism (PE), a major DVT-induced complication, are often considered two sides of the same coin leading to a pathological condition called venous thromboembolism (VTE), which represents a common cause of morbidity and mortality (3). Various risk factors are associated with the development of VTE, including obesity, abnormal platelet activation, alteration of blood oxygen concentration, genetic factors, trauma and surgery (4–6), as well as infections (7). Recent reports demonstrated that a fraction of patients with COVID-19 present with coagulation and fibrinolysis alterations leading to fatal complications (8–10). Besides these risk factors, chronic inflammation has been frequently associated with DVT. Some proinflammatory markers and cytokines, including tumor necrosis factor (TNF)α, C-reactive protein (CRP), interleukin (IL)6 and IL8, can promote a procoagulant state inducing the expression of the tissue factor (11) that actives the coagulation cascade resulting in fibrin deposition (12). Several studies have demonstrated that IL6 expression is increased in patients with DVT (13–15), and its activity may be affected by alterations of the canonical transduction signaling (cis-pathway) resulting in activation of the well-known IL6 trans-signaling pathway (16). The soluble form of the IL6 receptor (sIL6R) has a central role in activating intracellular signaling in cells that are physiologically IL6-unresponsive but express the interleukin-6 cytokine family signal transducer (IL6ST, also known as gp130) (17–19). The plasma levels of sIL6R mainly depend on the proteolytic activity of a disintegrin and metalloproteinase (ADAM) family proteins on the IL6R transmembrane (TM) isoform. IL6R cleavage is enhanced by the IL6R Asp358Ala mutation (SNP rs2228145) (16). In addition, alternative splicing of the IL6R gene is responsible for the expression of sIL6R isoforms characterized by the deletion of the TM domain (19). Similarly, the soluble form of gp130 (sgp130) is produced by ADAM cleavage and alternative splicing of its gene, IL6ST. Unlike the activating role of sIL6R, the sgp130 inhibits the IL6 trans-signaling by sequestering the IL6/sIL6R complex (20).

The dysregulation of both cis and trans IL6 signaling may affect the response to IL6 of immune cells involved in inflammation and its related diseases, including DVT. For instance, a study reported an accumulation of white blood cells, mainly leukocytes and neutrophils, inside the thrombus or surrounding vein wall during DVT, suggesting a possible correlation between thrombosis and inflammation (21).

In the present study, the expression levels of IL6R and IL6ST were analyzed in peripheral blood mononuclear cells (PBMCs) to investigate the involvement of IL6 signaling in DVT-associated immune responses in a cohort of 19 patients with DVT and 22 healthy individuals. The expression levels of the transcriptional isoforms of IL6R and IL6ST associated with their protein membrane retention were also evaluated. In addition, the SNP rs2228145 of IL6R was detected to examine its effect on the balance between soluble and membranous IL6R isoforms in DVT.

Materials and methods

Patients and samples

A consecutive series of 19 patients with DVT of the lower limbs (age range, 46–71 years) was included in the present study from January 2019 to March 2020. The patients were admitted to the Internal Medicine Department of G. Rodolico University Hospital (Catania, Italy). The DVT diagnosis was performed with data from ultrasound (US) examination of the venous circulation of the lower limbs, the non-compression of deep veins induced by the US probe (CUS test) was considered to diagnose lower limb DVT. Patients with pregnancy, malignancy, liver disorder and inflammatory bowel disease were excluded from the study. The control group consisted of 22 healthy subjects (age range, 41.7–62 years) with no history of any chronic disease.

Patients and controls had similar ethnic background and originated from the same geographic area. The Institutional Review Board of University Hospital ‘G. Rodolico’ of Catania approved all procedures. All participants gave written consent for blood collection. Venous blood obtained from all subjects was placed in tubes with or without heparin. Samples were centrifuged at 2,000 × g for 10 min at room temperature to recover plasma, serum and buffy coat fractions, then stored at −80°C until subsequent analysis. The demographic and clinical characteristics of both patients and controls are reported in Table I.

Table I.

Demographic and clinical characteristics of the subjects involved in the present study.

Table I.

Demographic and clinical characteristics of the subjects involved in the present study.

Clinical characteristicsControlDVTP-value
Age in years, median (range)48 (41.7-62)56 (46–71)0.2392b
Sex, number (%)
  Male12 (54.5)12 (63.2)0.7600a
  Female10 (45.5)7 (36.8)
Median C-reactive protein level (range), mg/l2.06 (0.79-6.96)6 (3–11)0.0400b
Thrombophilic patients, number (%)Not applicable12 (63)
Cardiopathic patients, number (%)Not applicable5 (27.7)

a Fishers exact test;

b Mann-Whitney test.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA was extracted from buffy coat samples from patients with DVT and healthy control using the TRIzol® LS Reagent (cat. no. 10296028; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. For each sample, 750 ng of tota RNA, quantified using a spectrophotometer (NanoDrop 1000; Thermo Fisher Scientific, Inc.), were treated with RNase-free DNase I (cat. no. EN0525; Thermo Fisher Scientific, Inc.) to remove possible DNA contamination. A mass of 400 ng treated RNA (final concentration 20 ng/µl) was then converted into cDNA using the SuperScript IV Reverse Transcriptase kit (cat. no. 18090050; Thermo Fisher Scientific, Inc.), following the manufacturer's protocol. The cDNA obtained from each sample was subsequently analyzed by qPCR using the Luminaris Color HiGreen qPCR Master Mix, high ROX (cat. no. K0362; Thermo Fisher Scientific, Inc.). The total and TM isoforms of both IL6R and IL6ST were amplified with a 7300 Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) using the primer pairs and thermocycling conditions reported in Table II. The expression levels of targets were normalized with those obtained for the GAPDH housekeeping gene. Relative fold changes in gene expression were calculated using the 2−ΔΔCq method (22). Furthermore, the IL6R TM/IL6R and IL6ST TM/IL6R mRNA ratios were calculated by dividing the Cq value of TM isoform by the Cq value of the total mRNA of each gene.

Table II.

Primers and PCR conditions.

Table II.

Primers and PCR conditions.

A, Expression profiling

Oligo nameSequence (5–3)Thermocycling conditions
IL6R total F GTCCCAGAAGTTCTCCTGCCUracil-DNA glycosylase pre-treatment at 50°C for 2 min, followed by an initial denaturation step at 95°C for 10 min, then 40 cycles at 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec.
IL6R total R GGCTGCAAGATTCCACAACC
IL6R TM F CACGCCTTGGACAGAATCCA
IL6R TM R CAATGGCAATGCAGAGGAGC
IL6ST total F GCCTCAACTTGGAGCCAGA
IL6ST total R TCCCACTTGCTTCTTCACTCC
IL6ST TM F TGAAACTGCTGTGAATGTGGA
IL6ST TM R GCTAAGCAAACAGGCACGAC
GAPDH F AGAAGGCTGGGGCTCATTTG
GAPDH F AGGGGCCATCCACAGTCTTC

B, IL6R exon 9 sequencing

Oligo nameSequence (5–3)Amplification conditions

IL6R exon 9 F TGTTGGTTGGCAGAGCTGTT95°C for 3 min, followed by 35 cycles of 95°C for 30 sec,
IL6R exon 9 R CACCTAAAACACGGCTTGGC60°C for 3 sec, 72°C for 1 min and final 72°C for 5 min.

[i] IL, interleukin; R, receptor; TM, transmembrane; ST, signal transducer; F, forward; R, reverse.

IL6R exon 9 sequencing

Genomic DNA from buffy coat samples from both DVT patients and healthy controls was extracted using a standard phenol-chloroform method and quantified using a spectrophotometer assay (NanoDrop 1000). Exon 9 from the IL6R gene was amplified using DreamTaq DNA Polymerase (cat. no. EP0702; Thermo Fisher Scientific, Inc.) with primers and thermocycling conditions reported in Table II. After PCR amplification, the DNA amplicons were purified with GeneJET PCR Purification kit (cat. no. K0702; Thermo Fisher Scientific, Inc.), according to manufacturer's indications. The purified samples were sequenced using the Mix2Seq kit (Eurofins Genomics Italy), according to the manufacturer's instructions. Chromas Lite software version 2.6.6 (technelysium.com.au/wp/) was used to retrieve and analyze the DNA sequences.

Statistical analysis

Unpaired Student's t-test was used to compare normally distributed data. Whereas, the Mann-Whitney test was performed when data were not normally distributed(Shapiro-Wilk normality test). The contingency analysis was performed using Fisher's exact test. To assess the diagnostic performance of putative biomarkers, the receiver operating characteristic (ROC) was performed considering specificity, sensitivity and likelihood ratio (LR), and the cutoff value was reported for each biomarker. All statistical analyses were performed using GraphPad Prism software Version 8.0.2 (GraphPad Software, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Results

The analysis of total IL6R mRNA expression levels revealed no significant difference between the DVT and control groups (Fig. 1A). By contrast, the ratio of IL6R TM to IL6R total mRNA expression was increased in patients with DVT by 1.66-fold compared with healthy controls (P<0.01; Fig. 1B). Moreover, a significant reduction of total IL6ST mRNA was observed in patients with DVT compared with the healthy controls (P<0.01; Fig. 2A). However, the ratio of IL6ST TM isoform to IL6ST total mRNA expression was 1.5-fold higher (P<0.01) in patients with DVT compared with controls (Fig. 2B). Mutation analysis of IL6R rs2228145 SNP revealed a high frequency of the mutated (AC and CC) genotypes in both DVT and control groups (DVT, 68.42% and CTRL, 66.67%; Table III and Fig. S1). When the samples were stratified according to the IL6R sr2228145 SNP, no significant association between the mutated genotypes and the relative expression of IL6R TM was observed in any of the groups (Fig. 3).

Figure 1.

Quantification of IL6R expression. mRNA expression levels of (A) total IL6R and (B) IL6R TM/IL6R ratios were assessed in peripheral blood mononuclear cells from patients with DVT and from healthy controls. **P<0.01. IL, interleukin; R, receptor; TM, transmembrane; DVT, deep vein thrombosis; CTRL, control; FC, fold change.

Figure 2.

Quantification of IL6ST expression. mRNA expression levels of (A) total IL6ST and (B) IL6ST TM/IL6ST ratios were assessed in peripheral blood mononuclear cells from patients with DVT and from healthy controls. **P<0.01. IL, interleukin; ST, signal transducer; TM, transmembrane; DVT, deep vein thrombosis; CTRL, control; FC, fold change.

Figure 3.

Stratification of IL6R TM/IL6R ratio values according to IL6R SNP rs2228145. (A) All samples. (B) Control group. (C) Patients with DVT. IL, interleukin; R, receptor; TM, transmembrane; SNP, single-nucleotide polymorphism; DVT, deep vein thrombosis; CTRL, control.

Table III.

Association analysis of IL6R and IL6R rs2228145 expression and the occurrence of DVT.

Table III.

Association analysis of IL6R and IL6R rs2228145 expression and the occurrence of DVT.

ParameterPatients with DVT, number (%)Healthy controls, number (%)OR, 95% CIa P-valuea
IL6R TM/IL6R mRNA ratio
  ≥0.31516 (84.21)5 (23.80)17.07, 3.48-83.75<0.001
  <0.3153 (15.79)16 (76.20)
IL6R rs2228145 genotype
  AC and CC genotypes13 (68.42)14 (66.67)1.08, 0.29-4.081
  Wild-type6 (31.58)7 (33.33)
IL6R TM/IL6R mRNA ratio& rs2228145 genotype
  ≥0.315 & AC and CC12 (63.15)2 (10.00)15.45, 2.73-87.32<0.001
≥0.315 WT; <0.35 WT, AC and CC7 (36.84)18 (90.00)
IL6ST TM/IL6ST mRNA ratio
  ≥0.272514 (77.78)5 (25.00)10.50, 2.33-47.22<0.003
  <0.27254 (22.22)15 (75.00)

a Fishers exact test. DVT, deep vein thrombosis; IL, interleukin; R, receptor; TM, transmembrane; ST, signal transducer; OR, odds ratio; CI, confidence interval.

In order to evaluate the association between the relative expression of IL6R TM and the occurrence of DVT, all subjects were stratified according to their IL6R TM/IL6R mRNA ratio (cut-off value, 0.315), the presence of the IL6R rs2228145(C) alleles, or both. The results from Fisher's exact tests revealed a strong association between IL6R TM expression and the occurrence of DVT [odds ratio (OR), 17.07; confidence interval (CI), 3.478-83.75; P<0.001; Table III). A similar association was observed when stratifying the subjects by both the IL6R TM/IL6R ratio and IL6R rs2228145(C) allele (OR, 15.45; CI, 2.726-87.32; P<0.001; Table III). By contrast, no significant association was observed when patients were stratified according to the presence of the IL6R rs2228145(C) allele (Table III).

Concerning the IL6ST TM/IL6ST mRNA ratio, the stratification of samples above the 75th percentile of normal values (>0.2725) highlighted a strong association between IL6ST TM/IL6ST mRNA ratio and the occurrence of DVT (OR, 10.50; CI, 2.335-47.22; P<0.003; Table III).

Finally, a ROC curve analysis was performed to evaluate the diagnostic performance of the IL6R TM/IL6R ratio in DVT. The cutoff of IL6R TM/IL6R ratio was 0.335 (sensitivity, 78.95%; specificity, 95.00%) with a LR of 16.58, indicating a significant increase in the probability of DVT given a positive test (Fig. 4A). Similarly, the IL6ST TM/IL6ST ratio (cutoff, 0.31) exhibited good diagnostic performance parameters (sensitivity, 72.00%; specificity, 90.00%) with a significant association with DVT (LR, 7.22) (Fig. 4B).

Figure 4.

Evaluation of the diagnostic performance of IL6 signaling in DVT. Receiver operating characteristic for (A) IL6R TM/IL6R ratios and for (B) IL6ST TM/IL6ST ratios in DVT. IL, interleukin; R, receptor; TM, transmembrane; ST, signal transducer; DVT, deep vein thrombosis; AUC, area under the curve.

Discussion

IL6 is a pleiotropic cytokine involved in several physiological processes, including the modulation of immune responses and several vascular disorders such as peripheral arterial disease, atherosclerosis and VTE (23–27). The effects of IL6 are mediated by both the IL6R and the gp130 TM receptors expressed by responsive cells (such as hepatocytes and leucocytes), activating the IL6 canonical signaling, also known as IL6 cis-signaling (16). The amount of these receptors on the membrane surface depends on the proteolytic cleavage of the IL6 binding domains by specific ADAM proteinases, as well as on the alternative splicing of the IL6R and IL6ST mRNA that results in the deletion of their transmembrane domains (16). The release of the soluble forms of IL6R and gp130 allows the activation of IL6 trans-signaling in cells lacking IL6R that are normally unresponsive to IL6 stimulation, which may be activated by IL6 if the gp130 receptor is present on their membrane surfaces (17–19). Several autoimmune (such as rheumatoid arthritis and systemic lupus erythematosus)and inflammatory diseases (such as inflammatory bowel disease and psoriasis) are sustained by the alterations at different levels of both cis- and trans-signaling of IL6 (28). Consequently, therapeutic targeting of IL6 signaling with available drug inhibitors is not always effective (28,29). Previous evidence has demonstrated the key role of inflammation in VTE/DVT pathogenesis mediated by different cytokines, including IL6, which is responsible for aberrant inflammatory responses (30). Several studies have highlighted how genetic polymorphisms in IL6 may be predictive of peripheral arterial disease and DVT in patients with cancer (31,14). In addition, the activation of leukocytes, as well as endothelial cells and platelets, can trigger the coagulation cascade by the formation of microparticles within intact veins (11). The role of leukocytes and their activation in both thrombus generation and vein remodeling have been debated (21).

The aim of the present study was to investigate the involvement of IL6R and IL6ST isoforms in the activation of the IL6 cis-signaling in DVT, focusing on the role of the IL6R Asp358Ala mutation (SNP rs2228145) in the alternative splicing of IL6R exon 9. In particular, the expression profiling of the different splicing isoforms of the IL6R and IL6ST receptor was analyzed in leukocytes obtained from patients with DVT and healthy donors.

The expression analysis revealed that in leucocytes from DVT patients the expression of TM transcript isoforms of both IL6R and IL6ST receptors were higher compared with those coding for the soluble isoforms. These results were supported by the strong association between higher TM transcript levels of both IL6R and IL6STand the occurrence of DVT, suggesting a crucial role of IL6 cis-signaling in DVT. Increased expression of IL6R on the membrane of leukocytes may provide a higher responsiveness to IL6, and this may be further reinforced by IL6ST being simultaneously overexpressed on the cellular membrane, thereby also activating the IL6 trans-signaling. The measurement of these molecular biomarkers may be useful to identify a subset of high-risk DVT patients that could develop a hyperinflammatory immune response associated with severe clinical outcomes (13).

The evaluation of IL6 signaling and the current results may have a fundamental impact in the prediction of DVT, as well as in the monitoring of vascular disorders due to other pathologies, and in particular during the COVID-19 pandemic. COVID-19 infection induces endothelial damage and cardiovascular disorders (10,32). Indeed, in some patients with severe COVID-19 symptomatology, abnormal expression of IL6 was observed, leading to a cytokine imbalance defined as ‘cytokine storm’ responsible for severe respiratory syndrome (10,33). Notably, the COVID-19 ‘cytokine storm’ is not observed in all patients with clinical symptoms, suggesting that genetic factors affecting key cytokines or immune cells or other comorbidities, in particular diabetes and cancer, may be related to this complication (34–37). It remains unknown if IL6 polymorphisms are also associated with COVID-19 severity or with its vascular complications.

To investigate the molecular mechanisms capable of driving the expression of IL6R TM, the mutational status of IL6R was assessed, as it has been demonstrated that the rs2228145 SNP impairs IL6R transcript splicing (19). However, the present results were not consistent with this previous report (19), as no significant association between the IL6R rs2228145 variant and the IL6R TM isoform was observed, probably due to the small number of cases analyzed. Therefore, it can be hypothesized that other molecular mechanisms could affect the relative expression of either the TM or soluble IL6R isoforms. For instance, it has been demonstrated that DNA methylation can regulate the splicing mechanism, thus influencing the binding of spliceosome proteins to nascent pre-mRNA (38,39).

Altogether, the present results support the hypothesis that IL6 activates leukocytes, which in turn may be responsible for the inflammatory status in DVT through the overexpression of both IL6R and IL6ST receptors. The assessment of the IL6 receptor complex could be a hallmark of the early inflammatory conditions associated with DVT development and may be useful for the management of patients at risk of thromboembolic events. Further studies will be required to confirm the activation of IL6 cis-signaling in DVT at the protein level and in a larger patient cohort.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

Funding: No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request

Authors' contributions

SSS and SC designed the project and confirm the authenticity of the raw data. BMT, RS and SC wrote the manuscript and performed the experiments. GG and RS performed acid nucleic extraction, PCR and RT-qPCR. SC and BMT performed the statistical analysis. SSS revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The study was conducted according to the guidelines of The Declaration of Helsinki, and ap-proved by the Institutional Review Board of The University Polyclinic of Catania. Informed consent was obtained from all subjects involved in the study for participation and data publication.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Phillippe HM: Overview of venous thromboembolism. Am J Manag Care. 23 (Suppl 20):S376–S382. 2017.PubMed/NCBI

2 

Kyrle PA and Eichinger S: Deep vein thrombosis. Lancet. 365:1163–1174. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Streiff MB, Agnelli G, Connors JM, Crowther M, Eichinger S, Lopes R, McBane RD, Moll S and Ansell J: Guidance for the treatment of deep vein thrombosis and pulmonary embolism. J Thromb Thrombolysis. 41:32–67. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Martinelli I, Bucciarelli P and Mannucci PM: Thrombotic risk factors: Basic pathophysiology. Crit Care Med. 38 (Suppl 2):S3–S9. 2010. View Article : Google Scholar : PubMed/NCBI

5 

Reitsma PH, Versteeg HH and Middeldorp S: Mechanistic view of risk factors for venous thromboembolism. Arterioscler Thromb Vasc Biol. 32:563–568. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Shaheen K, Alraies MC, Alraiyes AH and Christie R: Factor V Leiden: How great is the risk of venous thromboembolism? Cleve Clin J Med. 79:265–272. 2012. View Article : Google Scholar : PubMed/NCBI

7 

Kaplan D, Casper TC, Elliott CG, Men S, Pendleton RC, Kraiss LW, Weyrich AS, Grissom CK, Zimmerman GA and Rondina MT: VTE incidence and risk factors in patients with severe sepsis and septic shock. Chest. 148:1224–1230. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Zhai Z, Li C, Chen Y, Gerotziafas G, Zhang Z, Wan J, Liu P, Elalamy I and Wang C; Prevention Treatment of VTE Associated with COVID-19 Infection Consensus Statement Group, : Prevention and Treatment of Venous Thromboembolism Associated with Coronavirus Disease 2019 Infection: A Consensus Statement before Guidelines. Thromb Haemost. 120:937–948. 2020. View Article : Google Scholar : PubMed/NCBI

9 

Kartsios C, Lokare A, Osman H, Perrin D, Razaq S, Ayub N, Daddar B and Fair S: Diagnosis, management, and outcomes of venous thromboembolism in COVID-19 positive patients: A role for direct anticoagulants? J Thromb Thrombolysis. Sep 10–2020.(Epub ahead of print). doi: 10.1007/s11239-020-02257-7.PubMed/NCBI

10 

Tsatsakis A, Calina D, Falzone L, Petrakis D, Mitrut R, Siokas V, Pennisi M, Lanza G, Libra M, Doukas SG, et al: SARS-CoV-2 pathophysiology and its clinical implications: An integrative overview of the pharmacotherapeutic management of COVID-19. Food Chem Toxicol. 146:1117692020. View Article : Google Scholar : PubMed/NCBI

11 

Branchford BR and Carpenter SL: The role of inflammation in venous thromboembolism. Front Pediatr. 6:1422018. View Article : Google Scholar : PubMed/NCBI

12 

Bovill EG and van der Vliet A: Venous valvular stasis-associated hypoxia and thrombosis: What is the link? Annu Rev Physiol. 73:527–545. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Zhang Y, Zhang Z, Wei R, Miao X, Sun S, Liang G, Chu C, Zhao L, Zhu X, Guo Q, et al: IL (Interleukin)-6 contributes to deep vein thrombosis and is negatively regulated by miR-338-5p. Arterioscler Thromb Vasc Biol. 40:323–334. 2020. View Article : Google Scholar : PubMed/NCBI

14 

Malaponte G, Polesel J, Candido S, Sambataro D, Bevelacqua V, Anzaldi M, Vella N, Fiore V, Militello L, Mazzarino MC, et al: IL-6-174 G>C and MMP-9-1562 C>T polymorphisms are associated with increased risk of deep vein thrombosis in cancer patients. Cytokine. 62:64–69. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Sharma A, Singh K, Biswas A, Ranjan R, Kishor K, Pandey H, Kumar R, Mahapatra M, Oldenburg J and Saxena R: Impact of interleukin 6 promoter polymorphisms (−174 G>C, −572 G>C and −597 G>A) on plasma IL-6 levels and their influence on the development of DVT: A study from India. Hematology. 23:833–838. 2018. View Article : Google Scholar : PubMed/NCBI

16 

van Dongen J, Jansen R, Smit D, Hottenga JJ, Mbarek H, Willemsen G, Kluft C, Penninx BW, Ferreira MA, Boomsma DI, et al AAGC Collaborators, : The contribution of the functional IL6R polymorphism rs2228145, eQTLs and other genome-wide SNPs to the heritability of plasma sIL-6R levels. Behav Genet. 44:368–382. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Müller-Newen G, Küster A, Hemmann U, Keul R, Horsten U, Martens A, Graeve L, Wijdenes J and Heinrich PC: Soluble IL-6 receptor potentiates the antagonistic activity of soluble gp130 on IL-6 responses. J Immunol. 161:6347–6355. 1998.PubMed/NCBI

18 

Scheller J and Rose-John S: The interleukin 6 pathway and atherosclerosis. Lancet. 380:3382012. View Article : Google Scholar : PubMed/NCBI

19 

Ferreira RC, Freitag DF, Cutler AJ, Howson JM, Rainbow DB, Smyth DJ, Kaptoge S, Clarke P, Boreham C, Coulson RM, et al: Functional IL6R 358Ala allele impairs classical IL-6 receptor signaling and influences risk of diverse inflammatory diseases. PLoS Genet. 9:e10034442013. View Article : Google Scholar : PubMed/NCBI

20 

Morieri ML, Passaro A and Zuliani G: Interleukin-6 ‘Trans-signaling’ and ischemic vascular disease: The important role of soluble gp130. Mediators Inflamm. 2017:13963982017. View Article : Google Scholar : PubMed/NCBI

21 

Saha P, Humphries J, Modarai B, Mattock K, Waltham M, Evans CE, Ahmad A, Patel AS, Premaratne S, Lyons OT, et al: Leukocytes and the natural history of deep vein thrombosis: Current concepts and future directions. Arterioscler Thromb Vasc Biol. 31:506–512. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Bevelacqua V, Libra M, Mazzarino MC, Gangemi P, Nicotra G, Curatolo S, Massimino D, Plumari A, Merito P, Valente G, et al: Long pentraxin 3: A marker of inflammation in untreated psoriatic patients. Int J Mol Med. 18:415–423. 2006.PubMed/NCBI

24 

Malaponte G, Libra M, Bevelacqua Y, Merito P, Fatuzzo P, Rapisarda F, Cristina M, Naselli G, Stivala F, Mazzarino MC, et al: Inflammatory status in patients with chronic renal failure: The role of PTX3 and pro-inflammatory cytokines. Int J Mol Med. 20:471–481. 2007.PubMed/NCBI

25 

Signorelli SS, Anzaldi M, Fiore V, Simili M, Puccia G, Libra M, Malaponte G and Neri S: Patients with unrecognized peripheral arterial disease (PAD) assessed by ankle-brachial index (ABI) present a defined profile of proinflammatory markers compared to healthy subjects. Cytokine. 59:294–298. 2012. View Article : Google Scholar : PubMed/NCBI

26 

Signorelli SS, Anzaldi M, Libra M, Navolanic PM, Malaponte G, Mangano K, Quattrocchi C, Di Marco R, Fiore V and Neri S: Plasma levels of inflammatory biomarkers in peripheral arterial disease: Results of a Cohort Study. Angiology. 67:870–874. 2016. View Article : Google Scholar : PubMed/NCBI

27 

Signorelli SS, Candido S, Salemi R, Fiore V, Mangiafico M and Libra M: Low levels of inflammation and the absence of subclinical atherosclerosis in rheumatoid arthritis. Mol Med Rep. 13:3521–3524. 2016. View Article : Google Scholar : PubMed/NCBI

28 

Hunter CA and Jones SA: IL-6 as a keystone cytokine in health and disease. Nat Immunol. 16:448–457. 2015. View Article : Google Scholar : PubMed/NCBI

29 

Kang S, Tanaka T, Narazaki M and Kishimoto T: Targeting interleukin-6 signaling in clinic. Immunity. 50:1007–1023. 2019. View Article : Google Scholar : PubMed/NCBI

30 

Saghazadeh A and Rezaei N: Inflammation as a cause of venous thromboembolism. Crit Rev Oncol Hematol. 99:272–285. 2016. View Article : Google Scholar : PubMed/NCBI

31 

Libra M, Signorelli SS, Bevelacqua Y, Navolanic PM, Bevelacqua V, Polesel J, Talamini R, Stivala F, Mazzarino MC and Malaponte G: Analysis of G(−174)C IL-6 polymorphism and plasma concentrations of inflammatory markers in patients with type 2 diabetes and peripheral arterial disease. J Clin Pathol. 59:211–215. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Pennisi M, Lanza G, Falzone L, Fisicaro F, Ferri R and Bella R: SARS-CoV-2 and the nervous system: From clinical features to molecular mechanisms. Int J Mol Sci. 21:54752020. View Article : Google Scholar : PubMed/NCBI

33 

Papa A, Di Dato MT, Buonavolonta P, Saracco E, Salzano AM and Casale B: Clinical management of Il-6 driven cytokine storm related to COVID-19 in a patient with recent spinal cord stimulator implants: A Case Report. Anesth Pain Med. 10:e1041512020. View Article : Google Scholar : PubMed/NCBI

34 

Vivarelli S, Falzone L, Grillo CM, Scandurra G, Torino F and Libra M: Cancer management during COVID-19 pandemic: Is immune checkpoint inhibitors-based immunotherapy harmful or beneficial? Cancers (Basel). 12:22372020. View Article : Google Scholar : PubMed/NCBI

35 

Vivarelli S, Falzone L, Torino F, Scandurra G, Russo G, Bordonaro R, Pappalardo F, Spandidos DA, Raciti G and Libra M: Immune-checkpoint inhibitors from cancer to COVID 19: A promising avenue for the treatment of patients with COVID 19 (Review). Int J Oncol. 58:145–157. 2021. View Article : Google Scholar : PubMed/NCBI

36 

Zheng M, Wang X, Guo H, Fan Y, Song Z, Lu Z, Wang J, Zheng C, Dong L, Ma Y, et al: The Cytokine profiles and immune response are increased in COVID-19 patients with type 2 diabetes mellitus. J Diabetes Res. 2021:95267012021. View Article : Google Scholar : PubMed/NCBI

37 

Kaur S, Bansal R, Kollimuttathuillam S, Gowda AM, Singh B, Mehta D and Maroules M: The looming storm: Blood and cytokines in COVID-19. Blood Rev. 46:1007432021. View Article : Google Scholar : PubMed/NCBI

38 

Shayevitch R, Askayo D, Keydar I and Ast G: The importance of DNA methylation of exons on alternative splicing. RNA. 24:1351–1362. 2018. View Article : Google Scholar : PubMed/NCBI

39 

Lev Maor G, Yearim A and Ast G: The alternative role of DNA methylation in splicing regulation. Trends Genet. 31:274–280. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Salemi R, Tomasello B, Gattuso G, Signorelli SS and Candido S: Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis. Mol Med Rep 25: 136, 2022.
APA
Salemi, R., Tomasello, B., Gattuso, G., Signorelli, S.S., & Candido, S. (2022). Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis. Molecular Medicine Reports, 25, 136. https://doi.org/10.3892/mmr.2022.12652
MLA
Salemi, R., Tomasello, B., Gattuso, G., Signorelli, S. S., Candido, S."Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis". Molecular Medicine Reports 25.4 (2022): 136.
Chicago
Salemi, R., Tomasello, B., Gattuso, G., Signorelli, S. S., Candido, S."Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis". Molecular Medicine Reports 25, no. 4 (2022): 136. https://doi.org/10.3892/mmr.2022.12652
Copy and paste a formatted citation
x
Spandidos Publications style
Salemi R, Tomasello B, Gattuso G, Signorelli SS and Candido S: Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis. Mol Med Rep 25: 136, 2022.
APA
Salemi, R., Tomasello, B., Gattuso, G., Signorelli, S.S., & Candido, S. (2022). Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis. Molecular Medicine Reports, 25, 136. https://doi.org/10.3892/mmr.2022.12652
MLA
Salemi, R., Tomasello, B., Gattuso, G., Signorelli, S. S., Candido, S."Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis". Molecular Medicine Reports 25.4 (2022): 136.
Chicago
Salemi, R., Tomasello, B., Gattuso, G., Signorelli, S. S., Candido, S."Overactivation of IL6 cis‑signaling in leukocytes is an inflammatory hallmark of deep vein thrombosis". Molecular Medicine Reports 25, no. 4 (2022): 136. https://doi.org/10.3892/mmr.2022.12652
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team