Genome‑wide profiling of lncRNA expression patterns in patients with acute promyelocytic leukemia with differentiation therapy

  • Authors:
    • Jian Yu
    • Xiao‑Ling Guo
    • Yuan‑Yuan Bai
    • Jun‑Jun Yang
    • Xiao‑Qun Zheng
    • Ji‑Chen Ruan
    • Zhan‑Guo Chen
  • View Affiliations

  • Published online on: June 25, 2018     https://doi.org/10.3892/or.2018.6521
  • Pages: 1601-1613
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Long non‑coding RNAs (lncRNAs) are crucial factors in acute promyelocytic leukemia (APL) cell differentiation. However, their expression patterns and regulatory functions during all‑trans‑retinoic acid (ATRA)‑induced APL differentiation remain to be fully elucidated. The profile of dysregulated lncRNAs between three bone marrow (BM) samples from patients with APL post‑induction and three BM samples from untreated matched controls was examined with the Human Transcriptome Array 2.0. The dysregulated lncRNA expression of an additional 27 APL BM samples was validated by reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) analysis. The lncRNA functions were predicted through co‑expressed messenger RNA (mRNA) annotations. Co‑expressed lncRNA‑mRNA networks were constructed to analyze the functional pathways. In total, 825 lncRNAs and 1,218 mRNAs were dysregulated in the treated APL BM group, compared with the untreated APL BM group. The expression of 10 selected lncRNAs was verified by RT‑qPCR analysis. During APL differentiation, NONHSAT076891 was the most upregulated lncRNA, whereas TCONS_00022632‑XLOC_010933 was the most downregulated. Functional analysis revealed that several lncRNAs may exert activities in biological pathways associated with ATRA‑induced APL differentiation through cis and/or trans regulation of mRNAs. The findings of the present study assist in explaining the contributions of lncRNAs in APL myeloid differentiation and improve current knowledge on the potential mechanisms regarding dysregulated lncRNA expression in ATRA‑induced APL differentiation.

Introduction

Acute promyelocytic leukemia (APL) is distinguished by a specific t(15;17) chromosomal translocation, contributing to the expression of the oncoprotein PML-RARα, which counteracts myeloid differentiation and facilitates APL-initiating cell self-renewal (1,2). The dominant-negative effect of the PML-RARα oncoprotein, which antagonizes the myeloid differentiation process, can be reversed by pharmacological doses of all-trans-retinoic acid (ATRA) (3). The combined therapy of ATRA and arsenic trioxide (ATO), which eliminates APL by activating PML-RARα degradation, demonstrates efficacy as an APL therapy and markedly improves the prognosis of patients with APL (4). However, ATO and ATRA induce irreversible resistance, and certain patients with APL ultimately succumb to treatment-resistant diseases (5,6). Therefore, the unifying mechanisms required for myeloid differentiation and response to therapy in APL require further investigation.

Long non-coding RNAs (lncRNAs), which are in excess of 200 nucleotides, are involved in diverse biological processes including epigenetic regulation, chromosome imprinting, transcription, splicing, translation, cell-cycle control, and differentiation (7). They have been functionally coupled to cancer and cellular differentiation. The investigation of lncRNA expression and function may contribute to the current understanding of leukemogenesis, and the identification of novel therapeutic targets and seminal posttranscriptional factors associated with resistance to chemotherapy. Consequently, the global aberrant expression of lncRNAs that occurs during myeloid differentiation can assist in enhancing the efficacy of current APL therapies and identifying novel therapeutic targets for chemotherapies. lncRNAs have been considered as prognostic and diagnostic molecular biomarkers for acute myeloid leukemia (AML) (8,9). Previous investigations have demonstrated that lncRNAs are crucial in myeloid differentiation and APL therapy (1012). HOTAIRM1, a myeloid-specific lncRNA, has been defined as a key factor in ATRA-induced APL differentiation (11,13). Furthermore, HOTAIRM1 can promote the degradation of PML-RARα via a pathway associated with autophagy during myeloid cell differentiation or ATRA-induced APL differentiation (10). This suggests that aberrant lncRNA expression may be underlying targets for APL therapy and indicators for response to APL therapy. Several lncRNAs have been identified in APL-associated myeloid differentiation (1013); however, additional key lncRNAs and their functions in regulating myeloid maturation require characterization in the APL-associated myeloid differentiation transcriptome.

NB4 cells represent a suitable cell model to investigate changes in lncRNA expression between APL cells and their terminally differentiated counterparts. System analysis of the transcriptome has been beneficial for the identification of various pathways or cascades at the transcriptome level associated with ATRA/ATO-induced cell differentiation (14). These are common in the absence of the complicated and dynamic intracorporeal synergy between ATRA and ATO in APL therapy, which may affect cell survival and response to therapy. Although it has been suggested that lncRNAs are involved in ATRA/ATO-induced extracorporeal APL differentiation, further understanding of the lncRNA landscape in ATRA/ATO-induced intracorporeal APL differentiation is required.

The aim of the present study was to examine lncRNA profiles and regulatory functions in ATRA-based targeted therapy for APL differentiation. The lncRNA and messenger RNA (mRNA) profiles were compared in three post-induction bone marrow (BM) samples from patients with APL and pre-induction (untreated) matched controls via whole transcriptome microarray. Subsequently, 10 dysregulated lncRNAs were selected and verified by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis in another 27 APL BM samples. In addition, the functions of dysregulated lncRNAs were predicted via their co-expressed mRNAs. The findings identified the lncRNA landscape for myeloid differentiation in APL and revealed potential mechanisms occurring due to dysregulated lncRNA expression in ATRA-induced APL differentiation; this may provide underlying targets for APL therapy and lncRNA biomarkers for APL responses to therapy.

Materials and methods

Patient profiles

A total of 30 patients with APL who received ATRA-based targeted therapy at the Second Affiliated Hospital and Yuying Children's Hospital of Wenzhou Medical University (Wenzhou, China) between January 2014 and December 2016 were recruited for the present study. None of the patients received chemotherapy prior to targeted therapy. Written informed consent was collected from all the patients in conformity with the Declaration of Helsinki, and the present study obtained permission from the Ethics Committee of Wenzhou Medical University. The BM samples from the patients with APL at diagnosis and corresponding BM samples from patients with APL post-induction were collected in BD Vacutainer Heparin tubes (BD Biosciences, San Diego, CA, USA). Patient diagnoses were determined according to the 2016 World Health Organization criteria (15). The patients with APL were treated according to the International APL guidelines (15). Among the 60 samples, three paired samples (comprising three post-induction samples and three pre-induction samples) were used for lncRNA microarray analysis and the other samples were used for RT-qPCR analysis. The primary characteristics of the patients with APL are listed in Table I.

Table I.

Primary characteristics of patients with APL.

Table I.

Primary characteristics of patients with APL.

Characteristicn (%)
Patients30
Sex
  Male18 (60.0)
  Female12 (40.0)
Age (years)
  Median (range)40 (19–67)
WHO classification
  APL with t(15;17)(q22;q12); PML-RARa30 (100.0)
  Transcripts of PML-RARa30 (100.0)
  PML-RARa bcr118 (60.0)
  PML-RARa bcr21 (3.3)
  PML-RARa bcr311 (36.7)
  Received ATRA-based therapy30 (100.0)
  Paired BM post-induction obtained30 (100.0)

[i] APL, acute promyelocytic leukemia; BM, bone marrow; WHO, World Health Organization; lncRNA, long non-coding RNA.

Sample collection and RNA extraction

The mononuclear BM cells (MBMCs) were isolated from ~2 ml heparinized BM samples using density gradient medium centrifugation (800 × g, for 20 min at room temperature). Subsequently, 1×107 cells were resuspended in TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and temporarily stored at −80°C until further analysis. Total RNA was extracted from the MBMCs according to the manufacturer's protocol and dissolved in 100 µl nuclease-free water. The RNA yield was measured using a NanoDrop ND-2000 spectrophotometer from Thermo Fisher Scientific, Inc. and the RNA integrity was assessed using an Agilent 2100 bioanalyzer system (Agilent Technologies, Inc., Santa Clara, CA, USA). When the 28S:18S ratio was ascertained and the RNA integrity number (RIN) of each sample was assigned; RNA samples with a 28S:18S ratio ≥0.7 and RIN ≥7.0 were further analyzed.

lncRNA and mRNA microarray expression profiling

RNA from each sample (~200 ng) was applied for lncRNA and mRNA microarray analyses using Cluster 3.0 (http://bonsai.hgc.jp/~mdehoon/software/cluster/software.htm). Gene expression was analyzed using an Affymetrix GeneChip® Human Transcriptome Array 2.0 (Affymetrix, Inc., Santa Clara, CA, USA). The microarray contained 67,539 probes for 22,829 human lncRNAs and 44,710 human mRNAs, which were derived from eight authoritative databases, including RefSeq, Ensembl, UCSC, MGC, nocode, lncRNAdb, Broad Institute, TUCP catalogue and Human Body Map lincRNAs. Additionally, the microarray contained probes for small non-coding RNAs, but not microRNAs, and the majority of these were small nuclear RNAs and small nucleolar RNAs. The array experiments and computational analysis were performed according to the manufacturer's protocol (Affymetrix, Inc.). The raw data were extracted and standardized using the GeneChip Command Console software 4.0 and Expression Console software 1.3.1 from Affymetrix, Inc. Additional data processing was performed with GeneSpring software 12.5 (Agilent Technologies, Inc.). Dysregulated lncRNAs or mRNAs defined by an absolute value of fold change (FC) ≥2.0 and P≤0.05 (Student's t-test) were selected for further analysis. The dysregulated mRNAs were categorized into different Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) annotation groups. The lncRNA chip experiments were performed in the laboratory at Shanghai OE Biotech Co., Ltd. (Shanghai, China).

RT-qPCR verification of 10 dysregulated lncRNAs

The lncRNA and mRNA expression were analyzed using FastStart Universal SYBR-Green Master Mix (Rox) from Roche Diagnostics (Indianapolis, IN, USA) and an ABI ViiA™ 7 Real-Time PCR system from Applied Biosystems (Thermo Fisher Scientific, Inc.). Briefly, the total RNA was transcribed into cDNA using a Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics) as per the manufacturer's protocol. PCR amplification was performed in a 25 µl reaction containing 1 µl of cDNA template (~10 ng), 12.5 µl of FastStart Universal SYBR-Green Master Mix (Rox), 10.5 µl of nuclease-free water, and 0.5 µl of each pair of primers (Shanghai GeneCore BioTechnologies Co., Ltd., Shanghai, China). The RT-qPCR primers for the lncRNAs are listed in Table II. The reaction conditions were as follows: 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 45 sec. All experiments were repeated three times in parallel. The expression of lncRNAs was further standardized to the GAPDH gene and calculated using the 2−ΔΔCq method (16).

Table II.

Reverse transcription-quantitative polymerase chain reaction primers for lncRNAs.

Table II.

Reverse transcription-quantitative polymerase chain reaction primers for lncRNAs.

lncRNA primary IDPrimer sequence (5′-3′)Product (bp)
NONHSAT121385Forward: TACATGTTCCTGGTGAAAT108
Reverse: GGCATCAAGTATGTCTCT
ENST00000469418Forward: CAATTTACGGCTGGACGTTT128
Reverse: GAAAGGAATGCTGGGAAACA
ENST00000424415Forward: ATATTGAGATAGGAGGATGG107
Reverse: GGCTTCTTCTAGGATAAGT
NR_003186Forward: TACATGTTCCTGGTGAAAT115
Reverse: ATCTTTGGGCATCAAGTA
ENST00000536425Forward: TTGAATAATCCTAAATTATACATAC  78
Reverse: TCATAGTGACTAAATTGAATAAGTACCAAA
NONHSAT061249Forward: AGGATCGCTTGAGATGCAGT110
Reverse: GCTACCGCTCTCAAGTTTGG
TCONS_00017553-XLOC_008249Forward: GTGTCTGTGTGTACAGAA187
Reverse: ACATTCCATACACACAAAC
TCONS_l2_00030950-XLOC_l2_015963Forward: GTTGGAAGATGAAGGAAC114
Reverse: ATCACTGTGTAAAGGACTA
NONHSAT076891Forward: GGATCTCCCCTGTGTTCTCA146
Reverse: GACCAGGTAGTGGGGGAAGT
TCONS_00022632-XLOC_010933Forward: TCTTCCACGTAACAACCA124
Reverse: CTGACAGTGTCTTCCATA

[i] lncRNA, long non-coding RNA.

Microarray results analysis and functional prediction of selected dysregulated lncRNAs

The identification of the overall functional distributions for the dysregulated lncRNAs identified in the experiment were performed as follows. Briefly, the co-expressed mRNAs for each dysregulated lncRNA were first calculated, and functional enrichment analysis for the set of co-expressed mRNAs was then performed. The enriched functional terms served as the predicted functional term for a given lncRNA. Furthermore, the co-expressed mRNAs of lncRNAs were identified by calculating the Pearson's correlation (P<0.05). The functional enrichment terms for annotating the co-expressed mRNAs were determined using the hypergeometric cumulative distribution function (17,18). The top 200 reliable prediction associations between the lncRNAs and the predicted functional terms were selected to reflect the functional distribution of the dysregulated lncRNAs. The frequency of each predicted functional term for these associations was determined, following which the GO term and KEGG term with more functional annotations were statistically identified (19).

Identification of cis-regulated mRNAs for the dysregulated lncRNAs

The present study further examined how the dysregulated lncRNAs may exert activities through cis- and/or trans-regulated mRNAs. The regions of cis-regulation were identified as follows: Gene locations for different lncRNAs on the chromosome were determined; for each dysregulated lncRNA, the mRNAs were identified as cis-regulated mRNAs when the co-expressed mRNA loci were within 300 kbp downstream or upstream of the given lncRNA and the Pearson's correlation of lncRNA-mRNA expression was significant at the P<0.05 level. When the mRNAs did not conform to the cis-regulated mRNA rules, they were identified as possible trans-regulated mRNAs.

Identification of transcription factors associated with dysregulated lncRNAs

It has been documented that specific lncRNAs may be involved in certain biological processes, including transcriptional regulation, through key transcription factors (TFs) (17). Therefore, the TF/chromatin regulation complexes that may have critical co-regulatory roles with lncRNAs were identified (18,20). Briefly, the set of co-expressed mRNAs for lncRNA and TF/chromatin regulation complex target genes was determined, the enrichment level of which was analyzed using the hypergeometric distribution. Therefore, the TFs prominently associated with dysregulated lncRNAs were finally determined. The lncRNA-TF network was established using the hypergeometric distribution, and a graph showing the associations between TFs and lncRNAs was drawn using Cytoscape software (version 3.6.1; http://www.cytoscape.org/), an open source software platform. In the network, the core TF with the highest degree of expression was considered the centre of highest importance.

Results

General expression profiles of dysregulated lncRNAs and mRNAs

To investigate the lncRNA landscape involved in ATRA-induced APL differentiation, lncRNA and mRNA microarray analyses were performed on BMMCs from patients with APL. The microarray data were filtered through a volcano plot to determine the dysregulated lncRNAs and mRNAs in BM samples from patients with APL post-induction and corresponding BM samples from patients with APL at diagnosis (Fig. 1A). The lncRNA and mRNA expression data were clustered using Cluster 3.0 (Fig. 1B). Based on the similar expression patterns, the samples were further classified into two groups using dendrogram-based methods for clustering. It was found that 825 lncRNAs were dysregulated between the patients with APL post-induction and the matched controls at diagnosis, with 410 upregulated and 415 downregulated lncRNAs (Fig. 1C). Among the dysregulated lncRNAs, NONHSAT076891 was upregulated the most, with an FC of 304.00, whereas TCONS_00022632-XLOC_010933 was downregulated the most, with an FC of 447.09. It was also found that 1,218 mRNAs were dysregulated, with 660 upregulated and 558 downregulated mRNAs (Fig. 1C). The most upregulated and downregulated mRNAs were MPEG1 and CYTL1, with FCs of 257.13 and 1,169.37, respectively. The top 20 upregulated and downregulated lncRNAs and mRNAs are listed in Table III.

Table III.

Top 20 upregulated and downregulated lncRNAs and mRNAs in patients with APL with induction therapy.

Table III.

Top 20 upregulated and downregulated lncRNAs and mRNAs in patients with APL with induction therapy.

Upregulated lncRNAsFC (abs)Downregulated lncRNAsFC (abs)Upregulated mRNAsFC (abs)Downregulated mRNAsFC (abs)
NONHSAT076891304.001 TCONS_00022632-XLOC_010933447.093MPEG1257.128CYTL11,169.366
NONHSAT066562301.188 ENST00000419668145.949LRRK2235.480HGF357.526
NONHSAT104550272.525NONHSAT032682141.184PLBD1223.158CPA3206.801
NONHSAT12138586.674 TCONS_00022633-XLOC_01093479.771P2RY13220.328FLT3119.563
NR_00318685.927 ENST0000042915963.192CLEC7A165.126CFD82.293
NR_00318763.356NR_03410552.276VCAN163.269KIT77.132
NR_02832453.106NR_00361144.230FGL2157.751PRSS5775.924
TCONS_l2_00031106-XLOC_l2_01600847.907NONHSAT02142143.840RAB31146.390CCNA175.130
NR_03998346.826 TCONS_00008717-XLOC_00423143.062IFI30138.929ITM2A73.741
ENST0000046941842.355 ENST0000054512040.173VNN2101.935MAMDC240.283
TCONS_00028171-XLOC_01353141.054 ENST0000057945836.424S100A1292.761STAB135.361
NONHSAT14465238.665 ENST0000053535134.801C5AR181.921GTSF133.527
NONHSAT06011438.653 ENST0000042370832.984SAMHD165.141RFX831.113
NONHSAT09738635.242 TCONS_l2_00004167-XLOC_l2_00195330.059HLA-DRA63.702MMP226.319
NONHSAT05174732.846 ENST0000041350424.286NCF259.800TDRD924.590
NONHSAT15091632.737 ENST0000045126724.286GLT1D157.236UGT3A224.494
NONHSAT12068027.076 ENST0000042606321.941STX1155.971ZNF71120.705
NONHSAT09814621.665 TCONS_l2_00003557-XLOC_l2_00197121.569IGF2R54.459BLID16.816
TCONS_00013664-XLOC_00632419.262 TCONS_l2_00003558-XLOC_l2_00197219.349FLJ4544553.106CALR16.644
NONHSAT10290617.430 ENST0000051447319.153CEACAM150.279GABRE15.980

[i] FC (abs), absolute fold change (APL pre-induction therapy set as 1); lncRNAs, long non-coding RNAs; APL, acute promyelocytic leukemia.

Verification of dysregulated expression of lncRNAs and mRNAs

To verify the dysregulated expression of lncRNAs and mRNAs associated with ATRA-induced APL differentiation, RT-qPCR analysis was performed to examine the upregulation or downregulation of the genes. A total of 10 dysregulated lncRNA transcripts were selected for RT-qPCR analysis. These 10 lncRNAs consisted of four randomly selected lncRNAs, including NONHSAT121385, ENST00000469418, ENST00000424415, and NR_003186, and six specifically selected lncRNAs, including ENST00000536425, NONHSAT061249, TCONS_00017553-XLOC_008249, TCONS_l2_00030950-XLOC_l2_015963, NONHSAT076891, and TCONS_00022632-XLOC_010933. ENST00000536425 and NONHSAT061249 were selected as a result of their predicted cis-regulating potential. TCONS_00017553-XLOC_008249 and TCONS_l2_00030950-XLOC_l2_015963 were selected due to their predicted trans-regulating potential and their presence among the top 100 lncRNA-TF pairs. NONHSAT076891 and TCONS_00022632-XLOC_010933 were selected as they were the most upregulated and downregulated, respectively (Table III). The RT-qPCR results were in agreement with the results obtained from the microarray chip analysis (Fig. 2). As shown in Fig. 2, all selected lncRNAs were dysregulated and exhibited the same trend of upregulation or downregulation (P<0.05 for each lncRNA, Student's t-test).

lncRNA and mRNA co-expression profiles and lncRNA function prediction

Several hundred lncRNAs were co-expressed with hundreds of mRNAs. For example, ENST00000419668 was co-expressed with 515 mRNAs and TCONS_00022632-XLOC_010933 with 488 mRNAs. The GO and KEGG pathway annotations of the co-expressed mRNAs were used to predict the functions of the dysregulated lncRNAs. The lncRNAs were clustered into hundreds of GO and KEGG terms with more functional annotations. In the corresponding association between the ‘lncRNA name’ and ‘functional prediction term’, the top 200 predicted associations were selected to reflect the functional distribution of the dysregulated lncRNAs. Among the GO terms, the most common biological processes for the dysregulated lncRNAs were cell cycle phase transition, regulation of spindle checkpoint, negative regulation of viral genome replication, DNA damage checkpoint, and attachment of spindle microtubules to kinetochore (Fig. 3A). The most common KEGG terms were DNA replication, spliceosome, NF-κB signalling pathway, mismatch repair, primary immunodeficiency, nucleotide excision repair, and cell cycle (Fig. 3B). Therefore, according to the enrichment, cell cycle phase transition was the most enriched GO term and DNA replication was the most enriched KEGG term (Fig. 3).

Analysis of ‘cis’ lncRNAs and their adjacent co-expressed mRNAs

Evidence shows that a number of lncRNAs may cis-regulate the transcription of themselves and their adjacent mRNAs by recruiting remodelling factors to local chromatin (21). To determine the potential ‘cis’ mRNAs associated with a specific lncRNA, the co-expressed mRNAs 300 kb upstream and downstream of the dysregulated lncRNAs were analyzed. In total, 48 lncRNAs and their predictively cis-regulated mRNAs were identified using accurate genomic mapping based on the criteria mentioned above. The lncRNAs and their underlying cis-regulated mRNAs are listed in Table IV. The results suggested that lncRNA ENST00000536425 cis-regulates one mRNA, early endosome antigen 1 (EEA1) (Fig. 4A), whereas lncRNA NONHSAT061249 cis-regulates two mRNAs, including zinc finger protein 564 (ZNF564) and zinc finger protein 44 (ZNF44) (Fig. 4B).

Table IV.

All lncRNA transcripts and their potentially cis-regulated mRNA transcripts.

Table IV.

All lncRNA transcripts and their potentially cis-regulated mRNA transcripts.

ChromStrandCorrelationlncRNA primary IDtxStarttxEndmRNA primary IDtxStarttxEnd
10−0.846333103 ENST000004372321725623817271983CUBN1686596317171830
10−0.889863566 ENST000004396719442852994429500IDE9421144194333852
10−0.827414528 ENST000004538534679837046809021SYT154695276246971400
15+−0.844858112 ENST000004995286466318664667537TRIP46467995264747502
  5+−0.821398914 ENST000005128569612048196121703LNPEP9627109896373219
11−0.931044512 ENST000005255006235712162357959UBXN16244397062446562
110.904455214 ENST000005255006235712162357959HNRNPUL26248009762494857
11−0.832660059 ENST000005255006235712162357959AHNAK6220101662314332
12−0.936840914 ENST000005364259347737493477451EEA19316441393323107
140.933330841 ENST000005554035079324450794627L2HGDH5070428150779266
14+0.908030062 ENST000005554602288682622887645TRAV38-12273982122740446
14+0.871856814 ENST000005554602288682622887645TRAJ612294430622944365
14+0.825846372 ENST000005554602288682622887645TRAV302263629322636884
  1−0.833908257NONHSAT005886145372088145373798POLR3GL145456236145470388
  1+0.83645797NONHSAT007706173865073173871776DARS2173793641173827684
11−0.901219661NONHSAT0217656233441262340225HNRNPUL26248009762494857
110.874686208NONHSAT0217656233441262340225UBXN16244397062446562
11−0.844180413NONHSAT025134130434325130628495ADAMTS8130274818130298888
120.834550722NONHSAT0284855405902154062993CALCOCO15410490254121529
120.904345693NONHSAT031503122826057122839031ZCCHC8122956146122985543
14+−0.837693156NONHSAT0357522256430222564896TRAV412278856822789123
14+−0.820822874NONHSAT0357522256430222564896TRAV12-12230932122309956
16−0.864461252NONHSAT051747223162223620AXIN1337440402676
190.971374656NONHSAT0612491257635912624647ZNF5641263618412662356
190.880808619NONHSAT0612491257635912624647ZNF441233550112405714
  5−0.889390591NONHSAT1011163910532639105857RICTOR3893802139074510
  50.827904836NONHSAT1011233938314839393457DAB23937177639462402
  5+−0.83173824NONHSAT1029069607186896077284LNPEP9627109896373219
  5−0.921818421NONHSAT104550149782674149782885RBM22150070352150080669
  7+0.833858641NONHSAT1196652713571327139877 OTTHUMG000000652942742018127420825
X+0.82095135NONHSAT1372315484171854842362PAGE2B5510149655105342
190.83717369NONHSAT1805475235905652391189SIGLEC145211478152150151
220.859220203NONHSAT1926181871072618711888CLTCL11890008719279239
  1+−0.82131915NR_0031338987323889890493GBP68982943689853719
  6+−0.865567866NR_003288160514114160517244SLC22A1160542805160579750
19+−0.90635912NR_02424712858901378430DAZAP114075841435683
  4+0.882358648NR_0366948881299588815167DMP18857145488585513
  7+−0.879682301 TCONS_00012852-XLOC_006277141870970141923474TRBV4-2142045252142045816
  7+−0.852206355 TCONS_00012852-XLOC_006277141870970141923474TRBV2142000747142211011
10−0.823174131 TCONS_00017969-XLOC_0088054679837046809021SYT154695276246971400
  1−0.880035509 TCONS_l2_00002788-XLOC_l2_001347228155359228158853C1orf148228351787228353213
12+−0.842080292 TCONS_l2_00005685-XLOC_l2_0029945354705353548417ESPL15366208353778657
12+0.933722808 TCONS_l2_00005705-XLOC_l2_0030095690473456906923IL23A5673266356734194
15+−0.853220916 TCONS_l2_00008528-XLOC_l2_0046023084679030848689ARHGAP11B3091669730931023
17+−0.948957318 TCONS_l2_00011527-XLOC_l2_0056861833017518333940TRIM16L1860131118639432
17+0.815854971 TCONS_l2_00011527-XLOC_l2_0056861833017518333940LGALS9C1838009818398259
19+0.840205468 TCONS_l2_00012696-XLOC_l2_0068155427877854279108MIR516A25426438754264476
  2+−0.866656281 TCONS_l2_00014331-XLOC_l2_007832242626503242633704ING5242641450242668896

[i] lncRNA, long non-coding RNA; mRNA, messenger RNA; chrom, chromosome.

Dysregulated lncRNA ‘trans’ mechanism and construction of the TF-lncRNA-target gene network

As numerous dysregulated lncRNAs were involved in mRNA regulation, a ‘TF-lncRNA’ network is likely to be large and complex. Consequently, the top 100 associations were selected to generate a core TF-lncRNA network, visualized by hypergeometric distribution analysis (Fig. 5). The core TF-lncRNA network map for patients with APL post-induction, vs. matched controls at diagnosis is shown in Fig. 5A. The majority of potential trans-regulation lncRNAs were found to be involved in pathways regulated by three TFs, including E2F transcription factor 1 (E2F1), E2F transcription factor 6 (E2F6), and early B cell factor 1 (EBF1) (Fig. 5B). In the core network of lncRNA-TF pairs, E2F1, E2F6, and EBF1 regulated the expression of 16 lncRNAs, 13 lncRNAs and 10 lncRNAs, respectively.

Based on the lncRNA co-expression results, the target genes were incorporated into a ‘TF-lncRNA’ network to determine the TF-lncRNA-target network. Due to the large and complex networks, the top 10 associations were selected to produce a core TF-lncRNA-target network map (Fig. 6). The core TF-lncRNA-target gene association for patients with APL post-induction therapy, vs. pre-induction therapy is shown in Fig. 6, and includes 10 dysregulated lncRNAs (TCONS_l2_00006587-XLOC_l2_002952, ENST00000536425, NR_002174, TCONS_00002901-XLOC_001489, ENST00000558044, NONHSAT101365, TCONS_00017553-XLOC_008249, TCONS_00000490-XLOC_000746, NONHSAT034763, and TCONS_l2_00030950-XLOC_l2_015963), 247 target genes, and eight TFs (TAF1, GTF2B, E2F4, ZBTB7A, E2F1, NFYB, MYC, and E2F6) in the core map. As shown in Fig. 6, the core TF MYC association regulated two lncRNAs (TCONS_00017553-XLOC_008249 and TCONS_l2_00030950-XLOC_l2_015963) and 97 target genes. As observed for ‘MYC-TCONS_00017553-XLOC_008249-RIOK1’ in this map, target genes, including RIOK1, were co-expressed for TCONS_00017553-XLOC_008249. As observed for ‘MYC- TCONS_l2_00030950-XLOC_l2_015963-RPLP2’ in the map, target genes, including RPLP2, were co-expressed for TCONS_l2_00030950-XLOC_l2_015963-RPLP2. Therefore, these maps provided vital information on the lncRNAs, TFs and target genes.

Discussion

In the present study, the expression patterns of genome-wide lncRNAs were first evaluated in BM samples from patients with APL post-induction and corresponding BM samples from patients with APL at diagnosis using microarray analysis. Their potential functions were then examined by analysing their co-expressed mRNAs. The experimental results showed that 825 lncRNAs and 1,218 mRNAs were dysregulated. Furthermore, 10 selected dysregulated lncRNAs were validated by RT-qPCR analysis. Several hundred lncRNAs were co-expressed with hundreds of mRNAs, and a number of these may contribute to ATRA/ATO-induced intracorporeal myeloid differentiation by affecting these mRNAs in trans and/or in cis. The present study not only clarified the contributions of lncRNAs to myeloid differentiation in APL and/or intracorporeal therapy response, but also elucidated possible dysregulated lncRNA expression mechanisms associated with ATRA-induced APL differentiation.

APL has shifted from a complex problem in the past into a paradigm with successful targeted therapies, and a series of published randomized clinical trials in patients with APL have all demonstrated efficacy on the frontline of ATRA/ATO association. The identification of a novel class of lncRNAs has attracted attention and may have encouraged investigations focused on characterizing lncRNAs associated with myeloid differentiation and responses to APL therapy. For example, several lncRNAs, including NEAT1 and HOTAIRM1, are indispensable during APL differentiation induced by ATRA (10,12,22). However, numerous lncRNAs and their roles in APL differentiation remain to be fully elucidated. A systematic analysis of the ATRA/ATO-induced intracorporeal myeloid differentiation transcriptome may reflect the complicated and dynamic intracorporeal synergy between ATRA and ATO in patients with APL. lncRNA and mRNA analysis in BM from patients with APL is expected to reflect real changes.

To examine global lncRNA and mRNA profiling in the present study, the Human Transcriptome Array 2.0 was used to screen the dysregulated lncRNAs in three patients with APL post- and pre-induction therapy. The results showed that 825 lncRNAs and 1,218 mRNAs were dysregulated, including 410 upregulated lncRNAs, 415 downregulated lncRNAs, 660 upregulated mRNAs, and 558 downregulated mRNAs, suggesting that these dysregulated lncRNAs may be involved in ATRA-induced myeloid differentiation. Consequently, the present study may assist in determining whether these dysregulated lncRNAs and mRNAs can be applied for the early assessment of APL therapy response or efficacy. The present study also cross-validated the dysregulated gene results from the GeneChip with the results of RT-qPCR analysis; this comparison showed consistency between the microarrays and RT-qPCR results, which supports further predictions.

An increasing number of lncRNAs have been recognized as critical factors in gene programs to control cell differentiation and function, and serving as scaffolds or decoys at the transcriptional and translational levels (23). Although the number of novel and known lncRNAs is increasing exponentially, only a small subset of these have functional annotations, and the most commonly used method to predict lncRNA function is by investigating their co-expressed mRNAs and associated biological pathways. In the present study, it was found that thousands of mRNAs are co-expressed with the dysregulated lncRNAs. Through functional prediction with the co-expressed mRNAs, the present study identified lncRNAs involved in DNA replication associated with cell cycle phase transition as the most affected by ATRA-induced myeloid differentiation. When stabilized and inhibited via cell cycle phase transitions, lncRNAs function as a vital factor for regulating cell cycle during the course of myeloid maturation in NB4 APL cells (13). Therefore, lncRNAs may be a potential modulator of DNA replication, in addition to certain regulatory TFs.

Compared with mRNAs, lncRNAs have the inherent characteristic of cis-regulation (24) and can cis-regulate their adjacent mRNAs (25). The epigenetic upregulation of lncRNAs is associated with cis-downregulation of a functional gene cluster in leukemia (26). In the present study, 48 lncRNAs were found to potentially promote cis-regulation of their adjacent mRNAs. Although the majority of the identified lncRNAs have not been characterized, two sets of lncRNA-mRNAs, including ENST00000536425 and EEA1 mRNA and NONHSAT061249 and ZNF564 and ZNF44 mRNAs, were identified. A previous study revealed that EEA1 serves as an identifying marker of early endosomes for neddylation of type II receptor, and aberrant neddylation results in the development of leukemia (27). The biological processes associated with ZNF564 and ZNF44 are involved in transcription and transcription regulation, respectively. These findings suggest that lncRNA-mRNA networks may contribute to the regulation of cell responses to ATRA-induced APL differentiation.

Certain lncRNAs have been demonstrated to be involved in cis-regulation; however, the majority of characterized lncRNAs are functionally trans-regulating (18,24). The present study predicted the trans-regulatory functions of lncRNAs through TFs. In the central network of lncRNA-TF pairs, the potential trans-regulatory lncRNAs were mainly trans-regulated by E2F1, E2F6, and EBF1. E2F1 and E2F6 are TFs that contribute to controlling cell cycle. Several studies have associated the activity of E2F with cell-cycle control (28,29). The E2F1-C/EBPa feedback loop regulates the expression of the oncogene tribbles 2, which is important for AML cell proliferation control (30). E2F6 may transcriptionally regulate cell-cycle G1/S genes via recruiting BRG1 (29). EBF1, a TF that is critical for normal and malignant B-lymphocyte development, controls DNA repair in a dose-dependent manner, which may explain the reason for the frequent loss of the EBF1 gene in leukemia (31). In the present study, the dysregulated lncRNAs involved in the pathways mainly regulated by E2F1, E2F6, and EBF1 were candidate participants in ATRA-induced myeloid differentiation. Consequently, the ‘trans’ analysis provides a method to interpret the functions of lncRNAs and their biological processes in APL therapy.

The lncRNA-TF analysis identified novel lncRNAs and three TFs for enriched dysregulated mRNAs that contributed to APL treatment. The results of the ‘cis’ and ‘trans’ analyses provided essential clues on the modular regulation of lncRNAs. The data obtained may promote future investigations on therapeutic mechanisms in APL. However, the present study had several limitations. First, the sample size was small; thus, investigations with larger sample sizes are required. Second, as the functions of several of the identified lncRNAs have not been annotated, it was only possible to predict the functions of lncRNAs through network and pathway analyses with their co-expressed mRNAs. Therefore, the biological functions of these lncRNAs require further validation.

In conclusion, the present study offered insight into the genome-wide patterns of lncRNA expression during the course of ATRA-based APL therapy. A set of dysregulated lncRNAs were identified in patients with APL who received ATRA-based therapy compared with untreated matched controls. Several lncRNAs may be involved in biological pathways associated with ATRA-induced myeloid differentiation through the cis and/or trans regulation of mRNAs. Furthermore, targeting aberrantly activated pathways in APL cells may offer strategies to circumvent or mitigate disease. The present study provides a foundation for future investigations on lncRNAs associated with ATRA-based APL therapy as therapeutic and diagnostic targets by supplying candidate genes. Additionally, the results provide a platform for systematically evaluating a large number of lncRNAs and mRNAs to identify pathways critical for APL elimination using primary APL patient specimens prior to and following targeted therapy.

Acknowledgements

We thank Professor Yan Li and Professor Yongqing Tong (Department of Clinical Laboratory, Renmin Hospital of Wuhan University) for their selfless assistance. We thank Shanghai OE Biotech Co., Ltd. (Shanghai, China) for providing lncRNA chip analyses and American Journal Experts (AJE) for providing language help.

Funding

The present study was supported by the Medical and Health Research Science and Technology Plan Project of Zhejiang Province (grant nos. 2017KY112 and 2018KY523), the Public Welfare Science and Technology Plan Project of Wenzhou City (grant no. Y20170201), the National Nature Science Foundation of China (grant no. 81701426) and the PhD Research Launching Fund Project of the Second Affiliated Hospital of Wenzhou Medical University (grant no. FEY001).

Availability of data and materials

The datasets used during the present study are available from the corresponding authors upon reasonable request.

Authors' contributions

ZGC, JCR and XQZ designed and supervised the project. YYB and JJY provided the samples and clinical information. JY and XLG performed the experiments. YYB and XQZ provided instructions for the experiments. ZGC and JY analyzed the data and wrote the manuscript. ZGC and XLG edited the manuscript. All authors read and approved the manuscript and agree to be accountable for all aspects of the research in ensuring that the accuracy or integrity of any part of the work are appropriately investigated and resolved.

Ethics approval and consent to participate

Written informed consent was collected from all the patients in conformity with the Declaration of Helsinki, and the present study obtained permission from the Ethics Committee of Wenzhou Medical University.

Patient consent for publication

Written informed consent was collected from all the patients.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

APL

acute promyelocytic leukemia

lncRNAs

long non-coding RNAs

ATRA

all-trans-retinoic acid

mRNA

messenger RNA

BM

bone marrow

RT-qPCR

reverse transcription-quantitative polymerase chain reaction

ATO

arsenic trioxide

AML

acute myeloid leukemia

MBMCs

mononuclear bone marrow cells

TFs

transcription factors

FC

fold change

KEGG

Kyoto Encyclopedia of Genes and Genomes

GO

Gene Ontology

EEA1

early endosome antigen 1

ZNF564

zinc finger protein 564

ZNF44

zinc finger protein 44

E2F1

E2F transcription factor 1

EBF1

early B cell factor 1

E2F6

E2F transcription factor 6

References

1 

Ablain J, Rice K, Soilihi H, de Reynies A, Minucci S and de Thé H: Activation of a promyelocytic leukemia-tumor protein 53 axis underlies acute promyelocytic leukemia cure. Nat Med. 20:167–174. 2014. View Article : Google Scholar : PubMed/NCBI

2 

Li K, Wang F, Cao WB, Lv XX, Hua F, Cui B, Yu JJ, Zhang XW, Shang S, Liu SS, et al: TRIB3 promotes APL progression through stabilization of the oncoprotein PML-RARα and inhibition of p53-mediated senescence. Cancer Cell. 31:697–710 e697. 2017. View Article : Google Scholar : PubMed/NCBI

3 

Wang ZY and Chen Z: Acute promyelocytic leukemia: From highly fatal to highly curable. Blood. 111:2505–2515. 2008. View Article : Google Scholar : PubMed/NCBI

4 

Lo-Coco F, Avvisati G, Vignetti M, Thiede C, Orlando SM, Iacobelli S, Ferrara F, Fazi P, Cicconi L, Di Bona E, et al: Retinoic acid and arsenic trioxide for acute promyelocytic leukemia. N Engl J Med. 369:111–121. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Lehmann-Che J, Bally C and de Thé H: Resistance to therapy in acute promyelocytic leukemia. N Engl J Med. 371:1170–1172. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Zhu HH, Qin YZ and Huang XJ: Resistance to arsenic therapy in acute promyelocytic leukemia. N Engl J Med. 370:1864–1866. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Wang KC and Chang HY: Molecular mechanisms of long noncoding RNAs. Mol Cell. 43:904–914. 2011. View Article : Google Scholar : PubMed/NCBI

8 

Pan JQ, Zhang YQ, Wang JH, Xu P and Wang W: lncRNA co-expression network model for the prognostic analysis of acute myeloid leukemia. Int J Mol Med. 39:663–671. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Cao L, Xiao PF, Tao YF, Hu SY, Lu J, Zhao WL, Li ZH, Wang NN, Wang J, Feng X, et al: Microarray profiling of bone marrow long non-coding RNA expression in Chinese pediatric acute myeloid leukemia patients. Oncol Rep. 35:757–770. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Chen ZH, Wang WT, Huang W, Fang K, Sun YM, Liu SR, Luo XQ and Chen YQ: The lncRNA HOTAIRM1 regulates the degradation of PML-RARA oncoprotein and myeloid cell differentiation by enhancing the autophagy pathway. Cell Death Differ. 24:212–224. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Wei S, Zhao M, Wang X, Li Y and Wang K: PU.1 controls the expression of long noncoding RNA HOTAIRM1 during granulocytic differentiation. J Hematol Oncol. 9:442016. View Article : Google Scholar : PubMed/NCBI

12 

Zeng C, Xu Y, Xu L, Yu X, Cheng J, Yang L, Chen S and Li Y: Inhibition of long non-coding RNA NEAT1 impairs myeloid differentiation in acute promyelocytic leukemia cells. BMC Cancer. 14:6932014. View Article : Google Scholar : PubMed/NCBI

13 

Zhang X, Weissman SM and Newburger PE: Long intergenic non-coding RNA HOTAIRM1 regulates cell cycle progression during myeloid maturation in NB4 human promyelocytic leukemia cells. RNA Biol. 11:777–787. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Zheng PZ, Wang KK, Zhang QY, Huang QH, Du YZ, Zhang QH, Xiao DK, Shen SH, Imbeaud S, Eveno E, et al: Systems analysis of transcriptome and proteome in retinoic acid/arsenic trioxide-induced cell differentiation/apoptosis of promyelocytic leukemia. Proc Natl Acad Sci USA. 102:7653–7658. 2005. View Article : Google Scholar : PubMed/NCBI

15 

Sanz MA, Grimwade D, Tallman MS, Lowenberg B, Fenaux P, Estey EH, Naoe T, Lengfelder E, Büchner T, Döhner H, et al: Management of acute promyelocytic leukemia: Recommendations from an expert panel on behalf of the European LeukemiaNet. Blood. 113:1875–1891. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Schmittgen TD and Livak KJ: Analyzing real-time PCR data by the comparative C(T) method. Nat Protoc. 3:1101–1108. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Guttman M, Amit I, Garber M, French C, Lin MF, Feldser D, Huarte M, Zuk O, Carey BW, Cassady JP, et al: Chromatin signature reveals over a thousand highly conserved large non-coding RNAs in mammals. Nature. 458:223–227. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Guttman M and Rinn JL: Modular regulatory principles of large non-coding RNAs. Nature. 482:339–346. 2012. View Article : Google Scholar : PubMed/NCBI

19 

Gerstein MB, Kundaje A, Hariharan M, Landt SG, Yan KK, Cheng C, Mu XJ, Khurana E, Rozowsky J, Alexander R, et al: Architecture of the human regulatory network derived from ENCODE data. Nature. 489:91–100. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Khalil AM, Guttman M, Huarte M, Garber M, Raj A, Rivea Morales D, Thomas K, Presser A, Bernstein BE, van Oudenaarden A, et al: Many human large intergenic noncoding RNAs associate with chromatin-modifying complexes and affect gene expression. Proc Natl Acad Sci USA. 106:11667–11672. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Guenzl PM and Barlow DP: Macro lncRNAs: A new layer of cis-regulatory information in the mammalian genome. RNA Biol. 9:731–741. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Wang Y, Fu L, Sun A, Tang D, Xu Y, Li Z, Chen M and Zhang G: C/EBPβ contributes to transcriptional activation of long non-coding RNA NEAT1 during APL cell differentiation. Biochem Biophys Res Commun. 499:99–104. 2018. View Article : Google Scholar : PubMed/NCBI

23 

Alvarez-Dominguez JR and Lodish HF: Emerging mechanisms of long noncoding RNA function during normal and malignant hematopoiesis. Blood. 130:1965–1975. 2017. View Article : Google Scholar : PubMed/NCBI

24 

Lee JT: Epigenetic regulation by long noncoding RNAs. Science. 338:1435–1439. 2012. View Article : Google Scholar : PubMed/NCBI

25 

Ørom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, Lai F, Zytnicki M, Notredame C, Huang Q, et al: Long noncoding RNAs with enhancer-like function in human cells. Cell. 143:46–58. 2010. View Article : Google Scholar : PubMed/NCBI

26 

Garding A, Bhattacharya N, Claus R, Ruppel M, Tschuch C, Filarsky K, Idler I, Zucknick M, Caudron-Herger M, Oakes C, et al: Epigenetic upregulation of lncRNAs at 13q14.3 in leukemia is linked to the In Cis downregulation of a gene cluster that targets NF-κB. PLoS Genet. 9:e10033732013. View Article : Google Scholar : PubMed/NCBI

27 

Zuo W, Huang F, Chiang YJ, Li M, Du J, Ding Y, Zhang T, Lee HW, Jeong LS, Chen Y, et al: c-Cbl-mediated neddylation antagonizes ubiquitination and degradation of the TGF-β type II receptor. Mol Cell. 49:499–510. 2013. View Article : Google Scholar : PubMed/NCBI

28 

Attwooll C, Lazzerini Denchi E and Helin K: The E2F family: Specific functions and overlapping interests. EMBO J. 23:4709–4716. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Leung JY and Nevins JR: E2F6 associates with BRG1 in transcriptional regulation. PLoS One. 7:e479672012. View Article : Google Scholar : PubMed/NCBI

30 

Rishi L, Hannon M, Salomè M, Hasemann M, Frank AK, Campos J, Timoney J, O'Connor C, Cahill MR, Porse B and Keeshan K: Regulation of Trib2 by an E2F1-C/EBPα feedback loop in AML cell proliferation. Blood. 123:2389–2400. 2014. View Article : Google Scholar : PubMed/NCBI

31 

Prasad MA, Ungerbäck J, Åhsberg J, Somasundaram R, Strid T, Larsson M, Månsson R, De Paepe A, Lilljebjörn H, Fioretos T, et al: Ebf1 heterozygosity results in increased DNA damage in pro-B cells and their synergistic transformation by Pax5 haploinsufficiency. Blood. 125:4052–4059. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

September-2018
Volume 40 Issue 3

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Yu J, Guo XL, Bai YY, Yang JJ, Zheng XQ, Ruan JC and Chen ZG: Genome‑wide profiling of lncRNA expression patterns in patients with acute promyelocytic leukemia with differentiation therapy. Oncol Rep 40: 1601-1613, 2018.
APA
Yu, J., Guo, X., Bai, Y., Yang, J., Zheng, X., Ruan, J., & Chen, Z. (2018). Genome‑wide profiling of lncRNA expression patterns in patients with acute promyelocytic leukemia with differentiation therapy. Oncology Reports, 40, 1601-1613. https://doi.org/10.3892/or.2018.6521
MLA
Yu, J., Guo, X., Bai, Y., Yang, J., Zheng, X., Ruan, J., Chen, Z."Genome‑wide profiling of lncRNA expression patterns in patients with acute promyelocytic leukemia with differentiation therapy". Oncology Reports 40.3 (2018): 1601-1613.
Chicago
Yu, J., Guo, X., Bai, Y., Yang, J., Zheng, X., Ruan, J., Chen, Z."Genome‑wide profiling of lncRNA expression patterns in patients with acute promyelocytic leukemia with differentiation therapy". Oncology Reports 40, no. 3 (2018): 1601-1613. https://doi.org/10.3892/or.2018.6521