Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
July 2013 Volume 6 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July 2013 Volume 6 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress

  • Authors:
    • Manunya Nuth
    • Ann R. Kennedy
  • View Affiliations / Copyright

    Affiliations: Department of Radiation Oncology, University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA
  • Pages: 35-42
    |
    Published online on: May 23, 2013
       https://doi.org/10.3892/ol.2013.1362
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Ionizing radiation associated with highly energetic and charged heavy (HZE) particles poses a danger to astronauts during space travel. The aim of the present study was to evaluate the patterns of gene expression associated with cellular exposure to low‑dose iron ion irradiation, in the presence and absence of L‑selenomethionine (SeM). Human thyroid epithelial cells (HTori‑3) were exposed to low‑dose iron ion (1 GeV/n) irradiation at 10 or 20 cGy with or without SeM pretreatment. The cells were harvested 6 and 16 h post‑irradiation and analyzed by the Affymetrix U133Av2 gene chip arrays. Genes exhibiting a 1.5‑fold expression cut‑off and 5% false discovery rate (FDR) were considered statistically significant and subsequently analyzed using the Database for Annotation, Visualization and Integrated Discovery (DAVID) for pathway analysis. Representative genes were further validated by real‑time RT‑PCR. Even at low doses of radiation from iron ions, global genome profiling of the irradiated cells revealed the upregulation of genes associated with the activation of stress‑related signaling pathways (ubiquitin‑mediated proteolysis, p53 signaling, cell cycle and apoptosis), which occurred in a dose‑dependent manner. A 24-h pretreatment with SeM was shown to reduce the radiation effects by mitigating stress‑related signaling pathways and downregulating certain genes associated with cell adhesion. The mechanism by which SeM prevents radiation‑induced transformation in vitro may involve the suppression of the expression of genes associated with stress‑related signaling and certain cell adhesion events.

Introduction

Exposure to ionizing radiation poses a threat to astronauts on space missions. Of particular concern is the radiation emitted from high atomic mass (Z) and high-energy (HZE) particles. Unlike the relatively infrequent energy deposition by low linear energy transfer (LET) radiation along its track, high LET radiation from HZE particles exhibits a highly energetic and dense core and a laterally extending secondary radiation. The secondary radiation, termed δ-rays, generates an external region called the penumbra as a consequence of the HZE particle traversing through a medium. It has been estimated that there are approximately 32 cells hit by δ-rays for each cell traversed by a primary HZE particle of 1 GeV/n iron ions (1). The combination of the highly energetic core and δ-rays suggests a more damaging effect of HZE particle radiation compared to that observed from the same dose of low LET radiation. For example, the ratio of double-strand breaks to single-strand breaks is observed to be higher for HZE particle radiation when compared to photon radiation (2). There is evidence that differentially expressed genes respond uniquely to either photons or HZE particles (3). The number and types of gene expression changes attributable to δ-rays are thought to be similar to those expected from exposure to other types of low LET radiation (4). In addition, a significant number of genes not associated with DNA damage have been shown to be responsive to ionizing radiation (5). The response of target genes for products necessary for cell communication, such as those involved with the extracellular matrix (ECM) (6) and gap junctions (e.g., connexin 43) (7), further suggests an important role of ionizing radiation in altering events other than those associated with the DNA damage/repair response.

Ionizing radiation is typically viewed as a genotoxic stress to cells. As such, growth arrest of radiation-damaged cells through the control of cell cycle checkpoints allows the cells to recognize and repair DNA and other damage before DNA synthesis or mitosis occurs (8), whereas apoptosis serves as the means for removing cells with irreparable damage from the cell population. Studies of the effects of low doses have been difficult due to the inherently small changes in gene expression patterns. However, experiments with X- and γ-rays at doses ranging from 0.02 to 20 Gy have previously been successful in demonstrating the effects of low LET radiation on gene expression by microarray analyses (9–12). Low-dose experiments (0.2–2 Gy γ-rays) on peripheral blood cells revealed the induction of genes up to 72 h post-irradiation following 0.2-Gy exposure, whereby a linear dose-response correlation was observed between 0.2 and 2 Gy over the 24-48 h post-irradiation period for selected genes associated with growth arrest, such as CDKN1A/WAF1 and GADD45A (10). Exposures of human fibroblasts to 0.02 and 4 Gy X-rays over a time course of 1–24 h revealed the expression of genes exclusive to low or high-dose exposures, with overlaps (4). While the alteration of gene expression for genes associated with cell-cell signaling and DNA damage response was observed following exposure to a low dose, apoptosis and proliferation genes were modulated following exposure to a high dose of radiation (11).

Selenium is known to be a cancer chemopreventive agent (13) with anticarcinogenic activities against the development of cancers occurring in several different organ systems, such as the prostate, lung and colon (14,15). Selenite and L-selenomethionine (SeM) are the two forms of seleno compounds used in most cancer prevention studies. Although the mechanism for their mode of action is not clear, their ability to promote apoptosis (15) and cytotoxicity (16) in various cancer cell lines suggests a pro-oxidant effect from the inorganic form of selenium. SeM is the organic form of selenium found in selenized yeast supplements and used in clinical trials. The ability of SeM to effectively mitigate oxidative stress in vitro and in vivo (17–19) supports a role for SeM in antioxidant activities. Moreover, SeM treatment was shown to suppress iron ion radiation-induced transformation in human thyroid epithelial cells (HTori-3) (17).

It was reported previously that a 10 cGy dose to HTori-3 cells did not affect cell survival levels, and that a 20 cGy dose led to cell survival levels of approximately 85% in cells exposed to iron ion irradiation (20). In the current study, genomic profiling was performed to assess the effects of non-toxic (10 cGy) and slightly toxic (20 cGy) radiation exposure in cultured HTori-3 cells in the presence and absence of SeM.

Materials and methods

Cell culture and radiation exposure

Human thyroid epithelial cells (HTori-3) were maintained in Dulbecco’s modified Eagle’s medium (DMEM)/F12 supplemented with 1% glutamine and 10% FBS (growth medium). Twenty-four hours prior to irradiation with iron ions, fresh medium with or without 5 μM SeM (Sigma-Aldrich, St. Louis, MO, USA) was added. At the time of radiation exposure, the cells were approximately 80% confluent. Irradiation was performed at the NASA Space Radiation Laboratory (NSRL) facility at the Brookhaven National Laboratory (Upton, NY, USA). Radiation exposure was from 1 GeV/n iron ions delivered as a horizontal beam of approximately 20×20 cm in dimension at a dose rate of approximately 40 cGy/min. Six or 16 h post-irradiation, the cells were harvested and frozen in RNAlater solution (Qiagen, Valencia, CA, USA). Three replicates of two independent experiments were generated for each radiation dose/SeM supplement combination. For sham-irradiated controls, SeM treated or untreated cells were maintained in the same manner as utilized for the irradiated cells at the NSRL facility. For mock SeM pretreatment, the medium was supplemented with phosphate-buffered saline (PBS).

RNA preparation, microarray and real-time RT-PCR

RNA was extracted from frozen cells using the RNeasy kit (Qiagen) according to the manufacturer’s instructions. Each microarray probe was prepared and hybridized at the Penn Bioinformatics Core (University of Pennsylvania) using 1 μg total RNA. First-strand cDNA was synthesized using Superscript II First Strand cDNA Synthesis System (Invitrogen, Carlsbad, CA, USA). Following RNA degradation with RNase H, second-strand cDNA was synthesized with DNA polymerase I and extracted with 25:24:1 (v/v) phenol:chloroform:isoamyl alcohol. The double-stranded cDNA was used as a template to generate biotinylated cRNA using the BioArray HighYield RNA Transcript Labeling kit (Enzo Life Sciences, Farmingdale, NY, USA). The resulting cRNA was purified, fragmented and hybridized to U133Av2 Gene Chips (Affymetrix, Santa Clara, CA, USA) according to the manufacturer’s instructions, and further processed at the Penn Bioinformatics Core.

For real-time RT-PCR analysis, cDNA was initially synthesized with Superscript II using ∼1-2 μg total RNA. Two-step PCR (initial denaturation, 95°C, 30 sec; 40–50 cycles of 95°C, 5 sec and 65°C, 34 sec) was monitored in real-time by the SYBR-Green DNA intercalating dye (SYBR Advantage qPCR Premix; Clontech Laboratories, Inc., Mountain View, CA, USA) according to the manufacturer’s instructions on an Applied Biosystems 7300 Real-Time PCR System instrument. Primers were designed by ProbeFinder (Roche Applied Science, Indianapolis, IN, USA) or Primer Designer (equipped with the LightCycler real-time RT-PCR instrument, Roche Applied Science) with both β-actin and GAPDH serving as reference genes. The primer sequences used are shown in Table I. PCR products were confirmed by melting curve analysis and/or running on 1% agarose gels. cDNA microarray analysis was performed with biological triplicates, whereas n=4–6 for real-time RT-PCR analyses.

Table I.

Primer sets used for real-time RT-PCR experiments.

Table I.

Primer sets used for real-time RT-PCR experiments.

SymbolForward primer (5′→3′)Reverse primer (5′→3′)Amplicon size (nt)
ATF3 TTTGCCATCCAGAACAAGC CATCTTCTTCAGGGGCTACCT121
CDC6 CCTGTTCTCCTCGTGTAAAAGC GTGTTGCATAGGTTGTCATCG73
FAS GTGGACCCGCTCAGTACG TCTAGCAACAGACGTAAGAACCA112
GADD45A TTGCAATATGACTTTGGAGGAA CATCCCCCACCTTATCCAT71
β-actin TCGTGCGTGACATTAAGGACAGGTCTTTGCGGAT258
GAPDH AGCCACATCGCTCAGACAC GCCCAATACGACCAAATCC66

[i] RT-PCR, reverse transcription polymerase chain reaction; nt, nucleotides. ATF3, cyclic adenosine monophosphate-dependent transcription factor; CDC6, cell division cycle 6; FAS, TNF receptor superfamily member 6; GADD45A, growth arrest and DNA damage-inducible protein 45A; GAPDH, glyceraldehyde 3-phosphate dehydrogenase.

Statistical analysis and DAVID

Probe intensities were summarized and normalized using log scale robust multi-array analysis (RMA). ANOVA was performed using the GeneSpring GX software (Agilent, Santa Clara, CA, USA) using a 1.5-fold minimum expression cut-off and a false discovery rate (FDR) of 5%. Determination of differential gene expression was performed using dose (sham irradiation, 10 or 20 cGy exposure), time (6 or 16 h post-irradiation) or SeM treatment as independent variables. The Database for Annotation, Visualization and Integrated Discovery (DAVID) (21) was used for functional annotation and analysis by uploading Affymetrix-based nomenclature of statistically significant genes (1.5-fold expression cut-off; 5% FDR; P<0.05; http://david.abcc.ncifcrf.gov). Gene enrichment for pathway analysis (KEGG pathway) was accomplished by the integrated Expression Analysis System Explorer (EASE), with a count threshold of 2 (minimum number of genes for a particular term) and EASE threshold of 0.1 (a modified Fisher’s exact P-value). The Student’s t-test was used for statistical comparisons of real-time RT-PCR results.

Results

Global gene expression change in response to low-dose iron ion irradiation

To determine the impact of low-dose HZE particle radiation on gene expression, HTori-3 cells were exposed to 10 or 20 cGy iron ion irradiation (in the absence of SeM) and compared to the sham-irradiated cells at 6 h post-irradiation. With the GeneSpring software, global gene expression patterns are illustrated as heatmaps depicting the clustering of gene expression upon exposure to radiation (Fig. 1). Pooled averages from three independent experiments were compared. At a dose of 10 cGy, 121 and 42 unique genes were shown to be up- and downregulated, respectively, following the removal of redundant terms by DAVID. Pathway analysis by the KEGG pathway revealed the upregulation of genes associated with ubiquitin-mediated proteolysis and the p53 signaling pathway (Fig. 1 and Table II). Following an increased exposure to the 20 cGy dose, 285 unique genes were upregulated, while 34 genes were downregulated. Moreover, genes associated with the cell cycle, apoptosis and small cell lung cancer were observed to be upregulated, in addition to the pathways elicited at 10 cGy (Fig. 1 and Table III). No significant pathways were identified by DAVID for down-regulated genes in either the 10 or 20 cGy dose group. As such, the expression of genes consistent with a stress response was observed even at non-toxic doses. In addition, the dose increase (from 10 to 20 cGy) contributed to more stress. Lists of the total number of differentially expressed genes are provided in Tables II and III.

Figure 1

Gene expression profiles of human thyroid epithelial cells (HTori-3) in response to low-dose iron ion irradiation and the associated pathways affected. Cell monolayers were exposed to sham radiation or iron ion radiation (10 or 20 cGy) and processed 6 h after exposure. For L-selenomethionine (SeM) treatment, cell monolayers were sham-treated or treated with 5 μM SeM for 24 h prior to irradiation and similarly processed. The heatmaps depict hierarchical expression clustering, where genes are depicted as upregulated (red) or downregulated (green) using the GeneSpring GX software. Biological triplicates were used for ANOVA analyses, with depicted genes having 1.5-fold gene expression cut-off levels and 5% false discovery rate (FDR). KEGG pathway analysis was performed by the Expression Analysis System Explorer (EASE) algorithm integrated into the Database for Annotation, Visualization and Integrated Discovery (DAVID), setting count threshold=2 and EASE threshold=0.1. The listed pathways are affected by upregulated genes, whereas no pathways were significantly affected by the downregulated genes. A total of 163 and 319 unique genes were identified as responsive to irradiation following removal of redundant terms by DAVID for 10 and 20 cGy doses, respectively.

Table II.

Pathway analysis of gene induction at 10 cGy iron ion irradiation.

Table II.

Pathway analysis of gene induction at 10 cGy iron ion irradiation.

SymbolAccession No.Gene nameaFold changePathway affected
SKP2NM_005983S-phase kinase-associated protein 22.2Ubiquitin-mediated proteolysis
CUL2NM_003591Cullin 21.8Ubiquitin-mediated proteolysis
UBE2G2NM_003343Ubiquitin-conjugating enzyme E2 G21.5Ubiquitin-mediated proteolysis
DDB2NM_000107Damage-specific DNA binding protein 21.6Ubiquitin-mediated proteolysis, p53 signaling
MDM2NM_002392Double minute 21.7Ubiquitin-mediated proteolysis, p53 signaling
FASNM_000043Fas (TNF receptor superfamily, member 6)1.7Ubiquitin-mediated proteolysis, p53 signaling

a Genes represented are those out of 124 unique transcripts observed to be upregulated and identified to affect the stated signaling pathways. Genes exhibiting ≥1.5-fold expression and 5% false discovery rate (FDR) were considered significant and uploaded for analysis.

Table III.

Pathway analysis of gene induction at 20 cGy iron ion irradiation.

Table III.

Pathway analysis of gene induction at 20 cGy iron ion irradiation.

SymbolAccession No.Gene nameaFold changePathway affected
SKP2NM_005983S-phase kinase-associated protein 22.1Ubiquitin-mediated proteolysis
CUL5AAB70253Cullin 51.5Ubiquitin-mediated proteolysis
WWP1NM_007013WW domain containing E3 ubiquitin protein ligase 11.5Ubiquitin-mediated proteolysis
CUL3AAC28621Cullin 31.5Ubiquitin-mediated proteolysis
CUL2NM_003591Cullin 21.8Ubiquitin-mediated proteolysis
CUL4BAAB67315Cullin 4B1.5Ubiquitin-mediated proteolysis
SKP1NM_006930S-phase kinase-associated protein 1A1.6Ubiquitin-mediated proteolysis
PIAS2AAC36704Protein inhibitor of activated STAT, 21.5Ubiquitin-mediated proteolysis
DDB2NM_000107Damage-specific DNA binding protein 21.7p53 signaling
FASNM_000043Fas (TNF receptor superfamily, member 6)2.3p53 signaling
TNFRSF10BNM_003842TNF receptor superfamily, member 10B1.8p53 signaling
GADD45ANM_001924Damage-specific DNA binding protein 21.6p53 signaling, cell cycle
CDK2NM_001798Cyclin-dependent kinase 21.7p53 signaling, cell cycle
SKP2NM_005983S-phase kinase-associated protein 22.1p53 signaling, cell cycle
BUB3AAC06258Budding uninhibited by benzimidazoles 3 homolog (yeast)1.7Cell cycle
YWHAZNM_003406Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide1.5Cell cycle
SKP1NM_006930S-phase kinase-associated protein 1A1.6Cell cycle
RIPK1NM_003804Receptor (TNFRSF)-interacting serine-threonine kinase 11.7Apoptosis
FASNM_000043Fas (TNF receptor superfamily, member 6)2.3Apoptosis
BCL2L1NM_001191BCL2-like 11.5Apoptosis
TNFRSF10BNM_003842TNF receptor superfamily, member 10B1.8Apoptosis
CFLARNM_003879Tumor necrosis factor receptor superfamily, member 10B1.5Apoptosis
SKP2NM_005983S-phase kinase-associated protein 22.1Small cell lung cancer
CDK2NM_001798Cyclin-dependent kinase 21.7Small cell lung cancer
BCL2L1NM_001191BCL2-like 11.5Small cell lung cancer
TRAF3AAA56753TNF receptor-associated factor 31.5Small cell lung cancer
PIAS2AAC36704Protein inhibitor of activated Stat, 21.5Small cell lung cancer

a Genes represented are those out of 285 unique transcripts observed to be upregulated and identified to affect the stated signaling pathways.

SeM pretreatment alone promotes the upregulation of genes

HTori-3 cells were pretreated with 5 μM SeM for 24 h, processed 6 h post-sham irradiation, and compared to the control cells (mock SeM pretreatment and sham irradiation). In comparison to the untreated cells, 100 unique transcripts were differentially modulated, with 97 and 3 genes up- or down-regulated (Fig. 1 and Table IV). Pathway analysis revealed that the upregulation of genes was associated with the cell cycle and pentose phosphate pathway, with no identifiable pathways affected by the downregulated genes.

Table IV.

Pathway analysis of gene modulation after SeM treatment in sham-irradiated cells and in cells exposed to a 10 cGy dose of radiation.

Table IV.

Pathway analysis of gene modulation after SeM treatment in sham-irradiated cells and in cells exposed to a 10 cGy dose of radiation.

SymbolAccession No.Gene nameaFold changePathway affected
Sham-irradiated
  CCND3NM_001760Cyclin D31.5Cell cycle
  CDC20NM_001255Cdc20 cell division cycle 20 homolog (S. cerevisiae)1.5Cell cycle
  MAD1L1NM_001013836Mad1 mitotic arrest deficient-like 1 (yeast)2.0Cell cycle
  CCND1NM_053056Cyclin D11.5Cell cycle
  BUB1AAB97855Budding uninhibited by benzimidazoles 1 homolog1.5Cell cycle
  PGM3NM_015599Phosphoglucomutase 31.9Pentose phosphate
  GPINM_000175Glucose phosphate isomerase1.7Pentose phosphate
  PGDNM_002631Phosphogluconate dehydrogenase1.7Pentose phosphate
10 cGyb
  PGDNM_002631Phosphogluconate dehydrogenase1.5Pentose phosphate, glycolysis/gluconeogenesis
  PGM3NM_015599Phosphoglucomutase 31.6Pentose phosphate glycolysis/gluconeogenesis
  GPINM_000175Glucose phosphate isomerase1.7Pentose phosphate glycolysis/gluconeogenesis
  ENO1NM_001428Enolase 11.9 Glycolysis/gluconeogenesis
  METNM_000245Met proto-oncogene0.6Adherens junction
  IQGAP1NM_003870IQ motif containing GTPase activating protein 10.6Adherens junction

a Genes represented are those out of 97 unique transcripts observed to be upregulated and identified to affect the stated signaling pathways for sham-irradiation with SeM treatment.

b 6 h post-irradiation. For 10 cGy irradiation and SeM treatment, 61 unique transcripts were modulated. SeM, L-selenomethionine.

SeM supplementation mitigates gene expression associated with the cellular stress response from 10 cGy irradiation

As shown in Fig. 2A, SeM supplementation in irradiated cell cultures resulted in a reduction in the number of regulated genes representing less than half of the total differentially expressed transcripts, in comparison to the untreated population. Cells were irradiated with 10 cGy iron ions in the absence and presence of SeM pretreatment and processed 6 h post-irradiation. Datasets from both radiation treatments were initially compared pairwise to the sham-irradiated samples and then compared for SeM treatment. Upon SeM pretreatment, ubiquitin-mediated proteolysis and p53 signaling (Table II) were no longer significant. Moreover, genes associated with the pentose phosphate pathway and glycolysis/gluconeogenesis were upregulated. Of the stress-related genes represented in the microarray data, CDC6, GADD45A and FAS were shown to be downregulated in irradiated cells pretreated with SeM, as compared to radiation alone (Fig. 3). Additionally, the well-characterized stress response gene, ATF3 (22), which showed a significant increase in expression in response to irradiation, was observed to be downregulated when supplemented with SeM (Fig. 3). Taken together, the downregulation of these genes associated with the cellular stress response by SeM in irradiated cells may be indicative of the ability of SeM to mitigate cellular stress resulting from radiation treatment.

Figure 2

Venn diagrams comparing the effects of SeM treatment on gene expression. (A) Comparison of upregulated genes in cells exposed to a 10 cGy dose in the absence and presence of SeM and processed 6 h after exposure. Corresponding genes and fold induction are shown in Table II. (B) Comparison of total genes affected by SeM pretreatment at varying radiation doses and processed 16 h after exposure. At 20 cGy, genes associated with cell communication are observed to be downregulated and are shown in Table V. Corresponding pathways affected by the treatments are listed below each diagram for both panels. The numbers of altered genes common to treatment comparisons are shown but did not significantly contribute to functional analysis. SeM, L-selenomethionine.

Figure 3

Real-time RT-PCR results of putative genes associated with stress response. Relative expression (fold change) of mRNA transcripts are shown for sham-irradiated controls (clear), SeM-pretreated (gray) and irradiated, mock SeM-pretreated (black) cells. Representative radiation doses are shown for each group (0 and 10 cGy). *P< 0.05 and **P<0.001. Values are means ± SEM for n=4–6. SeM, L-selenomethionine.

SeM supplementation downregulates cell communication genes following an extended period post-irradiation

Having observed the ability of SeM to mitigate radiation-induced activation of stress-associated pathways at 6 h post-irradiation, the ability of the cells to recover was further examined with an extended recovery period. Cells exposed to a 10 cGy dose yielded negligible gene modulation when processed 16 h post-irradiation, thereby suggesting the ability of the cells to recover with time (Fig. 2B). Attempts to observe cells in the absence of SeM supplementation following 10 cGy exposure at 16 h post-irradiation also yielded negligible activation of pathways (data not shown). However, upon exposure to 20 cGy and in the presence of SeM, certain genes associated with cell communication were observed to be downregulated, when compared to the gene expression levels in irradiated cells (Fig. 2B). Particularly, the suppression of genes encoding for integrin αv, fibronectin 1 (FN1) and type IV collagen (Table V) may suggest the ability of SeM to curtail aggressive cell behavior following exposure to a higher dose of radiation.

Table V.

Pathway analysis of downregulated genes in response to SeM treatment with cells harvested at 16 h post-irradiation.**

Table V.

Pathway analysis of downregulated genes in response to SeM treatment with cells harvested at 16 h post-irradiation.**

SymbolAccession No.Gene nameaFold changePathway affected
10 cGy
  No identifable pathways
20 cGy
  METNM_000245Met proto-oncogene0.7Focal adhesion
  VCLNM_003373Vinculin0.6Focal adhesion
  ITGAVNM_002210Integrin, alpha V0.6Focal adhesion, extracellular matrix receptor interaction
  LAMB1NM_002291Laminin, beta 10.5Focal adhesion, cell communication, extracellular matrix receptor interaction
  TNCNM_002160Tenascin C0.3Focal adhesion, cell communication, extracellular matrix receptor interaction
  THBS1NM_003246Thrombospondin 10.6Focal adhesion, cell communication, extracellular matrix receptor interaction
  COL4A2NM_001846Collagen, type IV, alpha 20.5Focal adhesion, cell communication, extracellular matrix receptor interaction
  COL4A1NM_001845Collagen, type IV, alpha 10.5Focal adhesion, cell communication, extracellular matrix receptor interaction
  FN1NM_002026Fibronectin 10.5Focal adhesion, cell communication, extracellular matrix receptor interaction
  LAMC1NM_002293Laminin, gamma 10.5Focal adhesion, cell communication, extracellular matrix receptor interaction
  DSC3NM_001941Desmocollin 30.6Cell communication
  DSG2AAH99655Desmoglein 20.6Cell communication
  CDH2NM_001792Cadherin 2, type 1, n-cadherin0.6Cell adhesion molecules
  PTPRFNM_002840Protein tyrosine phosphatase, receptor type F0.7Cell adhesion molecules
  NEO1NM_002499Neogenin homolog 10.7Cell adhesion molecules
  GLG1NM_012201Golgi apparatus protein 10.6Cell adhesion molecules
  VCANNM_004385Chondroitin sulfate proteoglycan 2 (Versican)0.4Cell adhesion molecules
  NCAM1NM_000615Neural cell adhesion molecule 10.6Cell adhesion molecules
  ITGAVNM_002210Integrin, alpha V0.6Cell adhesion molecules, small cell lung cancer
  COL4A1NM_001845Collagen, type IV, alpha 10.5Small cell lung cancer
  FN1NM_001846Fibronectin 10.5Small cell lung cancer
  COL4A2NM_002026Collagen, type IV, alpha 20.5Small cell lung cancer
  LAMB1NM_002291Laminin, beta 10.5Small cell lung cancer, Prion disease
  LAMC1NM_002293Laminin, gamma 10.6Small cell lung cancer, Prion disease
  HSPA5NM_005347Heat shock 70 kDa protein 50.5Prion disease
  PTPRFNM_002840Protein tyrosine phosphatase, receptor type F0.6Adherens junction
  INSRNM_000208Insulin receptor0.6Adherens junction
  METNM_000245Met proto-oncogene0.7Adherens junction
  VCLNM_003373Vinculin0.6Adherens junction

a With SeM treatment of the 10 cGy irradiated cells, 15 genes were observed to be downregulated, but no significant effects on signaling pathways were observed. In contrast, with SeM treatment of the 20 cGy irradiated cells, genes are represented out of 123 unique transcripts observed to be downregulated and identified to affect the stated signaling pathways. SeM, L-selenomethionine.

Discussion

Selenium is a promising cancer chemopreventive agent; its contribution to antioxidant activities is thought to be a likely mode of action. SeM has also been shown to contribute to the mitigation of radiation-induced oxidative stress (17–19). Since SeM alone is redox-inactive, the antioxidant contribution is expected to be indirect. Specifically, SeM is a nutritional source of selenium cofactor for selenoproteins and enzymes, such as glutathione peroxidase and thioredoxin reductase (13), which serve as essential antioxidant enzymes with activities which protect against oxidative stress. Indeed, the function of certain transcription factors associated with oxidative stress, including p53 (23,24), AP-1 (25) and NF-κB (25,26), are known to be oxidant-sensitive and maintained in the active state through reduction. Thus, SeM may contribute to downstream signaling via the modulation of the oxidation state of these key transcription factors during a stress response.

The signaling events associated with selenium treatment have been shown to target malignant cell lines, while sparing normal cells. For example, SeM has the ability to selectively induce apoptosis and growth arrest in cancerous, but not normal, human prostate cells (27). Likewise, gene profiling of premalignant lesions in rat mammary glands and cultured human mammary epithelial cells treated with methylseleninic acid (a potent pro-oxidant form of selenium) revealed the modulation of regulatory genes linked to cell cycle and apoptosis, properties consistent with a role in the reduction of lesion development or the death of the premalignant cells (28,29). Mechanistically, SeM treatment was shown to promote growth inhibition in human colon cancer cells through the phosphorylation of histone H3 via the activation of MAPK extracellular regulated kinase (ERK) and subsequent phosphorylation of the ribosomal S6 kinase (RSK) (30,31). Recently, the ability of selenium to alter the ECM and stroma has been suggested as being responsible for its cancer chemopreventive potential (32). A comparison of both normal and malignant prostate cell lines adapted to Se-methylselenocysteine (a source of selenium in alliums) for one month, in order to achieve steady-state selenium levels, revealed significant modulation of ECM-associated genes, such as collagens (32). As such, we observed various gene products associated with cell-cell and cell-ECM communication to be downregulated when treated with SeM and processed 16 h after 20 cGy irradiation (Table V). Although the significance of this observation is unclear, the contributions to stromal remodeling (from the alteration of ECM gene products) and cell-cell communication may suggest a possible mechanism for the chemopreventive property of selenium. As SeM suppresses radiation transformation when applied to cultures of irradiated HTori-3 cells at time periods of longer than 16 h post-irradiation (Ware et al, unpublished data), the effects of SeM at 16 h post-irradiation may be particularly significant for understanding the mechanism(s) by which SeM suppresses radiation transformation in vitro.

Our results demonstrate the ability of low-dose HZE particle radiation to elicit changes in global gene expression consistent with a stress response. The activation of genes associated with cell cycle checkpoint (CDC6), apoptosis (GADD45A and FAS) and general stress response (ATF3) is consistent with a scenario of cellular growth arrest and repair. Whereas SeM mitigates the expression of genes associated with the stress response brought about following a short period of time (6 h) post-irradiation, SeM effects on gene expression patterns at a longer period of time post-irradiation (16 h) indicate that it potentially alters cell behavior by modulating the expression of genes associated with cell adhesion.

Acknowledgements

This study was supported by a grant from the National Aeronautics and Space Administration (NASA; No. NAG9-1517) and an NIH Training Grant (No. 2T32CA009677).

References

1. 

Brooks A, Bao S, Rithidech K, Couch LA and Braby LA: Relative effectiveness of HZE iron-56 particles for the induction of cytogenetic damage in vivo. Radiat Res. 155:353–359. 2001. View Article : Google Scholar : PubMed/NCBI

2. 

Nelson GA: Fundamental space radiobiology. Gravit Space Biol Bull. 16:29–36. 2003.PubMed/NCBI

3. 

Nelson GA, Jones TA, Chesnut A and Smith AL: Radiation-induced gene expression in the nematode Caenorhabditis elegans. J Radiat Res. 43(Suppl): S199–S203. 2002. View Article : Google Scholar : PubMed/NCBI

4. 

Ding LH, Shingyoji M, Chen F, et al: Gene expression profiles of normal human fibroblasts after exposure to ionizing radiation: a comparative study of low and high doses. Radiat Res. 164:17–26. 2005. View Article : Google Scholar : PubMed/NCBI

5. 

Fornace AJ Jr, Amundson SA, Bittner M, Myers TG, Meltzer P, Weinsten JN and Trent J: The complexity of radiation stress responses: analysis by informatics and functional genomics approaches. Gene Expr. 7:387–400. 1999.PubMed/NCBI

6. 

Barcellos-Hoff MH: The potential influence of radiation-induced microenvironments in neoplastic progression. J Mammary Gland Biol Neoplasia. 3:165–175. 2002. View Article : Google Scholar : PubMed/NCBI

7. 

Azzam EI, de Toledo SM and Little JB: Expression of CONNEXIN43 is highly sensitive to ionizing radiation and other environmental stresses. Cancer Res. 63:7128–7135. 2003.PubMed/NCBI

8. 

Zhou BB and Elledge SJ: The DNA damage response: putting checkpoints in perspective. Nature. 408:433–439. 2000. View Article : Google Scholar : PubMed/NCBI

9. 

Amundson SA, Do KT and Fornace AJ Jr: Induction of stress genes by low doses of gamma rays. Radiat Res. 152:225–231. 1999. View Article : Google Scholar : PubMed/NCBI

10. 

Amundson SA, Bittner M, Meltzer P, Trent J and Fornace AJ Jr: Induction of gene expression as a monitor of exposure to ionizing radiation. Radiat Res. 156:657–661. 2001. View Article : Google Scholar : PubMed/NCBI

11. 

Ding LH, Shingyoji M, Chen F, Chatterjee A, Kasai KE and Chen DJ: Gene expression changes in normal human skin fibroblasts induced by HZE-particle radiation. Radiat Res. 164:523–526. 2005. View Article : Google Scholar : PubMed/NCBI

12. 

Franco N, Lamartine J, Frouin V, Le Minter P, et al: Low-dose exposure to gamma rays induces specific gene regulations in normal human keratinocytes. Radiat Res. 163:623–635. 2005. View Article : Google Scholar : PubMed/NCBI

13. 

Combs GF Jr and Gray WP: Chemopreventive agents: selenium. Pharmacol Ther. 79:179–192. 1998. View Article : Google Scholar : PubMed/NCBI

14. 

Clark LC, Combs GF Jr, Turnbull BW, Slate EH, et al: Effects of selenium supplementation for cancer prevention in patients with carcinoma of the skin. A randomized controlled trial Nutritional Prevention of Cancer Study Group JAMA. 276:1957–1963. 1996.

15. 

Lu J, Kaeck M, Jiang C, Wilson AC and Thompson HJ: Selenite induction of DNA strand breaks and apoptosis in mouse leukemic L1210 cells. Biochem Pharmacol. 47:1531–1535. 1994. View Article : Google Scholar : PubMed/NCBI

16. 

Garberg P, Stahl A, Warholm M and Hogberg J: Studies of the role of DNA fragmentation in selenium toxicity. Biochem Pharmacol. 37:3401–3406. 1988. View Article : Google Scholar : PubMed/NCBI

17. 

Kennedy AR, Ware JH, Guan J, Donahue JJ, et al: Selenomethionine protects against adverse biological effects induced by space radiation. Free Radic Biol Med. 36:259–266. 2006. View Article : Google Scholar : PubMed/NCBI

18. 

Guan J, Wan XS, Zhou Z, Ware J, Donahue JJ, Biaglow JE and Kennedy AR: Effects of dietary supplements on space radiation-induced oxidative stress in Sprague-Dawley rats. Radiat Res. 162:572–579. 2004. View Article : Google Scholar : PubMed/NCBI

19. 

Guan J, Stewart J, Ware JH, Zhou Z, Donahue JJ and Kennedy AR: Effects of dietary supplements on the space radiation-induced reduction in total antioxidant status in CBA mice. Radiat Res. 165:373–378. 2006. View Article : Google Scholar : PubMed/NCBI

20. 

Wan XS, Ware JH, Zhou Z, Donahue JJ, Guan J and Kennedy AR: Protection against radiation-induced oxidative stress in cultured human epithelial cells by treatment with antioxidant agents. Int J Radiat Oncol Biol Phys. 64:1475–1481. 2006. View Article : Google Scholar : PubMed/NCBI

21. 

Dennis G Jr, Sherman BT, Hosack DA, Yang J, Gao W, Lane HC, et al: DAVID: Database for annotation, visualization, and integrated discovery. Genome Biol. 4:P32003. View Article : Google Scholar : PubMed/NCBI

22. 

Hai T, Wolfgang CD, Marsee DK, Allen AE and Sivaprasad U: ATF3 and stress responses. Gene Expr. 7:321–335. 1999.

23. 

Gaiddon C, Moorthy NC and Prives C: Ref-1 regulates the trans-activation and pro-apoptotic functions of p53 in vivo. EMBO J. 18:5609–5621. 1999. View Article : Google Scholar : PubMed/NCBI

24. 

Seo YR, Kelley MR and Smith ML: Selenomethionine regulation of p53 by a ref1-dependent redox mechanism. Proc Natl Acad Sci USA. 99:14548–14553. 2002. View Article : Google Scholar : PubMed/NCBI

25. 

Gius D, Botero A, Shah S and Curry HA: Intracellular oxidation/reduction status in the regulation of transcription factors NF-kappaB and AP-1. Toxicol Lett. 106:93–106. 1999. View Article : Google Scholar : PubMed/NCBI

26. 

Reynaert NL, van der Vliet A, Guala AS, McGovern T, Hristova M, Pantano C, et al: Dynamic redox control of NF-kappaB through glutaredoxin-regulated S-glutathionylation of inhibitory kappaB kinase beta. Proc Natl Acad Sci USA. 103:13086–13091. 2006. View Article : Google Scholar : PubMed/NCBI

27. 

Menter DG, Sabichi AL and Lippman SM: Selenium effects on prostate cell growth. Cancer Epidemiol Biomarkers Prev. 9:1171–1182. 2000.PubMed/NCBI

28. 

Dong Y, Ip C and Ganther H: Evidence of a field effect associated with mammary cancer chemoprevention by methylseleninic acid. Anticancer Res. 22:27–32. 2007.PubMed/NCBI

29. 

Dong Y, Ganther HE, Stewart C and Ip C: Identification of molecular targets associated with selenium-induced growth inhibition in human breast cells using cDNA microarrays. Cancer Res. 62:708–714. 2002.PubMed/NCBI

30. 

Goulet AC, Chigbrow M, Frisk P and Nelson M: Selenomethionine induces sustained ERK phosphorylation leading to cell-cycle arrest in human colon cancer cells. Carcinogenesis. 26:109–117. 2005. View Article : Google Scholar : PubMed/NCBI

31. 

Goulet AC, Watts G, Lord JL and Nelson MA: Profiling of selenomethionine responsive genes in colon cancer by microarray analysis. Cancer Biol Ther. 6:494–503. 2007. View Article : Google Scholar : PubMed/NCBI

32. 

Hurst R, Elliott RM, Goldson AJ and Fairweather-Tait SJ: Se-methylselenocysteine alters collagen gene and protein expression in human prostate cells. Cancer Lett. 269:117–126. 2008. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Nuth M and Kennedy AR: Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress. Oncol Lett 6: 35-42, 2013.
APA
Nuth, M., & Kennedy, A.R. (2013). Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress. Oncology Letters, 6, 35-42. https://doi.org/10.3892/ol.2013.1362
MLA
Nuth, M., Kennedy, A. R."Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress". Oncology Letters 6.1 (2013): 35-42.
Chicago
Nuth, M., Kennedy, A. R."Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress". Oncology Letters 6, no. 1 (2013): 35-42. https://doi.org/10.3892/ol.2013.1362
Copy and paste a formatted citation
x
Spandidos Publications style
Nuth M and Kennedy AR: Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress. Oncol Lett 6: 35-42, 2013.
APA
Nuth, M., & Kennedy, A.R. (2013). Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress. Oncology Letters, 6, 35-42. https://doi.org/10.3892/ol.2013.1362
MLA
Nuth, M., Kennedy, A. R."Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress". Oncology Letters 6.1 (2013): 35-42.
Chicago
Nuth, M., Kennedy, A. R."Mitigating effects of L‑selenomethionine on low‑dose iron ion radiation‑induced changes in gene expression associated with cellular stress". Oncology Letters 6, no. 1 (2013): 35-42. https://doi.org/10.3892/ol.2013.1362
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team