High CCR6/CCR7 expression and Foxp3+ Treg cell number are positively related to the progression of laryngeal squamous cell carcinoma

  • Authors:
    • Bin Chen
    • Duo Zhang
    • Jian Zhou
    • Qing Li
    • Lin Zhou
    • Shi-Min Li
    • Li Zhu
    • Kuang-Yen Chou
    • Liang Zhou
    • Lei Tao
    • Li-Ming Lu
  • View Affiliations

  • Published online on: July 8, 2013     https://doi.org/10.3892/or.2013.2603
  • Pages: 1380-1390
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Chemokine receptors CCR6 and CCR7 have been reported to play important roles in T cell migration and organ-specific metastasis of various tumors. In the present study, we evaluated the expression and clinical significance of CCR6, CCR7, their ligands and CD4+CD25+Foxp3+ regulatory T cells in laryngeal squamous cell carcinoma (LSCC) and metastatic lymph nodes (LNs). The expression of CCR6, CCR7 and their ligands mRNA (CCL20, CCL19/CCL21) as well as the CCR6 and CCR7 proteins were detected by real-time RT-PCR and immunohistochemistry (IHC), respectively. Flow cytometry was used to investigate the percentage of CD4+CD25+Foxp3+ regulatory T cells (Tregs) in peripheral blood mononuclear cells (PBMCs). Furthermore, a number of cytokines, including interleukin (IL)-2, IL-4, IL-10, IL-12p70, interferon (IFN)-γ and transforming growth factor (TGF)-β1 were detected by ELISA. The results showed that CCR6 and CCR7 were expressed in tumors in situ, metastatic LNs and CD4+CD25+Foxp3+ Tregs. It was hypothesized that the expression profile of CCR6, CCR7 and the proliferation of CD4+CD25+Foxp3+ Tregs affected the process of LN metastasis in LSCC patients. Therefore, the increased percentage of the Foxp3+ Tregs and the upregulation of Foxp3 expression on CCR6+ Tregs in LSCC patients may have accounted for the downregulation of antitumor immunity in these patients, which could be valuable for assessment of prognosis in LSCC treatment.

Introduction

Laryngeal squamous cell carcinoma (LSCC), a type of head and neck cancer (HNSCC), is the 11th most common cancer in men worldwide (1). It is also the only cancer with a decreased survival rate in the USA (2). Once it metastasizes, the 5-year survival rate of HNC patients is reduced by 50% (3). The lack of progress has been mainly attributed to local and regional recurrences particularly in patients with stages III and IV disease (4). Therefore, further efforts must be made to improve our understanding of LSCC pathogenesis and prognosis. Similar to most types of tumor, LSCC can result in a suppressed immune system with an altered serum cytokine profile and immune cells that function aberrantly (5). In recent years, a concept has emerged that peripheral tolerance to tumors is maintained and enhanced by T cells with their immunoregulatory function (6).

Regulatory T cells (Tregs) are a subgroup of CD4+ T cells characterized by expression of CD25 and forkhead box P3 (Foxp3) (6). To date, there are 3 main types of CD4+ Treg cells partly characterized in humans: i) CD4+CD25-IL-10+Foxp3low type 1 T regulatory (Tr1) cells, which arise in the periphery in an IL-10-dependent manner (7); ii) naturally occurring CD4+CD25+Foxp3+ T cells (nTregs), which arise directly in the thymus and have the ability to suppress responses of both CD4+ and CD8+ T cells in a contact-dependent, cytokine-independent and antigen non-specific manner (810); and iii) Th3 cells, which are defined by their production of large amounts of transforming growth factor (TGF)-β (11).

Tregs can suppress the activation, proliferation and effector functions of various immune cells in vitro and in vivo(12), which could play an important role in the maintenance of immune tolerance. However, Tregs can also suppress anticancer immune responses, which is in favor of tumor progression (13). The underlying mechanism of the enrichment of the Treg subset in tumor mass remains to be fully elucidated, but may aid in understanding the mechanisms of distinct Treg subsets in immunosuppression and in improving patient treatment and quality of life (14). However, the Treg migration and accumulation in local tissue is the precondition for its full functionality. Increasing evidence has shown that Tregs express chemokine receptors, which take part in their migration through interaction with specific ligands (15,16).

This chemokine system is a superfamily composed of ~50 ligands and 20 receptors, which are directly involved in trafficking along with lymphocyte activation and homing. Furthermore, it participates and plays a key role in inflammatory reactions (1719). It has been demonstrated that CD4+CD25+ regulatory T cells can express a number of chemokine receptors, including CCR6 and CCR7 (20), which are also expressed by several cancer cells (21). It has been demonstrated that other chemokine receptors were expressed on cancer cells and acted at all stages of tumor development and progression, including neoplastic transformation of cells, promotion of angiogenesis, clonal expansion and growth (22). Chemokines have been shown to have quite a multifaceted role in cancer development and progression (23). Previous reports suggested that chemokines contribute to protection mechanisms that enable malignant cancer cells to resist chemotherapy and radiation therapy (24,25).

Several cancer cells overexpress chemokine receptors and numerous metastasis sites express the corresponding chemokines. For example, CXCR4-CXCL12 signaling has been shown to play a role in breast cancer metastasis to bone, brain and liver (26). Meanwhile, Treg can also migrate to specific locations (such as tumor sites) via this mechanism. It has been proved that CCR7 expressing Treg can be chemoattractant to draining lymph nodes (LNs) where CCR7 ligands (CCL19 and CCL21) are expressed (27,28). The CCR6 also plays a role in organ selective liver metastasis of colorectal cancer (29). Therefore, in the present study, we investigated whether chemokines and their receptors favor the Treg migration, LSCC cell metastasis and the subsequent LSCC progression. This study was conducted to analyze the possible role of CCR6, CCR7 and their ligands CCL20 (also known as MIP-3α, LARC), CCL19 (also called MIP-3β, ELC) and CCL21 (also called 6Ckine, SLC) and to explore the possible association between their expression levels and clinical/pathological characteristics of LSCC.

Materials and methods

Patients and healthy donors

A total of 88 LSCC cases were enrolled from patients who were diagnosed and underwent surgery in the Otolaryngology Head and Neck Surgery Department of the Eye, Ear, Nose and Throat Hospital, Fudan University, between November 2008 and 2009. A total of 50 tumor specimens and paired adjacent pathologically confirmed normal mucosa (at least 1 cm from the tumor margin) were collected from patients undergoing total or partial laryngectomy for LSCC. These samples included 1, 16, 21 and 12 patients in stages I, II, III and IV. The detailed clinicopathological characteristics of these patients are summarized in Table I. Peripheral blood samples were obtained from another 38 untreated LSCC patients. None of these patients received chemotherapy or radiotherapy prior to specimen collection. Tumor stage was determined according to the 2002 International Union Against Cancer TNM classification system (30). Blood samples were also obtained from 20 healthy volunteers. All specimens were collected under study protocols approved by the Ethics Committee of Fudan University and all subjects provided written informed consent prior to their inclusion in the study (KJ2007-01).

Table I

Clinicopathological characteristics of LSCC patients.

Table I

Clinicopathological characteristics of LSCC patients.

VariablePatients (fresh tissue) (N=50)
n (%)
Patients (blood) (N=38)
n (%)
Age/years
 Mean (range)60.82 (37–81)60.92 (41–82)
Gender
 Male47 (94.0)37 (97.4)
 Female3 (6.0)1 (2.6)
Location
 Supraglottic23 (46.0)14 (36.8)
 Glottic23 (46.0)22 (57.9)
 Subglottic4 (8.0)2 (5.3)
cT stage
 T1+T218 (36.0)26 (68.5)
 T3+T432 (64.0)12 (31.6)
pN stage
 N034 (68.0)34 (89.5)
 N1+N216 (32.0)4 (10.5)
Clinical grade
 I+II17 (34.0)24 (63.2)
 III+IV33 (66.0)14 (36.8)

[i] LSCC, laryngeal squamous cell carcinoma.

Reagents and kits

The following reagents were used in this study: TRIzol® (15596-018; Life Technologies, USA), PrimeScript™ RT-PCR kit (Perfect Real Time) (DRR063A; Takara, Japan), mouse anti-human CD4-FITC, CD25-PE-Cy5, Foxp3-PE (11-0049, 15-0259, 12-4777; eBioscience, USA), CCR6- and CCR7-Alexa Fluor 647 (BioLegend, USA) monoclonal antibodies (mAb) and their respective isotypes, anti-Human Foxp3 Staining Set PE (72-5774; eBioscience), mouse anti-human CCR6 monoclonal antibody (MAB195; R&D Systems, USA), mouse anti-human CCR7 monoclonal antibody (550937; BD Pharmingen, USA), EnVision™+ Single Reagents (GK400115; Dako, Denmark) and human IL-2/IL-4/IL-10/IL-12p70/interferon (IFN)-γ/TGF-β1 ELISA Ready-SET-Go (eBioscience).

RNA isolation and reverse transcription

Total RNA was extracted from patient frozen tissues using TRIzol reagent according to the manufacturer’s instructions. A total of 1 μg of total RNA was reverse transcribed to cDNA in a 20-μl reaction system using PrimeScript RT reagent kit (Perfect Real Time) to prepare the template cDNA, which was then diluted with sterile water and stored at −20°C. The reverse transcription procedure was performed according to the manufacturer’s instructions.

Semi-quantitative real-time PCR

Semi-quantitative real-time PCR for chemokine ligands, receptors and cytokines was performed on an Applied Biosystems 7500 Fast Real-Time PCR System and the data was analyzed using the 7500 software. In brief, 2 μl of cDNA was added in a 20-μl reaction mixture containing 10 μl of 2X SYBR Premix Ex Taq, 0.4 μl forward primer (10 μM), 0.4 μl reverse primer (10 μM), 0.4 μl ROX reference dye and 6.8 μl sterile water. All primers were designed by Primer Premier 5 software, with their specificity confirmed by BLAST on the NCBI webpage (http://blast.ncbi.nlm.nih.gov/Blast.cgi). Detailed information of these primers is listed in Table II. The PCR conditions were: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 25 sec. The expression level of target gene mRNA was normalized by GAPDH and was represented as 100,000×2−ΔCt, in which the ΔCt represented the difference between the Ct value of the target gene and GAPDH (Cttarget gene−CtGAPDH). The real-time PCR products were subjected to 2% (w/v) agarose gel electrophoresis and were stained with ethidium bromide.

Table II

Primer sequences used for real-time PCR.

Table II

Primer sequences used for real-time PCR.

Primer nameForward primer sequence (5′→3′)Reverse primer sequence (5′→3′)Product (bp)
CCR6 TGCTCTACGCTTTTATTGGG TTGTCGTTATCTGCGGTCTC163
CCR7 GATTACATCGGAGACAACACCA AGTACATGATAGGGAGGAACCAG106
CCL19 GGCACCAATGATGCTGAAGAC GCAGCCATCCTTGATGAGAAG102
CCL20 CAACTTTGACTGCTGTCTTGGAT ACTTTTTTACTGAGGAGACGCAC195
CCL21 CAGCTATCCTGTTCTTGCCC TTGGAGCCCTTTCCTTTCTT181
IL-2 AACTCCTGTCTTGCATTGCAC TGCTCCAGTTGTAGCTGTGTTT94
IL-10 CTTTAAGGGTTACCTGGGTTG CACATGCGCCTTGATGTCT109
IL-12p40 TGGACCTTGGACCAGAGC CTCGCCTCCTTTGTGACAG108
TGF-β1 CCCACAACGAAATCTATGACA AGCAACACGGGTTCAGGT103
IFN-γ TCGGTAACTGACTTGAATGTCCA TCCTTTTTCGCTTCCCTGTT100
Foxp3 TCCCAGAGTTCCTCCACAAC ATTGAGTGTCCGCTGCTTCT122
GAPDH GAAGGTCGGAGTCAACGGAT CCTGGAAGATGGTGATGGG224

[i] CCR, chemokine receptor; IL, interleukin; TGF-β1, transforming growth factor-β1; IFN-γ, interferon-γ; Foxp3, forkhead box P3.

Flow cytometry (FCM)

The peripheral blood mononuclear cells (PBMCs) were isolated from 5 ml of heparinized blood from the patients with LSCC as well as healthy individuals using Ficoll. Half of these cells were suspended in TRIzol and were stored at −20°C for future use. The other half was extracellularly stained with specific antibodies against human CD4, CD25, CCR6 or CCR7 for 30 min, fixed, permeabilized with Fixation/Permeabilization solution and intracellularly stained with anti-Foxp3 according to the manufacturer’s protocol. Flow cytometry was performed on a BD FACSCalibur and the results were analyzed by CellQuest Pro software. To determine the percentage of CD4+CD25+Foxp3+ Tregs, lymphocytes were gated by plotting forward vs. side scatter followed by gating on CD4+ T cells. The gated cells were then analyzed for CD25, Foxp3, CCR6 or CCR7 expression.

Immunohistochemistry (IHC)

Paraffin-embedded tissue sections of human LSCC were used for immunostaining followed by standard procedures for the avidin-biotin-peroxidase method. The color reaction was developed in diaminobenzidine solution and the cells were counterstained with hematoxylin solution. Tissue sections were stained using mouse anti-human CCR6 mAb (1:200) and CCR7 mAb (1:200), followed by incubations with secondary Abs. Histopathological evaluation was independently carried out by 2 pathologists. As previously described (31,32), the evaluation of staining was performed based on its intensity and the percentage of stained cells. The staining was ranked as no staining, weak staining, medium staining and strong staining with the values of 0, 100, 200 and 300 assigned to each staining intensity, respectively. The final scores were determined by multiplying the staining values by the percentage of positively stained cells.

Enzyme-linked immunosorbent assay (ELISA)

The expression level of IL-2, IL-4, IL-10, IL-12p70, IFN-γ and TGF-β1 was determined with ELISA Ready-SET-Go in the plasma of LSCC patients and healthy volunteers according to the manufacturer’s instructions.

Statistical analysis

Statistical analysis was performed with SPSS 13.0 for Windows. The data are reported as mean ± SD or mean ± SE. Statistical significance of the data was assessed using paired or unpaired t-tests, Mann-Whitney U test and one-way ANOVA, where appropriate. P<0.05 was considered to indicate a statistically significant difference.

Results

The mRNA expression of CCR6, CCR7 and their ligands in the LSCC group and the paired adjacent normal tissue (ANT) were measured. The CCR6, CCR7, CCL19 and CCL21 mRNA were downregulated in the LSCC tissue, while the CCL20 mRNA (the sole ligand of CCR6) was significantly upregulated as compared to the ANT (Fig. 1A). The CCR6,CCR7 and CCL19 mRNA expression was downregulated in LN(+) subjects (Fig. 1B) in LSCC tissue, while the CCL20 mRNA was increased in LN(+) samples (Table III and Fig. 1C). The CCL20 mRNA expression was higher in T3+T4 and III+IV groups as compared to that of the T1+T2 and I+II groups, respectively (Fig. 1C). The expression of CCL21 mRNA in LSCC tissue showed no significant difference within various pT stages, cN stages and clinical groups (Table III and Fig. 1B). Our data further indicated that the age and tumor localization had no correlation with the expression of CCR6, CCR7 and their ligands.

Table III

Correlation between mRNA expression in cancer and clinical characteristics.

Table III

Correlation between mRNA expression in cancer and clinical characteristics.

P- or F-value

VariableNCCR6CCR7CCL19CCL20CCL21
Age/years
 ≤60250.570.660.320.330.58
 >6025
Location
 Supraglottic230.160.110.390.210.35
 Glottic23
 Subglottic4
cT stage
 T1+T2180.260.630.040.030.17
 T3+T432
pN stage
 N0340.040.040.040.010.08
 N1+N216
Clinical grade
 I+II170.260.630.040.010.09
 III+IV33

[i] CCR, chemokine receptor.

Immunostaining of CCR6 and CCR7 in LSCC and LN

To study the chemokine receptor expression in vivo, the paraffin-embedded tissue sections were stained for CCR6 and CCR7 by IHC (Fig. 2). Differential CCR6 and CCR7 expressions in LSCC and metastatic LN were confirmed. The results indicated that the primary and metastatic cancer cells expressed both CCR6 and CCR7. Co-expression of CCR6 and CCR7 was found in 40/50 primary and 15/16 lymphatic metastatic cancer samples. Using semi-quantitative histopathological evaluation, our results indicated that CCR6 and CCR7 were upregulated significantly once the metastasis occurred. Similarly, both CCR6 and CCR7 expression levels were higher in T3 + T4 stage and III + IV group as compared to those of the T1 + T2 stage and I + II group, respectively (Table IV). Notably, the data from 16 LN(+) LSCC patients showed that CCR6 and CCR7 scores of primary cancer were higher (stronger staining) in patients with a higher score (stronger staining) of CCR6 or CCR7 in their metastatic LN (Fig. 2).

Table IV

Correlation between tumor CCR6, CCR7 IHC scores and clinical characteristics.

Table IV

Correlation between tumor CCR6, CCR7 IHC scores and clinical characteristics.

VariableNCCR6 score (mean ± SD)P-value (mean ± SD)CCR7 score (mean ± SD)P-value
Age/years
 ≤6025155.8±28.20.38178.3±32.10.41
 >6025163.2±29.3190.4±24.8
T stage
 T1+T218131.8±23.40.03147.5±23.20.02
 T3+T432175.1±19.6205.1±27.6
N stage
 N034152.5±19.70.02173.7±15.70.03
 N1+N216174.4±12.8207.0±12.8
Clinical grade
 I+II17143.7±16.70.02158.3±15.60.03
 III+IV33167.6±20.2197.8±17.3

[i] CCR, chemokine receptor; IHC, immunohistochemistry.

We divided the 16 LN(+) LSCC patients into 2 groups according to the IHC score of tumor CCR6 or CCR7 respectively, CCR6 high expression group (tumor CCR6 score >174.4) and CCR6 low expression group (tumor CCR6 score <174.4); CCR7 high expression group (tumor CCR7 score >207.0) and CCR7 low expression group (tumor CCR7 score <207.0). CCR6 or CCR7 high expression group had a higher score of their expression in LN, compared with their low expression group, respectively (Fig. 2).

CD4+CD25+Foxp3+ Treg analysis and CCR6, CCR7 expression patterns detected by FACS

In order to understand the role of CD4+CD25+Foxp3+ Tregs and the potential function of CCR6 and CCR7 on Tregs, flow cytometry was used to investigate the proportion of CD4+CD25+Foxp3+ Tregs in peripheral blood and the CCR6, CCR7 expression pattern in them in LSCC patients. The frequency of circulating CD4+CD25+Foxp3+ Tregs in the LSCC patients (7.55±2.82% of the CD4+ T population) was significantly increased as compared to the normal controls (NCs) (3.91±1.81% of the CD4+ T population). Furthermore, the frequency of CD4+CD25+Foxp3+ Tregs was compared among different groups. The distribution of CD4+CD25+Foxp3+ Tregs was calculated in 4 clinical groups and is presented in Fig. 3A. The frequency of the Tregs was increased with the clinical group progression (Fig. 3A). Furthermore, the frequency of Tregs increased in LN(+) LSCC patients (10.73±0.81% of the CD4+ T population) as compared to LN(−) LSCC patients (7.13±2.32% of the CD4+ T population) (Figs. 3B and 4A). Further analysis of the data showed that the ratio of Foxp3 in the CD4+CD25+CCR6+ and CD4+CD25+ T-cell subpopulation was higher in LSCC patients than in LNs (Figs. 3C, E and 4B). Meanwhile, the CD4+CD25+Foxp3+ Tregs of LSCC patients had a higher CCR6 expression ratio (Fig. 3D).

The Foxp3 gene expression pattern in ANT and LSCC tissues

Foxp3, a valid marker of regulatory T cells, was thoroughly investigated by real-time RT-PCR. Our results showed a significant increase of Foxp3 expression in LSCC tissue (Fig. 1D). As Tregs are known to be able to suppress the induction of effective antitumor immunity, this result was consistent with our expectations. However, further analysis showed that Foxp3 expression of LSCC tissue from LN(+) patients was downregulated as compared to that of the LN(−) patients. The same trend was also observed between the early and advanced LSCC (Fig. 1D).

Cytokine profiles in ANT and LSCC tissues and plasma

A series of cytokines, including IL-2, IL-10, IL-12, IFN-γ and TGF-β1, were detected by real-time RT-PCR and ELISA. Real-time RT-PCR showed that the immune suppressive cytokine IL-10 and TGF-β1 of LSCC tissue were upregulated, while IL-2, IL-12 and IFN-γ were downregulated, as compared to those of the ANT (Fig. 5A). ELISA was used to detect the cytokine expression levels at the protein level. Our results also showed that IL-10 and TGF-β1 expression was increased in the plasma of LSCC patients, while the IFN-γ expression was decreased (Fig. 5B).

Discussion

Until the 1980s, total laryngectomy was considered the most appropriate therapy for patients with locally advanced laryngeal and hypopharyngeal cancer. Although this strategy did help to achieve a better disease control, it had a significant negative impact on patient quality of life due to the presence of a permanent tracheostomy and the loss of natural voice (33). Therefore, non-surgical treatment of LSCC became a hot topic in head and neck cancer (3438). Cervical LN is the first stop of metastatic laryngeal cancer cells, which plays a leading role in its prognosis. Therefore, it is reasonable to identify LN metastases at an early stage in LSCC.

Our data showed that CCR6 and CCR7 mRNA expression levels were not increased and they were even significantly decreased in LN(+) patients. Although the CCR6 and CCR7 proteins were both expressed in ANT (data not shown), their expressions were shown to have some significance in the development of this cancer in LSCC patients. The immunostaining results showed that the score of advanced stage samples (T3 + T4 or III + IV or LN positive) was higher than that of the early stage samples (T1 + T2 or I + II or LN negative). Moreover, the strong staining of CCR6 and CCR7 in LN indicated a more advanced stage of LSCC. This could be used as a potential marker to assess the condition and prognosis, and may help in choosing the most suitable treatment for LSCC patients. Considering the downregulation of CCR6 and CCR7 mRNA expression levels, we speculated that the expression of CCR6 and CCR7 was more sensitive in LSCC tissue for the assessment of LSCC. Unlike Wang et al(21), we found a heavier staining of CCR7 in metastatic LN as compared to that of the primary LSCC tissue. However, we did not find a decrease in CCR6 expression at the protein level. To some extent, this finding could be the result of the difference in composition of the subjects.

Real-time RT-PCR showed an increased expression of CCR6, CCR7, CCL19 and CCL21 and a decreased expression of CCL20 in ANT, which may have indicated that CCR7 played a more significant role in local infiltration and metastasis as compared to CCR6. The distinction of CCR7 was reinforced by its expression pattern in LN(+) and LN(−) LSCC tissue. Our results further showed that the CCL20 expression was elevated in cancer tissues with a higher level in metastatic and advanced cancer patients. It has been reported that CCL20 stimulates the cell proliferation and their adhesion to collagen in various tumor cells. Furthermore, overexpression of CCL20 in tumor cells promoted the growth and adhesion in vitro and increased tumor growth and invasiveness in vivo. Moreover, neutralizing antibodies to CCL20 inhibited the in vivo growth of tumors that either overexpressed CCL20 or naturally expressed CCL20 (39,40). Previous studies have showed that LN, spleen, tonsil T zone and lymphatic endothelial cells, which expressed CCL19 and CCL21 attracted the CCR7+ cells (17). Increasing evidence has demonstrated the role of CCR7 in LN metastasis, in oral, gastric, esophageal and lung cancer (4143). Although CCR6 has been reported to be involved in hepatocellular carcinoma metastasis (44), its role in LSCC was not the same. Therefore, we speculated that CCR6 and CCR7 may have a different effect on the progression and metastasis of LSCC, where CCR6 could conduct the proliferation of LSCC cells, while CCR7 could mediate the migration and metastasis.

Previous studies indicated that CCR2, CCR4, CCR5, CCR6, CCR7, CCR8 and CXCR4 are expressed in CD4+CD25+ Treg (20,4547), and they may participate in the process of CD4+CD25+ Treg migration, homing and selective immune response. The frequency of Treg cells in this study was significantly elevated in CD4+ T cells in LSCC patients as compared to the healthy controls, and was positively correlated with the disease progression or the tumor burden. Further analysis demonstrated that the percentage of Foxp3 positive CD4+CD25+ Treg and CD4+CD25+CCR6+ Treg was elevated in LSCC, which indicated that CD4+CD25+Foxp3+ Tregs may be induced and expanded in LSCC patients. The CD4+CD25+Foxp3+ Tregs suppressed the activation, proliferation and effector functions such as cytokine production in a wide range of immune cells, including CD4+ and CD8+ T cells, natural killer (NK) and NKT cells, B cells and antigen-presenting cells (APCs) in vitro and in vivo(12). These results clearly showed that CD4+CD25+Foxp3+ Tregs were involved in the LSCC progression and metastasis. Continuous proliferation of Tregs gradually strengthened the suppression of immune system and induced an immune tolerance status, which favored the LSCC progression and metastasis. Similar results were demonstrated in several other types of cancer (4850). Furthermore, 82.70±15.08% of the CD4+CD25+Foxp3+ Tregs expressed CCR6 in LSCC, while this percentage was 65.43±22.71% in NCs. There was no difference in CCR7 expression on CD4+CD25+Foxp3+ Tregs between the LSCC and NC groups, although >50% of the CD4+CD25+Foxp3+ Tregs expressed CCR7 (data not shown). Xu et al(14) demonstrated, in a mouse breast cancer model, that dendritic cells (DCs) in the tumor masses induced the proliferation of CCR6+ Tregs through TGF-β. This finding was in line with our results reporting a high percentage of CCR6 expression on CD4+CD25+Foxp3+ Tregs in LSCC patients. As CCL20 mRNA was highly expressed in the LSCC tissue, the CCR6+ Tregs may have been attracted and cumulated in the center of LSCC, which may have formed a more suppressive microenvironment. However, this requires further investigation to confirm whether the CCL20 had an effect on the proliferation of CCR6+ Tregs.

Several mechanisms of CD4+CD25+Foxp3+ Treg-mediated suppression have been proposed. It is believed that there are 2 main types of mechanisms for contact-dependent suppression including i) downregulation of APC co-stimulatory function, interaction with CD80 and CD86 on conventional T cells and conventional T cell lysis, and ii) cytokine-mediated suppression including attenuation of DC function, conversion of conventional T cells to Tr1 cells, cell cycle arrest and apoptosis in conventional T cells (13). In this study, IL-2, IL-12 and IFN-γ mRNA levels were decreased in cancer tissue, while IL-10 and TGF-β1 mRNA levels were increased as compared to those of the ANT. The ELISA assays showed that IFN-γ protein level was reduced to 25.32 pg/ml in the plasma of LSCC patients, while the IL-10 and TGF-β1 protein levels were increased to 27.38 and 1,527.00 pg/ml, respectively, and IL-2, IL-4 and IL-12p70 were not detectable. The results of this study showed that the Th1/Th2 cytokine responses were skewed toward a Th2 bias in the plasma of patients with LSCC as compared to the healthy controls. Furthermore, suppressive cytokines (IL-10 and TGF-β1) played a key role in forming an immunosuppressive status for LSCC patients. These results were consistent with Strauss et al(51).

Transcription factor Foxp3 was thought to be a special marker of Tregs (52); however, recent studies demonstrated that Foxp3 was also expressed in cancer cells (53,54). Our study showed a high expression level of Foxp3 in LSCC tissue at the genomic level, but a decreased expression in LN(+) and advanced LSCC patients. Although protein expression level and cellular localization of Foxp3 in LSCC remain to be identified, Ladoire et al(55) demonstrated that the Foxp3 upregulation was closely related to a better prognosis in breast cancer, which indicated a high predictive value for Foxp3. We speculated that the Foxp3 gene may be involved in certain tumor-suppressing mechanisms in association with tumor metastasis.

Although the chemokine system-based research of tumor immunology has made some progress, the results from different tumors are not fully compatible (21,5658). This illustrated not only the complexity of the chemokine system, but also the unique characteristics of different types of cancer. In this study, several methods were used to detect the expression of CCR6, CCR7 and their ligands, the expression patterns of CCR6 and CCR7 on CD4+CD25+Foxp3+ Tregs, as well as the cytokine profiles of LSCC patients. The present study revealed that CCR6 and CCR7 may directly mediate the migration of cancer cells and induce immune tolerance by recruiting CD4+CD25+Foxp3+ Tregs to cancer sites in order to form a particular cancer microenvironment in favor of LSCC initiation, invasion and metastasis. These results could function as a foundation to further explore a chemokine system-based cancer intervention strategy.

Since Müller et al(26) reported the involvement of chemokine receptor in tumor growth and progression in 2001 and the identification of regulatory T cells by Sakaguchi et al in 1995 (59), significant progress has been made in the field of cancer pathogenesis, prevention and treatment (60). The CCR6, CCR7, their paired ligands and the ligand-receptor interaction bridged the gap between LSCC cells and CD4+CD25+Foxp3+ Tregs. Therefore, they may directly or indirectly be involved in tumor progression and should be evaluated as novel candidate target molecules for specific treatment interventions as well as prognosis assessments in LSCC treatment.

Acknowledgements

This study was supported by the National Natural Science Foundation of China (30801283, 30972691), the Shanghai Science and Technology Development Funds (09QA1401000, 10QA1405900), the Training Program of the Excellent Young Talents of the Shanghai Municipal Health System (XYQ2011055, XYQ2011015) and the Shanghai Municipal Science and Technology Foundation (11JC1410802).

References

1 

Marioni G, Marchese-Ragona R, Cartei G, Marchese F and Staffieri A: Current opinion in diagnosis and treatment of laryngeal carcinoma. Cancer Treat Rev. 32:504–515. 2006. View Article : Google Scholar : PubMed/NCBI

2 

Hoffman HT, Porter K, Karnell LH, et al: Laryngeal cancer in the United States: changes in demographics, patterns of care, and survival. Laryngoscope. 116:1–13. 2006. View Article : Google Scholar : PubMed/NCBI

3 

Shah JP, Karnell LH, Hoffman HT, et al: Patterns of care for cancer of the larynx in the United States. Arch Otolaryngol Head Neck Surg. 123:475–483. 1997. View Article : Google Scholar : PubMed/NCBI

4 

Alhamarneh O, Agada F, Madden L, Stafford N and Greenman J: Serum IL10 and circulating CD4(+) CD25(high) regulatory T cell numbers as predictors of clinical outcome and survival in patients with head and neck squamous cell carcinoma. Head Neck. 33:415–423. 2011.

5 

Whiteside TL: The tumor microenvironment and its role in promoting tumor growth. Oncogene. 27:5904–5912. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Zou W: Regulatory T cells, tumour immunity and immunotherapy. Nat Rev Immunol. 6:295–307. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Roncarolo MG, Bacchetta R, Bordignon C, Narula S and Levings MK: Type 1 T regulatory cells. Immunol Rev. 182:68–79. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Dieckmann D, Plottner H, Berchtold S, Berger T and Schuler G: Ex vivo isolation and characterization of CD4(+)CD25(+) T cells with regulatory properties from human blood. J Exp Med. 193:1303–1310. 2001.

9 

Jonuleit H, Schmitt E, Stassen M, Tuettenberg A, Knop J and Enk AH: Identification and functional characterization of human CD4(+)CD25(+) T cells with regulatory properties isolated from peripheral blood. J Exp Med. 193:1285–1294. 2001.

10 

Levings MK, Sangregorio R and Roncarolo MG: Human cd25(+)cd4(+) T regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function. J Exp Med. 193:1295–1302. 2001.

11 

Chen Y, Kuchroo VK, Inobe J, Hafler DA and Weiner HL: Regulatory T cell clones induced by oral tolerance: suppression of autoimmune encephalomyelitis. Science. 265:1237–1240. 1994. View Article : Google Scholar : PubMed/NCBI

12 

Sakaguchi S, Yamaguchi T, Nomura T and Ono M: Regulatory T cells and immune tolerance. Cell. 133:775–787. 2008. View Article : Google Scholar : PubMed/NCBI

13 

Sakaguchi S, Miyara M, Costantino CM and Hafler DA: Foxp3+ regulatory T cells in the human immune system. Nat Rev Immunol. 10:490–500. 2010.

14 

Xu L, Xu W, Wen Z and Xiong S: In situ prior proliferation of CD4+ CCR6+ regulatory T cells facilitated by TGF-β secreting DCs is crucial for their enrichment and suppression in tumor immunity. PLoS One. 6:e202822011.PubMed/NCBI

15 

Wei S, Kryczek I and Zou W: Regulatory T-cell compartmentalization and trafficking. Blood. 108:426–431. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Zhu J and Paul WE: CD4 T cells: fates, functions, and faults. Blood. 112:1557–1569. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Mburu YK, Wang J, Wood MA, Walker WH and Ferris RL: CCR7 mediates inflammation-associated tumor progression. Immunol Res. 36:61–72. 2006. View Article : Google Scholar : PubMed/NCBI

18 

Schutyser E, Struyf S and Van Damme J: The CC chemokine CCL20 and its receptor CCR6. Cytokine Growth Factor Rev. 14:409–426. 2003. View Article : Google Scholar : PubMed/NCBI

19 

Zlotnik A and Yoshie O: Chemokines: a new classification system and their role in immunity. Immunity. 12:121–127. 2000. View Article : Google Scholar : PubMed/NCBI

20 

Hirahara K, Liu L, Clark RA, Yamanaka K, Fuhlbrigge RC and Kupper TS: The majority of human peripheral blood CD4+CD25highFoxp3+ regulatory T cells bear functional skin-homing receptors. J Immunol. 177:4488–4494. 2006.PubMed/NCBI

21 

Wang J, Xi L, Hunt JL, et al: Expression pattern of chemokine receptor 6 (CCR6) and CCR7 in squamous cell carcinoma of the head and neck identifies a novel metastatic phenotype. Cancer Res. 64:1861–1866. 2004. View Article : Google Scholar : PubMed/NCBI

22 

Arya M, Patel HR and Williamson M: Chemokines: key players in cancer. Curr Med Res Opin. 19:557–564. 2003. View Article : Google Scholar

23 

Vinader V and Afarinkia K: A beginner’s guide to chemokines. Future Med Chem. 4:845–852. 2012.

24 

Tetu B, Popa I, Bairati I, et al: Immunohistochemical analysis of possible chemoresistance markers identified by micro-arrays on serous ovarian carcinomas. Mod Pathol. 21:1002–1010. 2008. View Article : Google Scholar : PubMed/NCBI

25 

Waugh DJ and Wilson C: The interleukin-8 pathway in cancer. Clin Cancer Res. 14:6735–6741. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Müller A, Homey B, Soto H, et al: Involvement of chemokine receptors in breast cancer metastasis. Nature. 410:50–56. 2001.PubMed/NCBI

27 

Forster R, Davalos-Misslitz AC and Rot A: CCR7 and its ligands: balancing immunity and tolerance. Nat Rev Immunol. 8:362–371. 2008. View Article : Google Scholar : PubMed/NCBI

28 

Mantovani A, Savino B, Locati M, Zammataro L, Allavena P and Bonecchi R: The chemokine system in cancer biology and therapy. Cytokine Growth Factor Rev. 21:27–39. 2010. View Article : Google Scholar

29 

Ghadjar P, Coupland SE, Na IK, et al: Chemokine receptor CCR6 expression level and liver metastases in colorectal cancer. J Clin Oncol. 24:1910–1916. 2006. View Article : Google Scholar : PubMed/NCBI

30 

Wittekind C, Compton CC, Greene FL and Sobin LH: TNM residual tumor classification revisited. Cancer. 94:2511–2516. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Pavelic ZP, Pavelic K, Carter CP and Pavelic L: Heterogeneity of c-myc expression in histologically similar infiltrating ductal carcinomas of the breast. J Cancer Res Clin Oncol. 118:16–22. 1992. View Article : Google Scholar : PubMed/NCBI

32 

Tao L, Zhou L, Zheng L and Yao M: Elemene displays anti-cancer ability on laryngeal cancer cells in vitro and in vivo. Cancer Chemother Pharmacol. 58:24–34. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Lefebvre JL and Ang KK: Larynx preservation clinical trial design: key issues and recommendations - a consensus panel summary. Head Neck. 31:429–441. 2009. View Article : Google Scholar

34 

Chen AY, Schrag N, Hao Y, et al: Changes in treatment of advanced laryngeal cancer 1985–2001. Otolaryngol Head Neck Surg. 135:831–837. 2006.

35 

Holsinger FC and Weber RS: Swing of the surgical pendulum: a return to surgery for treatment of head and neck cancer in the 21st century? Int J Radiat Oncol Biol Phys. 69(Suppl 2): S129–S131. 2007. View Article : Google Scholar : PubMed/NCBI

36 

Laccourreye O, Brasnu D, Bassot V, Menard M, Khayat D and Laccourreye H: Cisplatin-fluorouracil exclusive chemotherapy for T1-T3N0 glottic squamous cell carcinoma complete clinical responders: five-year results. J Clin Oncol. 14:2331–2336. 1996.

37 

Lefebvre JL, Rolland F, Tesselaar M, et al: Phase 3 randomized trial on larynx preservation comparing sequential vs alternating chemotherapy and radiotherapy. J Natl Cancer Inst. 101:142–152. 2009. View Article : Google Scholar : PubMed/NCBI

38 

Stenson KM, Maccracken E, Kunnavakkam R, et al: Chemoradiation for patients with large-volume laryngeal cancers. Head Neck. 34:1162–1167. 2012.PubMed/NCBI

39 

Beider K, Abraham M, Begin M, et al: Interaction between CXCR4 and CCL20 pathways regulates tumor growth. PLoS One. 4:e51252009. View Article : Google Scholar : PubMed/NCBI

40 

Bonnotte B, Crittenden M, Larmonier N, Gough M and Vile RG: MIP-3alpha transfection into a rodent tumor cell line increases intratumoral dendritic cell infiltration but enhances (facilitates) tumor growth and decreases immunogenicity. J Immunol. 173:4929–4935. 2004. View Article : Google Scholar

41 

Cabioglu N, Yazici MS, Arun B, et al: CCR7 and CXCR4 as novel biomarkers predicting axillary lymph node metastasis in T1 breast cancer. Clin Cancer Res. 11:5686–5693. 2005. View Article : Google Scholar : PubMed/NCBI

42 

Shang ZJ, Liu K and Shao Z: Expression of chemokine receptor CCR7 is associated with cervical lymph node metastasis of oral squamous cell carcinoma. Oral Oncol. 45:480–485. 2009. View Article : Google Scholar : PubMed/NCBI

43 

Takanami I: Overexpression of CCR7 mRNA in nonsmall cell lung cancer: correlation with lymph node metastasis. Int J Cancer. 105:186–189. 2003. View Article : Google Scholar : PubMed/NCBI

44 

Chen KJ, Lin SZ, Zhou L, et al: Selective recruitment of regulatory T cell through CCR6-CCL20 in hepatocellular carcinoma fosters tumor progression and predicts poor prognosis. PLoS One. 6:e246712011. View Article : Google Scholar : PubMed/NCBI

45 

Annunziato F, Cosmi L, Liotta F, et al: Phenotype, localization, and mechanism of suppression of CD4(+)CD25(+) human thymocytes. J Exp Med. 196:379–387. 2002.

46 

Iellem A, Mariani M, Lang R, et al: Unique chemotactic response profile and specific expression of chemokine receptors CCR4 and CCR8 by CD4(+)CD25(+) regulatory T cells. J Exp Med. 194:847–853. 2001.PubMed/NCBI

47 

Xu L, Xu W, Qiu S and Xiong S: Enrichment of CCR6+Foxp3+ regulatory T cells in the tumor mass correlates with impaired CD8+ T cell function and poor prognosis of breast cancer. Clin Immunol. 135:466–475. 2010.PubMed/NCBI

48 

Kosmaczewska A, Ciszak L, Potoczek S and Frydecka I: The significance of Treg cells in defective tumor immunity. Arch Immunol Ther Exp (Warsz). 56:181–191. 2008. View Article : Google Scholar : PubMed/NCBI

49 

Mao C, Wang S, Jiang Q, et al: Increased CD4+CD25+Foxp3+ regulatory T cells in cancer patients from conversion of CD4+CD25 T cells through tumor-derived factors. Onkologie. 31:243–248. 2008.

50 

Pakravan N, Hassan AT and Hassan ZM: Naturally occurring self-reactive CD4+CD25+ regulatory T cells: universal immune code. Cell Mol Immunol. 4:197–201. 2007.

51 

Strauss L, Bergmann C, Szczepanski M, Gooding W, Johnson JT and Whiteside TL: A unique subset of CD4+CD25highFoxp3+ T cells secreting interleukin-10 and transforming growth factor-beta1 mediates suppression in the tumor microenvironment. Clin Cancer Res. 13:4345–4354. 2007.PubMed/NCBI

52 

Sakaguchi S: Naturally arising Foxp3-expressing CD25+CD4+ regulatory T cells in immunological tolerance to self and non-self. Nat Immunol. 6:345–352. 2005. View Article : Google Scholar : PubMed/NCBI

53 

Ebert LM, Tan BS, Browning J, et al: The regulatory T cell-associated transcription factor FoxP3 is expressed by tumor cells. Cancer Res. 68:3001–3009. 2008. View Article : Google Scholar : PubMed/NCBI

54 

Karanikas V, Speletas M, Zamanakou M, et al: Foxp3 expression in human cancer cells. J Transl Med. 6:192008. View Article : Google Scholar : PubMed/NCBI

55 

Ladoire S, Arnould L, Mignot G, et al: Presence of Foxp3 expression in tumor cells predicts better survival in HER2-overexpressing breast cancer patients treated with neoadjuvant chemotherapy. Breast Cancer Res Treat. 125:65–72. 2011. View Article : Google Scholar

56 

O’Hayre M, Salanga CL, Handel TM and Allen SJ: Chemokines and cancer: migration, intracellular signalling and intercellular communication in the microenvironment. Biochem J. 409:635–649. 2008.PubMed/NCBI

57 

Ito S, Ozawa S, Ikoma T, Yajima N, Kiyono T and Hata R: Expression of a chemokine BRAK/CXCL14 in oral floor carcinoma cells reduces the settlement rate of the cells and suppresses their proliferation in vivo. Biomed Res. 31:199–206. 2010. View Article : Google Scholar : PubMed/NCBI

58 

Silva TA, Ribeiro FL, Oliveira-Neto HH, et al: Dual role of CCL3/CCR1 in oral squamous cell carcinoma: Implications in tumor metastasis and local host defense. Oncol Rep. 18:1107–1113. 2007.PubMed/NCBI

59 

Sakaguchi S, Sakaguchi N, Asano M, Itoh M and Toda M: Immunologic self-tolerance maintained by activated T cells expressing IL-2 receptor α-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol. 155:1151–1164. 1995.

60 

DiPersio JF, Micallef IN, Stiff PJ, et al: Phase III prospective randomized double-blind placebo-controlled trial of plerixafor plus granulocyte colony-stimulating factor compared with placebo plus granulocyte colony-stimulating factor for autologous stem-cell mobilization and transplantation for patients with non-Hodgkin’s lymphoma. J Clin Oncol. 27:4767–4773. 2009.PubMed/NCBI

Related Articles

Journal Cover

September 2013
Volume 30 Issue 3

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Chen B, Zhang D, Zhou J, Li Q, Zhou L, Li S, Zhu L, Chou K, Zhou L, Tao L, Tao L, et al: High CCR6/CCR7 expression and Foxp3+ Treg cell number are positively related to the progression of laryngeal squamous cell carcinoma. Oncol Rep 30: 1380-1390, 2013.
APA
Chen, B., Zhang, D., Zhou, J., Li, Q., Zhou, L., Li, S. ... Lu, L. (2013). High CCR6/CCR7 expression and Foxp3+ Treg cell number are positively related to the progression of laryngeal squamous cell carcinoma. Oncology Reports, 30, 1380-1390. https://doi.org/10.3892/or.2013.2603
MLA
Chen, B., Zhang, D., Zhou, J., Li, Q., Zhou, L., Li, S., Zhu, L., Chou, K., Zhou, L., Tao, L., Lu, L."High CCR6/CCR7 expression and Foxp3+ Treg cell number are positively related to the progression of laryngeal squamous cell carcinoma". Oncology Reports 30.3 (2013): 1380-1390.
Chicago
Chen, B., Zhang, D., Zhou, J., Li, Q., Zhou, L., Li, S., Zhu, L., Chou, K., Zhou, L., Tao, L., Lu, L."High CCR6/CCR7 expression and Foxp3+ Treg cell number are positively related to the progression of laryngeal squamous cell carcinoma". Oncology Reports 30, no. 3 (2013): 1380-1390. https://doi.org/10.3892/or.2013.2603