A polymorphism in the nuclear receptor coactivator 7 gene and breast cancer susceptibility

  • Authors:
    • Julia Süllner
    • Claus Lattrich
    • Julia Häring
    • Regina Görse
    • Olaf Ortmann
    • Oliver Treeck
  • View Affiliations

  • Published online on: September 16, 2011     https://doi.org/10.3892/ol.2011.421
  • Pages: 131-134
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The nuclear receptor coactivator 7 (NCoA7) gene codes for an estrogen receptor-associated protein that plays a significant role in the cellular response to estrogens. Given that NCoA7 is expressed in the mammary gland, alterations in this gene may affect breast cancer risk. In this study, we compared the genotype and allele frequencies of the missense single nucleotide polymorphism (SNP) rs1567, located in the coding region of the NCoA7 gene and resulting in an amino acid exchange from asparagine to glutamine, in 305 women with sporadic breast cancer and 346 women without any malignancy. Statistical analysis of the observed frequencies did not reveal a significant difference between the cancer and control groups, nor did a comparison between histological breast cancer subgroups. In conclusion, the results of our phenotype-genotype association study indicate that NCoA7 SNP rs1567 does not affect breast cancer susceptibility.

Introduction

Multiple hormone-related mechanisms have been reported to be involved in breast cancer onset and progress (1). Markedly high levels of estrogens are known to increase the risk of developing this disease (1,2). The cellular response to estrogens is mediated by specific estrogen receptors (ERs), ERα and ERβ. These receptors regulate transcription of the target genes by binding directly to estrogen response elements or by interaction with other transcription factors. Binding to coregulatory proteins, which comprise corepressors as well as coactivators, is essential for ER function. These proteins bind to specific domains of the ligand-bound estrogen receptors and are therefore capable of controlling the transcription of target genes (3). In addition to communicating with the transcriptional machinery, certain coregulators are also capable of altering chromatin function (4). It has been suggested that coregulatory proteins perform virtually all of the reactions required to control enhancer-dependent gene expression. These proteins regulate subfunctions of numerous transcription factors in addition to cell processes including translation, energy generation and motility (5).

Nuclear receptor coactivator 7 (NCoA7) is an ER-coactivator protein also known as ERAP140 (ER-associated protein 140) (6). Ligand-bound ERα or ERβ recruits NCoA7 to the promoter region of ER target genes (7). Since NCoA7 has little structural homology with other nuclear receptor cofactors, it may represent a distinct class of nuclear receptor coactivators. NCoA7 is expressed in a cell- and tissue- specific manner. It is most abundantly expressed in the brain, but is also found in organs including the mammary gland, bone marrow, testis, ovary, uterus, prostate, stomach, bladder, spinal chord, pancreas and thyroid (6). The specific physiological function of NCoA7 is not completely understood. Certain studies have indicated that NCoA7 may be a favourable prognostic indicator for neuroblastomas. On the other hand, other authors identified an isoform that appears to be ovulation-associated and reproduction system-specific; another study found NCoA7 to possess an activity that contributes to oxidation resistance (8,9,10). Given that NCoA7 is expressed in the mammary gland and thus plays a role in the response of this tissue to estrogens, molecular alterations in the NCoA7 protein may affect breast cancer risk.

The most frequent molecular variations of the DNA are single nucleotide polymorphisms (SNPs). SNPs are point mutations occurring in at least 1% of the population. SNPs located in exon regions may alter protein function, whereas SNPs in the gene promoter are capable of modifying gene expression levels. Various genome-wide association studies detected a number of gene polymorphisms postulated to influence development of various diseases, as well as breast cancer susceptibility (1117).

In this study, we tested whether the missense SNP rs1567, located in the last exon of the coding region of the NCoA7 gene and thus leading to an amino acid exchange from asparagine to glutamine in the coactivator protein, affected breast cancer risk. For this purpose, we performed a genotype-phenotype association study and compared genotype and allele frequencies of this SNP in 305 women with sporadic breast cancer and 346 without any malignancy.

Patients and methods

Patients

This study included blood samples from 305 Caucasian women with sporadic breast cancer and 346 age-matched Caucasian women without any malignancy. The median ages of the patient collective and the control group were 55.6 and 54.9 years, respectively (age at diagnosis for case patients and age at inclusion for control subjects). The histopathological characteristics of the patients are shown in Table I. Samples of breast cancer case participants were provided by the Institute of Pathology, University of Regensburg, in an anonymous and randomised manner or were collected at the Clinic of Obstetrics and Gynecology, University Medical Center Regensburg after informed consent was obtained from the patients. Included were Caucasian female sporadic breast cancer patients with available information on tumour size, grading and nodal status, as well as receptor status of ERα, PR and HER2, between 2002 and 2007. The control participants originated from the same geographic area as the tumour patients, the Oberpfalz area of Regensburg, Bavaria, Germany. The inclusion criterion for the control subjects was the absence of known malignancies. The study was approved by the Ethics Committee of the University of Regensburg.

Table I

Histopathological characteristics and receptor status of breast cancer cases included in this study (n=305).

Table I

Histopathological characteristics and receptor status of breast cancer cases included in this study (n=305).

CharacteristicsPatient numbers
Tumour size
 pT1164
 pT2107
 pT311
 pT412
 pTx11
Histological grade
 G110
 G299
 G3161
 Gx35
Nodal status
 N0178
 N1–3103
 Nx24
ERα status
 Negative (≤4)52
 Positive (>4)243
 ERx10
PR status
 Negative (≤4)118
 Positive (>4)178
 PRx9
Her2/neu status
 Negative (0–2)238
 Positive (3)43
 Her2/neuX24
SNP analysis

The analysed SNP in the coding region of the last exon in the NCoA7 gene was identified using the websites www.genecards.org and http://www.ncbi.nlm.nih.gov/projects/SNP. SNP rs1567 (G/T) is located at position 126291607 (plus strand) of chromosome 6. The basis for the selection of this SNP was its location in the coding region of the NCoA7 gene. At this position, the nucleotide polymorphism causes a missense mutation and therefore a change of amino acids in the resulting NCoA7 protein. Genomic DNA was isolated from 100 μl EDTA-blood after the addition of 300 μl lysis buffer [1% v/v TritonX (Sigma, St. Louis, MO, USA), 0.32 M sucrose, 0.01 M Tris (pH 7,5) and 5 mM MgCl2 (Roth, Karslruhe, Germany)] and 2-fold centrifugation (13000 rpm) for 30 sec. The pellet was resuspended in 50 μl PCR buffer (GoTaq colorless buffer, Promega, Madison, WI, USA) containing 0.5% Tween-20 (Sigma) and 10 mAnson units proteinase K (Merck, Darmstadt, Germany), followed by incubation at 50°C overnight and heat inactivation of the enzyme for 10 min at 95°C. The genomic DNA-containing lysate was subjected to a tetra-primer ARMS PCR approach (18) allowing allele-specific amplification using the PCR primers listed in Table II (synthesised at Metabion, Martinsried, Germany). For this purpose, 2 μl of 5X GoTaq buffer, 0.2 μl of dNTP mix (10 mM) (Fermentas, St. Leon-Rot, Germany), 0.2 μl of primer 567-1, 567-2 and 567-T (10 μM), 0.4 μl of primer 567-G (10 μM) and 0.1 μl GoTaq polymerase (Promega, Madison, WI, USA) was added to 10 ng of genomic DNA and the PCR reaction was carried out using a T1 thermocycler (Biometra, Goettingen, Germany). The PCR program comprised denaturation of 10 min at 94°C followed by 38 PCR cycles of 94°C (30 sec), 63°C (30 sec) and anealing at 72°C (60 sec), followed by a final extension for 5 min at 72°C. PCR products were analysed using 1.5% agarose gel electrophoresis. Allele-specific PCR product sizes for SNP rs1567 were 154/196 bp (G/T). As a quality control for genotyping, a negative water control and a previously characterised DNA sample representing the heterozygous and the two homozygous genotypes were analysed in addition to the unknown samples in each PCR run.

Table II

Oligonucleotides used for SNP genotyping with tetra primer PCR.

Table II

Oligonucleotides used for SNP genotyping with tetra primer PCR.

SNPPrimerSequence (5′-3′)
rs 1567
567-T AGGATCTGGAGGTGTGGGCATTTAAT
567-G CAGTCTTTTTAATGTTATATTTTAAGGCAGTCTGAATTTTAC
567-1 TAGATGCTGATTTATACCACGGACGAAG
567-2 ACCTTCCAGAATCTTTCTGCAATGTGAT
PCR product sizes (bp)
rs1567:T allele, 196; G allele, 154; outer primers, 283.
Statistical analysis

Deviation from the Hardy-Weinberg equilibrium was estimated using the Fisher's exact and χ2 tests, and all values were subjected to one-way ANOVA to achieve homogeneity of variance. Statistical tests for association [confidence interval (CI) 95%] and significance were carried out using Microsoft Office Excel 2003 and the Internet websites http://www.quantitativeskills.com/sisa/statistics/twoby2.htm and http://ihg2.helmholtz-muenchen.de/cgi-bin/hw/hwa1.pl. P<0.05 was considered to be statistically significant. After tests for deviation using the Hardy-Weinberg equilibrium were conducted, allele frequency, allele positivity and genotype frequencies were determined. The odds ratio (OR) was calculated using the more frequent homozygous genotypes as a reference group.

Results

Genotype analysis

Analysis of 305 breast cancer patients and 346 women without any malignancy revealed that the homozygous genotype TT of ER-coactivator SNP rs1567 was most frequent (73.7% in the control group), whereas the GG genotype was relatively rare (2.3% in the control group). A heterozygous GT genotype was exhibited by 22.6% of the control population. Statistical analysis did not show significant differences in homozygous or heterozygous genotype frequencies between the case and the control group (Table III). Thus, no association of a specific rs1567 genotype with breast cancer risk was observed.

Table III

No significant differences were observed between the breast cancer and the control groups with regard to genotype frequency, allele frequency or allele positivity of NCoA7 SNP rs1567a.

Table III

No significant differences were observed between the breast cancer and the control groups with regard to genotype frequency, allele frequency or allele positivity of NCoA7 SNP rs1567a.

rs1567Genotype frequencyAllele frequencyAllele positivity for T-alleleAllele positivity for G-allele




TTTGGGTGTT+TGGGTTTG+GG









n%n%n%n%n%n%n%n%n%
Case22975.16922.672.352786.48313.629897.772.322975.17624.9
Control25573.78123.4102.959185.410114.633697.1102.925573.79126.3
P-value0.77810.61820.60920.63470.6868
Odds ratio1.05421.28291.08511.2671.0753
CI 95%0.73–1.520.48–3.420.79–1.480.75–1.530.47–3.37

a After tests for deviation using the Hardy-Weinberg equilibrium were conducted, genotype and allele frequency were determined, as well as allele positivity. The odds ratio and p-values were determined using the more frequent allele as a reference group. CI, confidence interval.

Allele frequency

Comparing allele frequencies of the NCoA7 SNP rs1567 in breast cancer patients and controls also showed no significant difference between the two groups (OR 1.0851, Table III). The clearly predominant allele in the two groups was the T allele (0.86 vs. 0.85), whereas only 13.6% of the tested chromosomes carried the G allele.

Allele positivity

Phenotype-genotype association analysis of the allele positivity of the rs1567 SNP revealed no significant difference between women with breast cancer and the control population (Table III).

Association between histological breast cancer characteristics and receptor status

We compared SNP genotype frequencies between breast cancer subgroups with various specific tumour characteristics. The respective subgroup size allowed statistical analysis of tumour size (T), nodal status (N) and histological grading (G). No significant difference was observed between the compared subgroups in any of these tests (data not shown). Since interactions between ERα, PR, and HER2 occur in breast cancer cells, we also compared the SNP genotypes between the subgroups of different ERα, PR and HER2 status. However, statistical analysis did not reveal a significant difference between the receptor status subgroups regarding genotype frequency, allele frequency or allele positivity.

Discussion

SNPs in genes of steroid hormone metabolism or signalling are potential factors that may affect cancer risk in hormone-dependent tissues. Various genome-wide association studies detected a number of gene polymorphisms, which are thought to affect breast cancer susceptibility (1417). Since estrogens are known to affect breast cancer development, it is essential to analyse polymorphisms in the two estrogen receptor genes, ESR1 and ESR2, as well as their co-regulatory proteins, which may affect breast cancer risk. Co-activators and co-suppressors determine the function of ERs as a transcriptional regulator. NCoA7 is an ER coactivator protein that has been shown to be expressed in the mammary gland, but has yet to be analysed in the context of breast cancer.

We did not observe any association of the missense SNP rs1567 with breast cancer risk or with histopathological characteristics of the cancer tissue. Even taking into account the fact that the tested sample numbers were limited and the frequency of the rare genotype was relatively small, the observed allele and genotype frequencies were so similar that our data clearly indicate that NCoA7 SNP rs1567 does not affect breast cancer susceptibility. One explanation for this lack of association is that the missense SNP tested only led to an amino acid exchange from asparagine to glutamine. The two amino acids have markedly similar properties, as they are neutral, polar and hydrophilic amino acids; thus, it appears unlikely that SNP rs1567 was able to strongly alter the structure or function of NCoA7 protein.

According to previous studies, the NCoA7 protein may be a new group of ER-coactivating proteins (7). Shao et al reported that NCoA7 is a tissue-specific coactivator to agonist-bound nuclear receptors, including the estrogen receptors. These authors also found that NCoA7 is expressed in breast tissue (6). In addition to its role as a coactivator the protein appears to be crucial for the reduction of oxidative damage of the DNA inside the nucleus. The NCoA7 protein contains similar functional domains to the mitochondrial OXR1-protein, which is known to reduce oxidative damage in DNA structure. In contrast to OXR-1, NCoA7 is not stress-induced but reacts to estrogens and interacts with the estrogen receptor (10). Given that NCoA7 is not estrogen receptor-specific but binds to other nuclear receptors as well, this coactivator is involved in a variety of other signalling pathways (7,19).

With regard to the function of NCoA7 in carcinogenesis, only limited data exist. Due to the high expression of NCoA7 in the human brain, previous studies focused on the role of NCoA7 in the context of brain diseases (8,20). NCoA7 expression is reportedly a favorable predictive factor in neuroblastoma (8). To the best of our knowledge, the only NCoA7 SNP study to be published reported a lack of association between the appearance of schizophrenia and five SNPs in this gene (20).

In conclusion, we did not observe any association between NCoA7 polymorphism rs1567 and breast cancer susceptibility. Our results do not preclude a significant function of NCoA7 in breast cancer development.

Acknowledgements

We thank Helena Lowack for expert technical assistance.

References

1 

Kelsey JL and Bernstein L: Epidemiology and prevention of breast cancer. Annu Rev Public Health. 17:47–67. 1996. View Article : Google Scholar : PubMed/NCBI

2 

Preston-Martin S, Pike MC, Ross RK, Jones PA and Henderson BE: Increased cell division as a cause of human cancer. Cancer Res. 50:7415–7421. 1990.PubMed/NCBI

3 

Hall JM and McDonnell DW: Coregulators in nuclear estrogen receptor action – from concept to therapeutic targeting. Mol Interv. 5:343–357. 2005.

4 

Silva CM and Shupnik MA: Integration of steroid and growth factor pathways in breast cancer: focus on signal transducers and activators of transcription and their potential role in resistance. Mol Endocrinol. 21:1499–1512. 2007. View Article : Google Scholar : PubMed/NCBI

5 

O'Malley B: Coregulators: From whence came these ‘master genes’. Mol Endocrinol. 21:1009–1013. 2007.PubMed/NCBI

6 

Shao W, Halachmi S and Brown M: ERAP140, a conserved tissue-specific nuclear receptor coactivator. Mol Cell Biol. 22:3358–3372. 2002. View Article : Google Scholar : PubMed/NCBI

7 

Paramanik V and Thakur MK: Interaction of estrogen receptor associated protein (ERAP) 140 with ER beta decreases but its expression increases in aging mouse cerebral cortex. Cell Mol Neurobiol. 30:961–966. 2010. View Article : Google Scholar

8 

Arai H, Ozaki T, Niizuma H, Nakamura Y, Ohira M, Takano K, Matsumoto M and Nakagawara A: ERAP140/Nbla10993 is a novel favorable prognostic indicator for neuroblastoma induced in response to retinoic acid. Oncol Rep. 19:1381–1388. 2008.PubMed/NCBI

9 

Shkolnik K, Ben-Dor S, Galiani D, Hourvitz A and Dekel N: Molecular characterization and bioinformatics analysis of Ncoa7B, a novel ovulation-associated and reproduction system-specific Ncoa7 isoform. Reproduction. 135:321–333. 2008. View Article : Google Scholar : PubMed/NCBI

10 

Durand M, Kolpak A, Farrell T, Elliott NA, Shao W, Brown M and Volkert MR: The OXR domain defines a conserved family of eukaryotic oxidation resistance proteins. BMC Cell Biol. 8:132007. View Article : Google Scholar : PubMed/NCBI

11 

Reding KW, Weiss NS, Chen C, Li CI, Carlson CS, Wilkerson HW, Farin FM, Thummel KE, Daling JR and Malone KE: Genetic polymorphisms in the catechol estrogen metabolism pathway and breast cancer risk. Cancer Epidemiol Biomarkers. 18:1461–1467. 2009. View Article : Google Scholar : PubMed/NCBI

12 

Hsieh SM, Smith RA, Lintell NA, Hunter KW and Griffiths LR: Polymorphisms of the SIPA1 gene and sporadic breast cancer susceptibility. BMC Cancer. 9:3312009. View Article : Google Scholar : PubMed/NCBI

13 

Giess M, Lattrich C, Springwald A, Goerse R, Ortmann O and Treeck O: GPR30 gene polymorphisms are associated with progesterone receptor status and histopathological characteristics of breast cancer patients. J Steroid Biochem Mol Biol. 118:7–12. 2010. View Article : Google Scholar : PubMed/NCBI

14 

Kirchhoff T, Chen ZQ, Gold B, Pal P, Gaudet MM, Kosarin K, Levine DA, Gregersen P, Spencer S, Harlan M, Robson M, Klein RJ, Hudis CA, Norton L, Dean M and Offit K: The 6q22.33 locus and breast cancer susceptibility. Cancer Epidemiol Biomarkers. 18:2468–2475. 2009. View Article : Google Scholar : PubMed/NCBI

15 

Thomas G, Jacobs KB, Kraft P, et al: A multistage genome-wide association study in breast cancer identifies two new risk alleles at 1p11.2 and 14q24.1 (RAD51L1). Nat Genet. 41:579–584. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Zheng W, Long J, Gao YT, et al: Genome-wide association study identifies a new breast cancer susceptibility locus at 6q25.1. Nat Genet. 41:324–328. 2009. View Article : Google Scholar : PubMed/NCBI

17 

Garcia-Closas M and Chanock S: Genetic susceptibility loci for breast cancer by estrogen receptor status. Clin Cancer Res. 14:8000–8009. 2008. View Article : Google Scholar : PubMed/NCBI

18 

Ye S, Dhillon S, Ke X, Collins AR and Day IN: An efficient procedure for genotyping single nucleotide polymorphisms. Nucleic Acids Res. 29:E88–8. 2001. View Article : Google Scholar : PubMed/NCBI

19 

Lazennec G, Ediger TR, Petz LN, Nadulli AM and Katzenellenbogen BS: Mechanistic aspects of estrogen receptor activation probed with constitutively active estrogen receptors: correlations with DNA and coregulator interactions and receptor conformational changes. Molecular Endocrinology. 11:1375–1386. 1997. View Article : Google Scholar

20 

Liu Y, Shi Y, Guo T, et al: No association between the nuclear receptor coactivator 7 gene and schizophrenia in the Chinese Han population. Schizophr Res. 89:360–361. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

January 2012
Volume 3 Issue 1

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Süllner J, Lattrich C, Häring J, Görse R, Ortmann O and Treeck O: A polymorphism in the nuclear receptor coactivator 7 gene and breast cancer susceptibility. Oncol Lett 3: 131-134, 2012.
APA
Süllner, J., Lattrich, C., Häring, J., Görse, R., Ortmann, O., & Treeck, O. (2012). A polymorphism in the nuclear receptor coactivator 7 gene and breast cancer susceptibility. Oncology Letters, 3, 131-134. https://doi.org/10.3892/ol.2011.421
MLA
Süllner, J., Lattrich, C., Häring, J., Görse, R., Ortmann, O., Treeck, O."A polymorphism in the nuclear receptor coactivator 7 gene and breast cancer susceptibility". Oncology Letters 3.1 (2012): 131-134.
Chicago
Süllner, J., Lattrich, C., Häring, J., Görse, R., Ortmann, O., Treeck, O."A polymorphism in the nuclear receptor coactivator 7 gene and breast cancer susceptibility". Oncology Letters 3, no. 1 (2012): 131-134. https://doi.org/10.3892/ol.2011.421