Novel mutation in exon 56 of the dystrophin gene in a child with Duchenne muscular dystrophy
- Authors:
- Published online on: September 18, 2013 https://doi.org/10.3892/ijmm.2013.1498
- Pages: 1166-1170
Abstract
Introduction
Muscular dystrophy (MD) refers to a genetically heterogeneous group of degenerative muscle disorders that are characterized by the progressive loss of muscle strength and integrity (1), and the most common and severe type of MD is Duchenne muscular dystrophy (DMD; MIM#310200), which accounts for more than half of all MD cases (2–4) and affects approximately 1 in 3,500 live male newborns (5,6). This disease is associated with continuous cycles of muscle cell regeneration and degeneration, ultimately resulting in the failure of muscle regeneration; the muscle is substituted by fat and connective tissue. Clinical symptoms include constant falling, waddling and out-turned knees, which appear as early as the age of 2. Pathological studies have shown that DMD is triggered primarily by the decreased function of a vital muscle protein known as dystrophin, which is a long, rod-shaped molecule composed of 3,685 amino acid residues. It contains 4 distinct domains: an N-terminal actin binding domain, a central rod domain containing a second actin binding domain, a cysteine-rich (CR) domain and a C-terminal (CT) domain (7).
In 1987, the dystrophin gene was cloned by Koenig et al (8,9) approximately 150 years after the discovery of DMD, which is the largest human gene, which spans >3,000 kb on the X-chromosome and encodes a 14-kb transcript that consists of 79 exons, 78 introns and 8 promoters (10–13). Genotype analysis has revealed that DMD is a common X-linked recessive neuromuscular disorder caused by mutations of this gene inherited through the mothers who are carriers or that arise from germ line mosaicism. To date, there are 2 types of identified mutations of the dystrophin gene: deletions, which constitute approximately 60% of the mutations and generally involve the region of a major 3′-hotspot and a minor 5′-hotspot, exons 1–11 and 41–54 regions and non-deletions, which constitute 40% of the mutations, including point mutations, small deletions and insertions of the dystrophin gene (14,15).
In this study, we analyzed the coding sequences of the dystrophin gene in a Chinese family and identified a novel duplication mutation in exon 56 of the dystrophin gene that causes DMD, expanding the spectrum of mutations causing DMD. To our knowledge, we are the first to demonstrate that a novel duplication of a single base can cause severe DMD.
Materials and methods
Patients
The study participants were identified and enrolled at Huazhong University of Science and Technology Union Hospital, Wuhan, China. Informed consent was obtained from the participants in accordance with the study protocols approved by the Ethics Committee of Huazhong University of Science and Technology. Fourteen family members, including 9 males and 5 females participated in this study (Fig. 1A). Detailed records of their medical history, physical examinations and histopathological analysis of muscle tissue were obtained. The diagnosis of DMD was made on the basis of symptoms, physical signs and blood creatine kinase (CK) levels. Among all the family members, only the proband presented the clinical criteria of the DMD phenotype.
Direct DNA sequencing analyses
As previously described (16), venous blood (5 ml) was collected from the participants, and total human genomic DNA was isolated using the DNA Isolation kit for Mammalian Blood (Roche Diagnostics, Indianapolis, IN, USA). Considering that the dystrophin gene mutation is the genetic factor in DMD, we carried out mutation screening in the dystrophin gene directly without performing linkage analysis. The entire 79 exons and the exon-intron boundaries of the dystrophin gene of the proband were amplified by polymerase chain reaction (PCR). Primers were designed to amplify DNA fragments to span all 79 exons (range, of 200–800 bp; primers not shown). The nucleotide sequence of the DMD gene was obtained from GenBank (sequences of the primers are available upon request). Each amplicon was designed for an optimal size, with the exon centered within the amplicon. As a result, a total of 79 amplicons were used to sequence the coding region of the gene. Briefly, for PCR amplification, amplification was performed in a PTC-200 thermal cycler (MJ Research Inc., Waterdown, MA, USA) in a 25-μl reaction mixture containing 1.5 mM MgCl2, 0.2 mM of dNTP (Qiagen, Hilden, Germany), 0.5 μM primers, 1 U of TaqDNA polymerase (Qiagen) and 50 ng of genomic DNA. PCR was performed as follows: an initial denaturation step was carried out for 5 min at 94°C, 9 cycles of 45 sec at 94°C, 45 sec at 61.5°C and 45 sec at 72°C, followed by the same 29 cycles with a separate annealing temperature at 55°C. Direct bidirectional resequencing of all PCR-amplified products was performed using the BigDye Terminator Cycle Sequencing v3.1 kit (Applied Biosystems, Foster City, CA, USA) and electrophoresed on an ABI PRISM 3730 Genetic Analyzer (Applied Biosystems). Sequencing results from the subjects and dystrophin gene consensus sequences from GenBank (GenBank accession no. M18533) were compared using BLAST analysis. Mutation description followed the nomenclature recommended by the Human Genomic Variation Society. Resequencing of the mutated exon 56 of the dystrophin gene was performed on the 13 family members and the 100 unrelated controls and the primers used were as follows: forward, GGCACTGGGGTACACTTTATCATAGAA; and reverse, GCTGCACTCCTCATTTAAATTCACTCT.
Single-strand conformation polymorphism (SSCP) analysis
To confirm the mutation and determine whether the mutation co-segregates with the disease in the family, the novel variation detected in exon 56 of the dystrophin gene was further evaluated in the 14 available family members, as well as the normal control subjects using SSCP analysis, as previously described (17). Briefly, as mentioned above, PCR amplification was performed on exon 56 of the dystrophin gene and the primers used were as follows: forward, GAAAAGGGATTTGAGATGTA; and reverse, GTGCTAAGACAATGAGGAAA, and an initial denaturation annealing temperature at 60°C and a separate annealing temperature at 53°C. Subsequently, 2 μl of undigested PCR products were mixed with 4 μl of the degenerating loading buffer, denatured at 95°C for 10 min and immediately placed on ice; they were then loaded on 6% polyacrylamide gels and the DNA samples were separated by electrophoresis overnight at 150 V. The DNA bands were visualized by silver staining.
Results
Pedigree and clinical features of the family
The patient was a 4-year-old boy of Chinese origin, born after a normal term pregnancy. He developed normally until the age of 2. Family history was negative and his parents were not consanguineous. He began to walk when at 18 months of age. However, at age 3 he presented his first symptom, a tendency to fall, and had difficulty in rising from the floor and in walking on his toes. At age 4 he had a waddling gait and could no longer climb stairs. A physical examination revealed proximal muscle weakness, calf hypertrophy, a mild weakness of the limb-girdle muscles, deep tendon hyporflexia, hyperlordosis and a positive Gower’s sign. Serum muscle enzyme concentrations were markedly increased to 33,400 U/l (normal: 37–174 U/l). His muscle biopsy specimen revealed dystrophic features with a wide variation in fiber size, including fiber hypertrophy, degeneration, atrophy and an increase in endomysial connective tissue (Fig. 1C). However, all the clinical features of the proband were not discovered in the other members of his family, particularly his mother.
Mutation analysis
To identify the molecular basis of DMD in the proband, exons 1–79 of the dystrophin gene were amplified by PCR. By direct bidirectional sequencing of the PCR products in the proband, a duplication at position 8284 (c.8284dupA) in exon 56 of the dystrophin gene (Fig. 2A) was revealed; this was confirmed by repeating the experiment. We did not find any other mutation or polymorphism in the exons of the dystrophin gene. Since DMD is a common X-linked recessive neuromuscular disorder, direct sequence analysis of DNA from his parents and brother was also performed on exon 56 of the dystrophin gene. However, the sequence was the same as that of the normal one (Fig. 2B).
Analysis of the changes in dystrophin protein sequences after mutation
A duplication (c.8284dupA) in the dystrophin gene causes a termination codon TGA that results in a truncated product of 2,770 amino acid residues (p.Ile2762Asnfs*10) (Fig. 2C) instead of the wild-type length of 3,685 amino acid residues. Ile2762 is highly conserved among humans (Homo sapiens), mice (Mus musculus), chickens (Gallus gallus), rats (Rattus norvegicus) and orangutans (Pongo abelii) (Fig. 2D).
SSCP analysis
To confirm the mutation and test whether the mutation co-segregates with the disease in the family, the novel variation detected in exon 56 of the dystrophin gene was further evaluated in the 14 available family members, as well as in the normal control subjects using SSCP analysis (Fig. 3). The SSCP results revealed that an extra band was found in exon 56 of the dystrophin gene. However, the DNA samples from the 100 normal males and all the family members were also analyzed by SSCP, and the results revealed that the unaffected members of the family and the 100 normal Chinese Han controls did not carry this mutation. These results further suggest that this novel mutation (c.8284dupA, p.Ile2762Asnfs*10) of the dystrophin gene is not a rare polymorphism, but a causative mutation for DMD in the proband.
Discussion
The present study demonstrates that the newly identified mutation in exon 56 of the dystrophin gene (c.8284dupA) is associated with DMD in a child in a Chinese family, and that this mutation is a de novo mutation, but not an X-linked recessive mode of inheritance from the mother. First, the fact that the clinical manifestations of proximal muscle weakness, calf hypertrophy, mild weakness of the limb-girdle muscles, deep tendon hyporflexia, hyperlordosis and a positive Gower’s sign occurred only in the proband. The other members did not present these clinical features. Second, the genotype revealed a duplication at position 8284 (c.8284dupA) in exon 56 of the dystrophin gene, but the mother and brother had a normal genotype at this position. Furthermore, the fact that the mutation found in the proband was not detected in the 100 unrelated control subjects without DMD by SSCP excludes the possibility that this mutation is a polymorphism.
Full-length dystrophin is a large rod-shaped protein with a molecular weight of 427 kDa that contains 3,685 amino acid (AA) residues and comprises 4 domains (Fig. 4), which include the actin-binding (N-terminal) domain (AA #14–240, exons 2–8), the central rod domain (AA #253–3040, exons 8–61) consisting of 24 spectrin repeats and 4 hinge regions, the CR domain (AA #3080–3360, exons 62–69) and the CT domain (AA #3361–3685, exons 69–79) (18–21). In this study, we find the newly identified mutation in exon 56 of the dystrophin gene (c.8284dupA), which results in a frameshift mutation and a premature termination 10 codons downstream (p.Ile2762Asnfs*10) by stop codon TGA, which is thus far the most frequent point mutation found in the DMD gene (10/47) (22). Due to this mutation, the entire CR and CT domain was lacking. In the context of a full-length dystrophin protein, the essential CR and CT domain was not retained; the protein is completely non-functional (23), which seems to cause severe symptoms (24). These results are consistent with the conclusion of Koenig et al (8,9), who pointed out that the nucleotide sequence corresponding to the CR and CT domain was lacking in most DMD cases based on their dystrophin gene mutation analysis. Dystrophin is associated with the plasma membrane of cardiac and skeletal muscle (sarcolemma) and its main role in the sarcolemma is to interact with integral membrane proteins (sarcoglycan, dystroglycans, syntrophin and dystrobrevin complexes) that are assembled in the dystrophin-glycoprotein complex (DGC) through its CR and CT domains (Fig. 4) (25), including the last 54 amino acid residues of the rod to the CR domain (amino acid residues #3026–3345) (26). Therefore, the lack of these domains in the dystrophin gene leads to destabilization and loss of the DGC (27). Thus, as long as the CR and CT are deleted, the binding between syntrophin and dystrobrevin is eliminated. Consequently, the function of the muscle is diminished.
In conclusion, although several point mutations in the dystrophin gene associated with DMD have been identified worldwide (28,29), in this study, we identified a novel duplication in exon 56 of the dystrophin gene in a Chinese child with DMD. To our knowledge, this is the first report of Chinese DMD patients with a duplication in the region of exon 56, which results in truncated dystrophin lacking the CR and CT. This finding expands the mutation spectrum of the dystrophin gene and may prove useful and valuable for genetic counseling and prenatal diagnosis in families with DMD.
Abbreviations:
CR |
cysteine-rich domain |
CT |
C-terminal domain |
DGC |
dystrophin-glycoprotein complex |
DMD |
Duchenne muscular dystrophy |
MD |
muscular dystrophy |
SSCP |
single-strand conformation polymorphism analysis |
References
Emery AE: The muscular dystrophies. Lancet. 359:687–695. 2002. View Article : Google Scholar : PubMed/NCBI | |
Hoffman EP, Brown RH and Kunkel LM: Dystrophin: The protein product of the Duchenne Muscular Dystrophy locus. Cell. 51:919–928. 1987. View Article : Google Scholar : PubMed/NCBI | |
Emery AE: Population frequencies of inherited neuromuscular disorders - a world survey. Neuromuscul Disord. 1:19–29. 1991. View Article : Google Scholar : PubMed/NCBI | |
Blake DJ, Weir A, Newey SE and Davies KE: Function and genetics of dystrophin and dystrophin-related proteins in muscle. Physiol Rev. 82:291–329. 2002.PubMed/NCBI | |
van Essen AJ, Kneppers AL, van der Hout AH, et al: The clinical and molecular genetic approach to Duchenne and Becker muscular dystrophy: an updated protocol. J Med Genet. 34:805–812. 1997.PubMed/NCBI | |
Sura T, Eu-ahsunthornwattana J, Pingsuthiwong S and Busabaratana M: Sensitivity and frequencies of dystrophin gene mutations in Thai DMD/BMD patients as detected by multiplex PCR. Dis Markers. 25:115–121. 2008. View Article : Google Scholar : PubMed/NCBI | |
Batchelor CL and Winder SJ: Sparks, signals and shock absorbers: How dystrophin loss causes muscular dystrophy. Trends Cell Biol. 16:198–205. 2006. View Article : Google Scholar : PubMed/NCBI | |
Koenig M, Hoffman EP, Bertelson CJ, et al: Complete cloning of the Duchenne muscular dystrophy (DMD) cDNA and preliminary genomic organization of the DMD gene in normal and affected individuals. Cell. 50:509–517. 1987. View Article : Google Scholar : PubMed/NCBI | |
Koenig M, Monaco AP and Kunkel LM: The complete sequence of dystrophin predicts a rod-shaped cytoskeleton protein. Cell. 53:219–228. 1988. View Article : Google Scholar : PubMed/NCBI | |
Ahn AH and Kunkel LM: The structural and functional diversity of dystrophin. Nat Genet. 3:283–291. 1993. View Article : Google Scholar : PubMed/NCBI | |
Nishio H, Takeshima Y, Narita N, et al: Identification of a novel first exon in the human dystrophin gene and of a new promoter located more than 500 kb upstream of the nearest known promoter. J Clin Invest. 94:1037–1042. 1994. View Article : Google Scholar : PubMed/NCBI | |
Magri F, Del Bo R, D’Angelo MG, et al: Clinical and molecular characterization of a cohort of patients with novel nucleotide alterations of the dystrophin gene detected by direct sequencing. BMC Med Genet. 12:372011. View Article : Google Scholar : PubMed/NCBI | |
Dent KM, Dunn DM, von Niederhausern AC, et al: Improved molecular diagnosis of dystrophinopathies in an unselected clinical cohort. Am J Med Genet A. 134:295–298. 2005. View Article : Google Scholar : PubMed/NCBI | |
Tuffery-Giraud S, Chambert S, Demaille J and Claustres M: Point mutations in the dystrophin gene: evidence for frequent use of cryptic splice sites as a result of splicing defects. Hum Mutat. 14:359–368. 1999. View Article : Google Scholar : PubMed/NCBI | |
Wang Q, Li-Ling J, Lin C, et al: Characteristics of dystrophin gene mutations among Chinese patients as revealed by multiplex ligation-dependent probe amplification. Genet Test Mol Biomarkers. 13:23–30. 2009. View Article : Google Scholar : PubMed/NCBI | |
Cai F, Zhu J, Chen W, et al: A novel PAX6 mutation in a large Chinese family with aniridia and congenital cataract. Mol Vis. 16:1141–1145. 2010.PubMed/NCBI | |
Wang Q, Shen J, Splawski I, et al: SCN5A mutations associated with an inherited cardiac arrhythmia, long QT syndrome. Cell. 80:805–811. 1995. View Article : Google Scholar : PubMed/NCBI | |
Sadoulet-Puccio HM and Kunkel LM: Dystrophin and its isoforms. Brain Pathol. 6:25–35. 1996. View Article : Google Scholar | |
Roberts RG: Dystrophins and dystrobrevins. Genome Biol. 2:REVIEWS30062001. View Article : Google Scholar : PubMed/NCBI | |
Davies KE, Tinsley JM and Blake DJ: Molecular analysis of Duchenne muscular dystrophy: past, present, and future. Ann NY Acad Sci. 758:287–296. 1995. View Article : Google Scholar : PubMed/NCBI | |
Ozawa E: Our trails and trials in the subsarcolemmal cytoskeleton network and muscular dystrophy researches in the dystrophin era. Proc Jpn Acad Ser B Phys Biol Sci. 86:798–821. 2010. View Article : Google Scholar : PubMed/NCBI | |
Wang J, Wang W, Li R, et al: The diploid genome sequence of an Asian individual. Nature. 456:60–65. 2008. View Article : Google Scholar : PubMed/NCBI | |
Nishida A, Kataoka N, Takeshima Y, et al: Chemical treatment enhances skipping of a mutated exon in the dystrophin gene. Nat Commun. 2:3082011. View Article : Google Scholar : PubMed/NCBI | |
Hall N: Advanced sequencing technologies and their wider impact in microbiology. J Exp Biol. 210:1518–1525. 2007. View Article : Google Scholar : PubMed/NCBI | |
Singh SM, Kongari N, Cabello-Villegas J and Mallela KM: Missense mutations in dystrophin that trigger muscular dystrophy decrease protein stability and lead to cross-beta aggregates. Proc Natl Acad Sci USA. 107:15069–15074. 2010. View Article : Google Scholar : PubMed/NCBI | |
Ishikawa-Sakurai M, Yoshida M, Imamura M, et al: ZZ domain is essentially required for the physiological binding of dystrophin and utrophin to beta-dystroglycan. Hum Mol Genet. 13:693–702. 2004. View Article : Google Scholar : PubMed/NCBI | |
Kemaladewi DU, Hoogaars WM, van Heiningen SH, et al: Dual exons kipping in myostatin and dystrophin for Duchenne muscular dystrophy. BMC Med Genomics. 4:362011. View Article : Google Scholar : PubMed/NCBI | |
Hwa HL, Chang YY, Huang CH, et al: Small mutations of the DMD gene in Taiwanese families. J Formos Med Assoc. 107:463–469. 2008. View Article : Google Scholar : PubMed/NCBI | |
Sitnik R, Campiotto S, Vainzof M, et al: Novel point mutations in the dystrophin gene. Hum Mutat. 10:217–222. 1997. View Article : Google Scholar : PubMed/NCBI |