This article is mentioned in:

Introduction

Lung cancer ranks among the highest in incidence and mortality rates of common malignant tumors both in China and worldwide (1,2). In 2018, it was estimated that there were 2.1 million new cases of lung cancer and 1.8 million related deaths globally, with China accounting for 37% of new cases and 39.2% of lung cancer related-deaths (1). Non-small cell lung cancer (NSCLC), the most common histological type of lung cancer, primarily comprises squamous cell carcinoma and adenocarcinoma (3). Significant advancements in the treatment of NSCLC, including surgery, chemotherapy, radiation therapy, targeted therapy and immunotherapy, have been made, particularly for patients with specific genetic mutations. However, the overall prognosis improvement for the entire population of patients with NSCLC varies due to individual differences, genetic characteristics and responses to treatment (4,5).

The development of tumor immunotherapy has made a major breakthrough in the treatment of tumors (6). Numerous studies have reported that immunotherapy with immune-checkpoint inhibitors targeting programmed death 1 (PD-1)/programmed death ligand 1 (PD-L1) has marked antitumor effects in several malignant tumors, such as hepatocellular carcinoma (7), melanoma (8), NSCLC (9) and head and neck cancer (10). However, the majority of patients with NSCLC do not respond to this type of immunotherapy (11). This is due to the fact that cancer cells can evade immune attack by manipulating immune surveillance mechanisms (12). Therefore, actively elucidating the mechanism of action may be a key breakthrough in improving NSCLC immunotherapy.

PD-1 is an important immunosuppressive molecule expressed on the surface of T cells. Once PD-L1 binds to PD-1 in tumor cells, it transmits a ‘brake’ signal to T cells, inhibiting the activation of T cells, thereby preventing the immune system from killing cancer cells (13,14). Studies have revealed that PD-L1 expression is elevated in a series of malignant tumors, including NSCLC, and is associated with poor prognosis and shortened patient survival (15,16). Treatment that inhibits PD-1 or PD-L1 improves the survival of patients with advanced NSCLC (17).

As an important non-coding RNA, circular (circ) RNA can regulate the immune escape of tumors mediated by PD-1/PD-L1 in several ways and promote further development of tumors. A previous study reported that circCHST15 targeting microRNA (miR)-155-5p and miR-194-5p up-regulated the expression of PD-L1, affected the function of CD8+T cells and promoted the immune escape of lung adenocarcinoma cells (18). Another study reported that circHSP90A inhibited the progression of NSCLC by regulating the signal transducer and activator of transcription 3 signaling and the PD-1/PD-L1 checkpoint to activate antitumor immunity (19). Such evidence demonstrates the great potential of circRNA as an effective and specific biomarker in the immunotherapeutic targeting of NSCLC.

CircENTPD7, a circRNA, is upregulated in glioblastoma and targets the regulation of ROS proto-oncogene 1, receptor tyrosine kinase expression to promote tumor progression (20). Our previous study demonstrated that upregulation of circENTPD7 expression in NSCLC tissues and cells, along with high circENTPD7 levels, predicted a lower survival rate of patients with NSCLC (21). However, the behavioral and regulatory mechanisms of circENTPD7 in inducing immune responses during NSCLC cell progression have not been fully elucidated. Therefore, the present study aimed to elucidate the specific role of circENTPD7 in NSCLC, particularly in the progression of immune escape, and its potential relationship with PD-L1. Overall, the results of the present study provide novel insights into the mechanisms of NSCLC, providing a molecular basis for clinical diagnosis and precision drug therapy.

Materials and methods

Cell culture

Human normal lung epithelial BEAS-2B cells, human NSCLC H1299 cells and human 293T cells were purchased from Wuhan Elabscience Biotechnology Co., Ltd. BEAS-2B cells were grown in a Dulbecco's Modified Eagle Medium (DMEM; Gibco; Thermo Fisher Scientific, Inc.), whereas H1299 cells were grown in a Roswell Park Memorial Institute 1640 complete medium (Gibco; Thermo Fisher Scientific, Inc.). Activated peripheral blood mononuclear cells (PBMCs) were purchased from IPHASE, Inc. (cat. no. 082A01.11). PBMCs were grown in Human peripheral blood mononuclear cells special medium (cat. no. IMP-H022-1; Immocell; Xiamen Yimo Biotechnology Co., Ltd.). All cells were cultured in a 5% CO2 incubator at 37°C.

RNA interference and plasmid transfection

Sangon Biotech Co., Ltd. designed small interfering (si)RNA (si-circENTPD7 and si-PD-L1) and lentivirus pLV-eGFP-N-Puro-specifically targeting circENTPD7 or PD-L1 overexpression (OE)-insulin-like growth factor 2 (IGF2) mRNA-binding protein 2 (IGF2BP2) expression vectors (OE-IGF2BP2) and their negative control (NC) empty vectors (si-NC and OE-NC). The lentiviral plasmid was transfected into H1299 cells using Lipofectamine™ 3000 (Invitrogen™; Thermo Fisher Scientific, Inc.), according to the supplier's guidelines. The concentration of nucleic acid used was 0.75 µg. Follow-up experiments were performed 48 h after transfection in room temperature. The siRNA-circENTPD7 and siRNA-PD-L1 sequences were as follows: circENTPD7 siRNA-1 forward, 5′-UAUAUUGAUUCAAAAGGACCU-3′ and reverse, 3′-GUCCUUUUGAAUCAAUAUACA-5′; circENTPD7 siRNA-2 forward, 5′-UGUAUAUUGAUUCAAAAGGAC-3′ and reverse, 5′-CCUUUUGAAUCAAUAUACAAA-3′; circENTPD7 siRNA-3 forward, 5′-UUGUAUAUUGAUUCAAAAGGA-3′ and reverse, 5′-CUUUUGAAUCAAUAUACAAAG-3′; PD-L1 siRNA-1 forward, 5′-AUAAAGACAGCAAAUAUCCUC-3′ and reverse, 5′-GGAUAUUUGCUGUCUUUAUAU-3′; PD-L1 siRNA-2 forward, 5′-UAUAAAGACAGCAAAUAUCCU-3′ and reverse, 5′-GAUAUUUGCUGUCUUUAUAUU-3′; PD-L1 siRNA-3 forward, 5′-AGUUGUUGUGUUGAUUCUCAG-3′ and reverse, 5′-GAGAAUCAACACAACAACUAA-3′; si-NC forward, 5′-CACCGTTCTCCGAACGTGTCACGTTTCAAGAGAACGTGACACGTTCGGAGAATTTTTTG-3′ and reverse, 5′-GATCCAAAAAATTCTCCGAACGTGTCACGTTCTCTTGAAACGTGACACGTTCGGAGAAC-3′.

Cell counting kit-8 assay for cell viability

The viability of H1299 cells was assessed using the Cell Counting Kit-8 proliferation assay kit (cat. no. CEB044Hu; BIOSS). The duration of incubation with CCK-8 reagent was 2 h. Absorption was measured at a wavelength of 450 nm, with all procedures performed according to the kit manual.

Transwell assay

Cell migration and invasion were assessed in Transwell Petri dishes with or without Matrigel (Corning, Inc.). Briefly, transfected H1299 cells (2×105) were added to 100 µl serum-free medium (Gibco; Thermo Fisher Scientific, Inc.) and seeded into the upper chamber, and then 500 µl DMEM containing 10% serum (Shanghai ExCell Biology, Inc.) was seeded into the lower chamber. The cells in the upper chamber were incubated for 24 h in a 5% CO2 incubator at 37°C and then fixed with 4% paraformaldehyde (Beyotime Institute of Biotechnology) for 10 min at room temperature. After cell staining with 0.2–0.5% crystal violet (Sigma-Aldrich; Merck KGaA) for 10 min at room temperature, the cells were observed under an inverted optical microscope (Shanghai Optical Instrument Factory) and statistically analyzed. The migration assay was similar to the invasion assay, except that Matrigel was not used.

Co-culture of H1299 cells and T cells

Activated peripheral blood mononuclear cells (PBMCs) were purchased from IPHASE, Inc. (cat. no. 082A01.11). First, CD4+ (CD3+ and CD4+) and CD8+ (CD3+ and CD8+) cells were purified from human PBMCs using the EasySep™ Human T cell Isolation Kit (cat. no. 17952; NovoBiotechnology). Subsequently, the % of CD4+ and CD8+ cells in the total PBMC was analyzed using a FACScan device. T cells were then stained with 5 µM FITC for 10 min, and 5×105 T cells were co-cultured with the treated H1299 cells in the medium. Subsequently, recombinant human lL-2 (20 IU/ml; cat. no. 90103ES60; Shanghai Yeasen Biotechnology Co. Ltd.), anti-CD3 (2 µg/ml; cat no. ab16669; Abcam) and anti-CD28 (1 µg/ml; cat. no. ab243228; Abcam) antibodies were added to the medium. T cells were then collected and assessed using an Attune NxT flow cytometer (Invitrogen; Themo Fisher Scientific, Inc.) after 48 h of culture.

ELISA analysis

The culture medium supernatant of the co-culture system was collected. According to the manufacturer's guidelines, the human interferon-γ [IFN-γ; cat. no. EK180; Multi Sciences (Lianke) Biotech Co., Ltd.], human IL-2 [cat. no. EK102; Multi Sciences (Lianke) Biotech Co., Ltd.] and human transforming growth factor β (TGF-β; cat. no. JL20082; Shanghai Future Industrial Co., Ltd.) ELISA kits were used to detect IFN-γ, IL-2 and TGF-β concentrations in the H1299 cells, respectively.

Reverse transcription (RT)-quantitative (q)PCR experiment

Total RNA was extracted from BEAS-2B and H1299 cells using the FastPure Cell/Tissue Total RNA Isolation Kit V2 (cat. no. RC112; Vazyme Biotech Co., Ltd.). RT of circRNA/mRNA was performed using the HiScript III 1st Strand cDNA Synthesis Kit (cat. no. R111-01/02; Vazyme Biotech Co., Ltd.). The temperature protocol used was as follows: 37°C for 15 min and 85°C for 5 sec. qPCR (22) was performed using the Taq Pro Universal SYBR qPCR Master Mix (cat. no. Q712; Vazyme Biotech Co., Ltd.). The thermocycling conditions were as follows: 95°C for 10 sec, 60°C for 30 sec and 95°C for 15 sec. The relative expression levels of the miRNAs were calculated using the 2−ΔΔCq method (23). GAPDH was used as an internal reference for mRNA/circRNA. The primers used are listed in Table I.

Table I. Primer sequences.

Table I.

Primer sequences.

Gene	Direction	Primer sequence (5′-3′)
CircENTPD7	F	ATGCCAGTGATTACCTTCGT
	R	CTTCAAGCTCCCCTACTC
IGF2BP2	F	AGAAAAGAGAACTCTGGAGCTG
	R	CAGCCAGCATATCATTTTCAAAGG
PD-L1	F	ACTTAAAAGGCCCAAGCACTG
	R	ACATGACAAGAAGACCTCACAG
GAPDH	F	GGTCTCCTCTGACTTCAACA
	R	GTGAGGGTCTCTCTCTTCCT

[i] CircENTPD7, circular RNA ENTPD7 (hsa_circ_0019421); IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; PD-L1, programmed death ligand 1; F, forward; R, reverse.

Western blotting

Protein was extracted from the BEAS-2B and H1299 cells using a radio-immunoprecipitation assay lysis buffer (Biosharp Life Sciences). Protein quantification was determined by the BCA method. Proteins with a volume of 10 µl and a mass of 20 µg were then loaded onto an sodium dodecyl sulfate-polyacrylamide gel electrophoresis gel (10% separating gel and 5% compression gel, BioFroxx; neoFroxx GmbH) and transferred to a polyvinylidene fluoride membrane after electrophoresis. The membranes were blocked by shaking at room temperature for 20–40 min using a rapid closure solution (cat. no. P0252; 500 ml; Beyotime Institute of Biotechnology). Subsequently, the membrane was incubated with the following primary antibodies overnight at 4°C in a solution containing 5% skim milk powder (BioFroxx; neoFroxx GmbH): EPR6741 (1:2,000; cat. no. ab124930; Abcam), anti-PD-L1 (1:1,000; cat. no. ab205921; Abcam) and anti-GAPDH (1:10,000; cat. no. ab8245; Abcam). The corresponding secondary antibodies Goat Anti-Rabbit IgG H&L (HRP; 1:20,000; cat. no. bs-0295G-HRP; Abcam) and Goat Anti-Mouse IgG H&L (HRP; 1:20,000; cat. no. bs-0296G-HRP; Abcam) were then added for another 2 h of incubation. Finally, an enhanced chemiluminescence kit (cat. no. T15139; NCM Biotech) was used for signal visualization, and the optical density values were analyzed using ImageJ 1.8.0 software (National Institutes of Health).

Statistical analysis

Data were analyzed and plotted using GraphPad Prism 9 (version 9.4.0; Dotmatics). The graph was organized using Adobe Illustrator (version 2023; Adobe Systems, Inc.). All data are expressed as mean ± standard deviation. Statistical difference between groups was assessed using an unpaired t-test. P<0.05 was considered to indicate a statistically significant difference.

Results

High expression of circENTPD7, IGF2BP2 and PD-L1 in NSCLC cells

RT-qPCR was used to determine the expression patterns of circENTPD7, IGF2BP2 and PD-L1 in normal lung epithelial cells and NSCLC cell lines. RT-qPCR results revealed that circENTPD7, IGF2BP2 and PD-L1 expression was significantly higher in H1299 cells than in BEAS-2B cells (P<0.01; Fig. 1A-C). In addition, the results of western blotting experiments also demonstrated that the expression levels of IGF2BP2 and PD-L1 were significantly upregulated in H1299 cells, compared with in BEAS-2B cells (P<0.05; Fig. 1D-F).

Figure 1. Highly expressed circENTPD7, IGF2BP2 and PD-L1 in non-small cell lung cancer cells. (A) circENTPD7, (B) IGF2BP2 and (C) PD-L1 expression in BEAS-2B and H1299 cells, evaluated using reverse transcription-quantitative PCR. (D) IGF2BP2 and PD-L1 protein expression in BEAS-2B and H1299 cells, evaluated using western blotting. (E) Bar chart of IGF2BP2 protein expression. (F) Bar chart of PD-L1 protein expression. n=3. *P<0.05; **P<0.01; ***P<0.001. circENTPD7, circular RNA ENTPD7 (hsa_circ_0019421); IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; PD-L1, programmed death ligand 1.

CircENTPD7 knockdown suppresses the malignant phenotype of NSCLC cells

Subsequently, a circENTPD7 knockout function experiment was performed to assess the biological function of circENTPD7 in NSCLC cells, and RT-qPCR was used to detect transfection efficiency. The results demonstrated that circENTPD7 expression was significantly reduced after transfection of si-circENTPD7 into H1299 cells, compared with transfection with si-NC (P<0.01; Fig. 2A). Furthermore, Cell Counting Kit-8 analysis revealed that, compared with the si-NC group, the proliferation of H1299 cells treated with si-circENTPD7 was significantly suppressed (P<0.001; Fig. 2B). Furthermore, it was demonstrated that downregulation of circENTPD7 significantly impeded H1299 cell migration and invasion, in comparison with the control (P<0.01; Fig. 2C and D). These data indicate that knockdown of circENTPD7 could impede the proliferation, migration and invasion of H1299 cells.

Figure 2. Knockdown of circENTPD7 suppresses the malignant phenotype of non-small cell lung cancer cells. (A) Transfection efficiency of si-circENTPD7 in H1299 cells, evaluated using reverse transcription-quantitative PCR. (B) Transwell assay to assess H1299 cell migration. (C) Cell Counting Kit-8 assay to assess H1299 cell proliferation. (D) Transwell assay to assess H1299 cell invasion. n=3. **P<0.01; ***P<0.001. circENTPD7, circular RNA ENTPD7 (hsa_circ_0019421); si, small interfering; NC, negative control; OD, optical density.

Overexpression of IGF2BP2 inhibits the malignant phenotype of NSCLC cells by reversing circENTPD7 silencing

To evaluate the regulatory mechanism of circENTPD7 and IGF2BP2 in H1299 cells, the present study used western blotting to assess the influence of downregulated circENTPD7 on IGF2BP2 expression in H1299 cells and then semi-quantified the results. The results demonstrated that IGF2BP2 expression in the si-circENTPD7 group was significantly lower than that in the si-NC group (P<0.01; Fig. 3A). However, there was no significant difference in circENTPD7 expression between the OE-IGF2BP2 and the OE-NC groups (P>0.05; Fig. 3B). These results indicate that circENTPD7 could positively regulate IGF2BP2, whereas IGF2BP2 could not negatively regulate circENTPD7. Subsequently, salvage experiments were used to further assess the regulatory roles of circENTPD7 and IGF2BP2 in NSCLC. Transfection efficiency was determined (P<0.001; Fig. 3C). In brief, transfection of the OE-IGF2BP2 plasmid in H1299 cells significantly upregulated IGF2BP2 expression, and OE-IGF2BP2 significantly reversed the effect of si-circENTPD7 on IGF2BP2 expression, in comparison with the negative controls. At the same time, biological function experiments revealed that overexpression of IGF2BP2 could significantly accelerate the malignant behavior of H1299 cells, in comparison with negative controls. Moreover, overexpression of IGF2BP2 significantly reversed the inhibitory effect of circENTPD7 silencing on the malignant behavior of H1299 cells, in comparison with negative controls (P<0.05; Fig. 3D-G). These data indicate that circENTPD7 may accelerate the malignant phenotype of NSCLC cells by upregulating IGF2BP2 expression.

Figure 3. Overexpression of IGF2BP2 mediates the inhibition of malignant phenotype in non-small cell lung cancer cells by reversing circENTPD7 silencing. (A) Effect of downregulated circENTPD7 on IGF2BP2 expression in H1299 cells, assessed using western blotting. (B) Effect of upregulated IGF2BP2 on circENTPD7 expression in H1299 cells, evaluated using RT-qPCR. (C) Transfection efficiency of OE-IGF2BP2 in H1299 cells of each group, evaluated using RT-qPCR. (D) Cell Counting Kit-8 assay detection of H1299 cell proliferation. (E) Transwell assay to assess H1299 cell migration and invasion. (F) Bar chart of Transwell assay to assess H1299 cell migration. (G) Bar chart of Transwell assay to assess H1299 cell invasion. n=3. *P<0.05; **P<0.01; ***P<0.001. circENTPD7, circular RNA ENTPD7 (hsa_circ_0019421); IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; RT-qPCR, reverse transcription-quantitative PCR; OE, overexpression; NC, negative control; ns, no significant difference.

IGF2BP2 overexpression upregulates PD-L1 and promotes immune escape in NSCLC cells

PD-1/PD-L1 is an important mechanism for tumor immune escape (24). Therefore, the present study assessed the effects of IGF2BP2 on PD-L1 expression. RT-qPCR results demonstrated the transfection efficiency of si-PD-L1 (P<0.001; Fig. 4A). Furthermore, the results of western blotting revealed that the protein expression levels of PD-L1 and IGF2BP2 were significantly increased in the treatment group with high IGF2BP2 expression, compared with negative controls. However, si-PD-L1 significantly reversed the effects of high IGF2BP2 expression on PD-L1 and IGF2BP2 expression levels, compared with negative controls, suggesting an interaction between IGF2BP2 and PD-L1 (P<0.01; Fig. 4B-D).

Figure 4. Overexpression of IGF2BP2 upregulates PD-L1 in non-small cell lung cancer cells. (A) Reverse transcription-quantitative PCR was used to assess the transfection efficiency of si-PD-L1. (B) Western blotting was used to evaluate IGF2BP2 and PD-L1 expression in H1299 cells. (C) Bar chart of IGF2BP2 protein expression. (D) Bar chart of PD-L1 protein expression. n=3. **P<0.01; ***P<0.001. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; PD-L1, programmed death ligand 1; si, small interfering; NC, negative control; OE, overexpression.

To further evaluate the effect of IGF2BP2 upregulation on PD-L1-mediated immune escape in NSCLC cells, CD8+ and CD4+T cells were first isolated and purified from human PBMC cells and their purity was measured using flow cytometry (Fig. 5A). Subsequently, an in vitro blocking experiment was performed. The experimental results revealed that overexpression of IGF2BP2 significantly reduced CD4+ and CD8+T cell ratios, whilst blocking PD-L1 reversed this phenomenon, in comparison with negative controls (P<0.001; Fig. 5B-D). This indicates increased proliferation of H1299 cells, suggesting immune evasion by the tumor cells. In this scenario, the tumor cells could potentially inhibit T cell activity by upregulating immune checkpoint molecules such as PD-L1, promoting their own proliferation. This decrease in the proportion of co-cultured CD4 and CD8 T cells may hinder their recognition of H1299 cells, leading to a blocking effect. Furthermore, ELISA results demonstrated that the inhibitory effect of IGF2BP2 overexpression on the immune effectors IFN-γ and IL-2, as well as its promoting effect on the immunosuppressive factor TGF-β, was significantly reversed by blocking PD-L1, in comparison with negative controls (P<0.001; Fig. 5E-G). These data suggest that IGF2BP2 may drive NSCLC immune escape through upregulation of PD-L1 expression.

Figure 5. Overexpression of IGF2BP2 promotes the immune escape of non-small cell lung cancer cells. (A) CD8+ and CD4+ T cells were isolated and purified from human peripheral blood mononuclear cells using flow cytometry. (B) Flow cytometry was used to assess the proportion of CD4+ and CD8+ T cells in the co-culture system of T cells and H1299 cells. The lower-left quadrant represent non-CD4+ or non-CD8+ T cells. (C) Bar chart of CD3+CD4+. (D) Bar chart of CD3+CD8+. (E) IFN-γ production in T cell and H1299 cell co-culture system, assessed using ELISA. (F) IL-2 production in T cell and H1299 cell co-culture system, assessed using ELISA. (G) TGF-β production in T cell and H1299 cell co-culture system, assessed using ELISA. n=3. ***P<0.001. IGF2BP2, insulin-like growth factor 2 mRNA-binding protein 2; IFN-γ, interferon-γ; IL, interleukin; TGF-β, transforming growth factor β; OE, overexpression; NC, negative control; si, small interfering.

Discussion

Previous studies have reported that circENTPD7 acts as an oncogene in NSCLC (20,21). The results of the present study demonstrated that circENTPD7 expression in NSCLC cells was increased, consistent with the previous conclusion. Loss-of-function experiments also confirmed that circENTPD7 knockdown inhibited the proliferation, migration and invasion of NSCLC cells. These results revealed that circENTPD7 may serve a key role in the malignant progression of NSCLC as an oncogene. However, the involvement of circENTPD7 in the immune escape process of NSCLC remains unclear.

As the main ligand of PD-1, PD-L1 is mainly expressed in T cells, B cells and other immune cells, and is highly expressed in NSCLC (25). In normal tissues, PD-L1 helps maintain immune homeostasis. However, in cancer, PD-L1 facilitates immune escape by inhibiting the activation, expansion and effector functions of antigen-specific CD4+ and CD8+ T cells (26,27). In the present study, the overexpression of IGF2BP2 upregulated PD-L1 expression in NSCLC cells. Previous studies have reported that there is an interaction between IGF2BP2 and PD-L1, and knockdown of IGF2BP2 can inhibit the PD-1/PD-L1 pathway (28,29). Therefore, the present study assessed the association between PD-L1 and IGF2BP2 and their role in the immune escape of NSCLC. The results revealed that upregulation of IGF2BP2 increased the number of T cells, whereas downregulation of PD-L1 reversed the effect of IGF2BP2 on T cells. These results were confirmed by key factors specific to T cell-mediated immune responses (IL-2, TGF-β and IFN-γ). The aforementioned findings indicate that IGF2BP2 regulates the immune escape process of NSCLC cells by upregulating PD-L1 expression.

IGF2BP2 is an RNA-binding protein that regulates several biological processes. Initially, IGF2BP2 was discovered as a gene related to type 2 diabetes, whereas further studies have reported its role in the occurrence and development of several malignant tumors (30). Moreover, IGF2BP2 is closely associated with cancer cell proliferation, migration, adhesion, energy metabolism and immune response (31–33). Notably, previous studies have reported that IGF2BP2 acts as a tumor promoter in NSCLC cells, with its high expression contributing to the growth and metastasis of these cells (34,35). In the present study, IGF2BP2 contributed to the malignant phenotype of NSCLC cells, consistent with previous reports.

In the present research, circENTPD7 positively regulated the expression of IGF2BP2, whereas IGF2BP2 failed to negatively regulate the expression of circENTPD7. In addition, overexpression of IGF2BP2 could reverse the inhibitory effect of circENTPD7 silencing on the malignant behavior of H1299 cells. Therefore, it is hypothesized that circENTPD7 may promote PD-L1-mediated immune escape by influencing the translation or degradation of IGF2BP2 in NSCLC cells, thereby contributing to tumor progression in NSCLC. However, more research is needed to further explore these mechanisms. Additionally, future research should involve animal experiments and detailed analysis of functions and signaling pathways to elucidate the mechanisms by which abnormal circENTPD7 expression promotes immune escape in NSCLC via the IGF2BP2/PD-L1 axis. In addition, the expression of circENTPD7 in the serum of patients with NSCLC should be tested in the future to assess whether circENTPD7 can be used as a biomarker for blood biopsies of patients with NSCLC. Despite initially revealing that circENTPD7 positively regulates the expression of IGF2BP2 and hypothesizing that this regulation may promote PD-L1-mediated immune escape and tumor progression in NSCLC by influencing the translation or degradation of IGF2BP2 within NSCLC cells, the present study had several limitations. Firstly, it was not possible to confirm a negative regulatory effect of IGF2BP2 on circENTPD7, which hinders a comprehensive understanding of their interaction mechanism. Secondly, although a hypothesis has been proposed, the specific mechanism remains unclear, necessitating further research to explore how circENTPD7 impacts the immune escape of NSCLC through the IGF2BP2/PD-L1 axis. Additionally, the present study primarily relies on cellular experiments, lacking animal experiments and detailed functional and signaling pathway analyses, which limits the broad applicability and persuasive power of the findings. Lastly, although circENTPD7 holds potential as a biomarker for blood biopsies in patients with NSCLC, its expression in the serum of patients with NSCLC has not been detected in the present study, and this potential application requires further validation and clinical data support in future research.

In conclusion, the present study identified a novel circRNA, circENTPD7, which exhibits oncogenic properties in NSCLC. Furthermore, it was demonstrated that circENTPD7 inhibits the proliferation and differentiation of CD4+ and CD8+ T cells by modulating the IGF2BP2/PD-L1 axis, thereby facilitating the immune evasion of NSCLC cells. These findings suggest that circENTPD7 may serve as a potential therapeutic target for immune escape in NSCLC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Guangzhou Health Science and Technology General Guidance Project (grant no. 20221A010062).

Availability of data and materials

The data generated in the present study may be requested from the corresponding author.

Authors' contributions

HY and TZ performed the conception and design of the study. HY, YZ, RY, CX, ZL and TZ performed the investigation and methodology. HY and TZ confirm the authenticity of all the raw data. HY drafted the manuscript or figures preparation. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The use of the primary peripheral blood mononuclear cells was approved by the Ethics Committee of the Affiliated Cancer Hospital and Institute of Guangzhou Medical University (Guangzhou, China; approval no. KY-2023011010).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviation

Abbreviations:

References