miR‑221 targets HMGA2 to inhibit bleomycin‑induced pulmonary fibrosis by regulating TGF‑β1/Smad3-induced EMT
- Authors:
- Published online on: August 11, 2016 https://doi.org/10.3892/ijmm.2016.2705
- Pages: 1208-1216
Abstract
Introduction
Idiopathic pulmonary fibrosis (IPF) is an aggressive disease that involves the replacement of normal lung parenchyma with fibrotic tissue in combination with inflammation, fibroblast proliferation, and excessive collagen deposition (1). Epithelial-mesenchymal transition (EMT), which is characterized by the loss of epithelial characteristics (E-cadherin) and the acquisition of a mesenchymal phenotype [N-cadherin, vimentin, and α-smooth muscle actin (α-SMA)] (3), is a major contributor to the pathogenesis of fibrosis (4). Accordingly, it is necessary to better understand the process of EMT in order to develop novel therapeutic strategies for IPF (5). As a well-established inducer of EMT (6–8), the increased expression of transforming growth factor-β1 (TGF-β1) has been suggested to lead to tissue fibrosis in many organs, including the lung (9–12). Moreover, the inhibition of TGF-β1/Smad3 signaling has been reported to ameliorate fibrosis, validating the TGF-β1/Smad3 signaling pathway as a therapeutic target for the treatment of lung fibrosis (13–15). High mobility group AT-hook 2 (HMGA2), a transcription factor that is induced by the TGF-β1/Smad3 signaling pathway during the EMT process (3), is also reported to promote EMT (2) and to be upregulated in IPF (3).
MicroRNAs (miRNAs or miRs) are a type of small, non-coding RNAs which regulate protein expression by either inhibiting translation or initiating the specific degradation of target mRNAs (16). Previous studies suggest that miRNA regulation is critical in the process of EMT and pulmonary fibrosis. For example, members of the miR-200 family and miR-205 are decreased when cells undergo EMT (17). miR-124 targets Slug to regulate EMT and promote the metastasis of breast cancer (18). The increased expression of miR-155 has been found in a mouse model of lung fibrosis (19). Liu et al have demonstrated that mice with bleomycin (BLM)-induced pulmonary fibrosis exhibited a significant increase in miR-21 levels, which was associated with an increased TGF-β level (20). Additionally, the decreased expression of members of the miR-29 family is also found in the lungs of patients with IPF compared with normal individuals (21). Accordingly, miRNAs merit further evaluation as a therapeutic target in pulmonary fibrosis.
miR-221 is reported not only to induce EMT in pancreatic cancer (22), breast cancer (23) and bladder cancer (24), but it is also associated with kidney fibrosis (25) and liver fibrosis (26). However, whether miR-221 plays a role in pulmonary fibrosis as well as the target of miR-221 in the EMT process remain largely unknown. In this study, we first detected the expression of miR-221 and HMGA2 in human IPF tissue and cells. The expression of EMT-related proteins in human bronchial epithelium (HBE) cells and adenocarcinoma A549 cells was detected following TGF-β1 treatment. Following the transfection of miR-221 mimics, the expression of Smad3, phosphorylated (p-) Smad3 and HMGA2 was detected. EMT and cell proliferation were also evaluated in miR-221-overexpressing cells. The association between miR-221 and HMGA2 was confirmed by a dual-luciferase reporter gene assay. Finally, a model of BLM-induced pulmonary fibrosis was used in order to examine the protective effects of miR-221 in EMT. These findings may provide novel insights into the treatment of pulmonary fibrosis.
Materials and methods
Isolation of human lung tissue
A total of 10 human IPF tissues and the corresponding adjacent normal tissues were obtained from surgical remnants of biopsies or lungs explanted from patients with IPF that underwent pulmonary transplantation. This study was approved by the Ethics Committee of Central South University (Changsha, China). All patients provided written informed consent for the use of their samples in scientific research.
Cell culture
The HBE and adenocarcinoma A549 cell lines were purchased from Auragene Bioscience Co. (Changsha, China). The cells were cultured in Dulbecco's modified Eagle's medium (Hyclone, Logan, UT, USA) supplemented with 10% fetal calf serum (Gibco BRL, Gaithersburg, MD, USA). TGF-β1 (Sigma-Aldrich, St. Louis, MO, USA) was used at final concentration of 10 ng/ml. The cells were cultured in medium containing TGF-β1 for 48 h, and then collected for further analysis.
Transfection
The A549 and HBE cells were cultured as described above prior to transfection. A total of 100 pmol of either mimics NC, miR-221 mimics, inhibitor NC or miR-221 inhibitor (Auragene Bioscience Co.) was diluted in 250 µl serum-free RPMI-1640 medium, which was then mixed with 10 µl Lipofectamine® 2000 (diluted in 250 µl serum-free medium). After incubation at 37°C for 4 h, the medium was replaced with complete medium and cultured for a further 48 h. The cells were then collected for use in subsequent experiments.
MTT assay
For proliferation analysis of A549 and HBE cells, 5,000 cells were plated in three 96-well plates. At 24, 48 and 72 h, the cells in one plate were treated with 20 µl MTT solution (5 mg/ml) for 4 h. Subsequently, MTT solution was replaced with 150 µl dimethylsulfoxide (DMSO) to dissolve the tetrazolium crystals. After 10 min, the optical density values were read at a test wavelength of 570 nm with a microplate reader (Thermo Labsystems, Altrincham, UK).
Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
Total RNA was extracted from cells and tissues using TRIzol reagent (Life Technologies, Shanghai, China) according to the manufacturer's instructions. cDNA was synthesized with a TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems Life Technologies, Foster City, CA, USA). qPCR was performed using a Lightcycler® 480 SYBR-Green I Master system (Roche, Mannheim, Germany) according to the manufacturer's instructions. β-actin was used as an internal control. The following primer sequences were used: miR-221 (HmiRQP0337) and U6 (HmiRQP9001) (both from Fulengen, Guangzhou, China); HMGA2 sense, TGTGGCCAATGGAACAGTAA and antisense, CGACCAACAACAGCAAAGAA; TGF-β1 sense, CGAGCCTGAGGCCGACTACTA and antisense, CTCGGAGCTCTGATGTGTTGAA; collagen III sense, TGATGGGATCCAATGAGGGAGA and antisense, GAGTCTCATGGCCTTGCGTGTTT; collagen I sense, ATCAGCCCAAACCCCAAGGAGA and antisense, CGCAGGAAGGTCAGCTGGATAG; E-cadherin sense, CATTTCCCAACTCCTCTCCTGGC and antisense, ATGGGCCTTTTTCATTTTCTGGG; N-cadherin sense, CCACGCCGAGCCCCAGTATC and antisense, CCCCCAGTCGTTCAGGTAATCA; vimentin sense, GACGCCATCAACACCGAGTT and antisense, CTTTGTCGTTGGTTAGCTGGT; α-SMA sense, AGAAGCCCAGCCAGTCGCCATCA and antisense, AGCAAAGCCCGCCTTACAGAGCC; β-actin sense, AGGGGCCGGACTCGTCATACT and antisense, GGCGGCACCACCATGTACCCT. PCR was performed in a total volume of 20 µl, including 10 µl of 2X SYBR-Green qPCR Mix, 1 µl of each forward and reverse primer (10 µmol/l), 1 µl of each cDNA sample and 7 µl H2O. Amplifications were performed in triplicate in 96-well microtiter plates. The thermal cycling conditions were as follows: 95°C for 3 min, followed by 35 cycles of 95°C for 10 sec, and 60°C for 30 sec, finally followed by 95°C for 12 sec and 60°C for 50 sec.
Western blot analysis
Lysates of whole-cell or tissue homogenate were lysed in a buffer containing 150 mM NaCl, 1 mM phenymethylsulfonyl fluoride, NaVO4, aprotinin and leupeptin as protease inhibitors, 50 mM Tris-HCl pH 8.0, 0.2% sodium dodecyl sulphate (SDS), 1% NP-40. Protein (30 µg/sample) was resolved on a SDS-polyacrylamide gel with subsequent transfer blotting. The membranes were incubated at 4°C with the following primary antibodies overnight: HMGA2 (ab97276; Abcam, Cambridge, UK); E-cadherin (YT1453; ImmunoWay Biotechnology Company, Newark, DE, USA); N-cadherin (ab18203; Abcam); vimentin (YT4881) and α-SMA (YT5053) both from ImmunoWay Biotechnology Company); collagen I (ab34710) and collagen III (ab7778) (both from Abcam); TGF-β1 (YT4632; ImmunoWay Biotechnology Company); Smad3 (#9513s; Cell Signaling Technology, Danvers, MA, USA); and p-smad3 (sc-130218; Santa Cruz Biotechnology, Inc., Dallas, TX, USA). After washing, the membranes were incubated with the corresponding secondary antibody (111-035-003 or 111-035-008; Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA) for 1 h at room temperature, followed by chemiluminescence for visualization.
miRNA target prediction
The miRNA target prediction software, microRNA.org-Targets and Expression, was used to identify potential miR-221 targets.
Dual-luciferase reporter gene assay
A dual-luciferase reporter gene assay kit (E1910; Promega Corp., Madison, WI, USA) was used in the experiment. A 3′-untranslated region (3′-UTR) segment of the HMGA2 gene was amplified by PCR. The PCR products were recombined with psi-CHECK2. A549 and HBE cells were transfected with the firefly luciferase HMGA2-3′-UTR-psi-CHECK2, combined with miR-221 mimics (HmiR-AN0337), miR-221 inhibitor (HmiR-AN0337-SN-10), miRNA negative control (NC) mimics (CmiR-AN0001) and miRNA NC inhibitor (CmiR-AN0001-SN) (all from Fulengen), respectively. Twenty-four hours after transfection, the cells were lysed with a 1X passive lysis buffer and the activity of both Renilla and firefly luciferase was assayed using the dual-luciferase reporter assay system (Promega Corp.) according to the manufacturer's instructions.
Establishment of a mouse model of BLM-induced pulmonary fibrosis
A total of 35 8-week-old male BALB/c mice were purchased from the Slaccas Experimental Animal Company (Shanghai, China). All animal experiments were carried out after obtaining approval from the Ethics Committee of Central South University. The mice were divided into the following 4 groups: i) control, ii) BLM, iii) BLM + pre-Con, and iv) BLM + pre-miR-221. For BLM (Hisun Pfizer Pharmaceuticals Co., Ltd., Zhejiang, China) treatment, 8-week-old mice were anesthetized with isoflurane. BLM (10 mg/kg body weight in 50 µl saline) was delivered into the oropharyngeal cavity after the tongues of the anesthetized mice were gently pulled forward. The tongue was kept in an extended position until intratracheal injection was complete. The control group without BLM treatment was injected with saline whereas the BLM group was without injection. The other 2 groups were injected with the mimics NC and miR-221 mimics (10 mg/kg), respectively. Saline and the mimics were injected intratracheally. The mice were sacrificed after 28 days, and the lung tissue was used for subsequent analysis.
Hematoxylin and eosin (H&E) staining
The assay was performed by the UAB Tissue Histology Core Facility as described previously (27).
Statistical analysis
All data are presented as the means ± standard deviation (SD). Comparisons among groups were performed by one-way ANOVA using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). All experiments were repeated three times. P<0.05 was considered to indicate a statistically significant difference.
Results
miR-221 expression is downregulated and HMGA2 expression is upregulated both in vivo and in vitro
To detect the expression of miR-221 and HMGA2 in human IPF tissue, 10 samples of human IPF tissue and adjacent normal tissue were collected and analyzed by qPCR, respectively. As shown in Fig. 1A, miR-221 expression in the IPF tissues was significantly downregulated compared with that in the adjacent normal tissues (P=0.025). Notably, the relative expression of HMGA2 in the IPF tissues was significantly higher than that in the adjacent normal tissues (P=0.001, Fig. 1B).
Additionally, we examined miR-221 and HMGA2 expression in adenocarcinoma A549 cells and HBE cells following TGF-β1 treatment. As shown in Fig. 1C, the mRNA expression of TGF-β1 in both A549 and HBE cells was significantly increased (A549, P=0.017; HBE, P=0.009). miR-221 expression was significantly downregulated (A549, P=0.019; HBE, P=0.002; Fig. 1D) whereas HMGA2 was highly expressed in the cells following TGF-β1 treatment (A549, P=0.011; HBE, P=0.002; Fig. 1E). Furthermore, the expression of HMGA2 in A549 and HBE cells was evaluated by western blot analysis (Fig. 1F). The protein expression of HMGA2 was significantly upregulated in both cell types (A549, P=0.002; HBE, P=0.003; Fig. 1G). Collectively, these findings indicate that miR-221 was downregulated both in IPF tissues and in A549 and HBE cells whereas HMGA2 expression was upregulated.
TGF-β1 induces the EMT in A549 and HBE cells
EMT is characterized by the loss of the epithelial cell marker E-cadherin and the increased expression of the mesenchymal markers N-cadherin, vimentin and α-SMA as well as the associated deposition of collagens. qPCR and western blot analysis were performed to evaluate the expression of E-cadherin, N-cadherin, vimentin, α-SMA, collagen I and collagen III in A549 and HBE cells. The qPCR data showed that N-cadherin (A549, P=0.003; HBE, P=0.033), vimentin (A549, P=0.004; HBE, P=0.009), α-SMA (A549, P=0.019; HBE, P=0.002), collagen I (A549, P=0.008; HBE, P=0.028) and collagen III (A549, P=0.008; HBE, P=0.003) were significantly increased whereas E-cadherin (A549, P=0.01; HBE, P=0.021) expression was significantly decreased (Fig. 2A) in the TGF-β1-treated group compared with the control group. Western blot analysis revealed that TGF-β1 had similar effects on the expression of E-cadherin (A549, P=0.002; HBE, P=0.003), N-cadherin (A549, P=0.001; HBE, P=0.000), vimentin (A549, P=0.003; HBE, P=0.017), α-SMA (A549, P=0.048; HBE, P=0.002), collagen I (A549, P=0.009; HBE, P=0.002) and collagen III (A549, P= 0.001; HBE, P= 0.002) as those observed in qPCR (Fig. 2B and C). Taken together, these findings demonstrate that TGF-β1 induced the EMT in A549 and HBE cells.
Overexpression of miR-221 suppressed the TGF-β1/Smad3 signaling pathway in vitro
The effect of miR-221 on the activation of TGF-β1/Smad3 signaling pathway was evaluated by western blot analysis. The protein expression of p-Smad3 in A549 and HBE cells was significantly upregulated following TGF-β1 treatment (A549, P=0.002; HBE, P=0.001), whereas no changes were observed in Smad3 expression (A549, P=0.065; HBE, P=0.073; Fig. 3A and B). This indicates that TGF-β1/Smad3 signaling was activated by TGF-β1 in both cell types.
Additionally, we performed gain-of-function studies using miR-221 mimics, and miRNA transfection efficiency was determined by qPCR. Following the transfection of A549 and HBE cells with miR-221 mimics, miR-221 expression was significantly upregulated (A549, P=0.004; HBE, P=0.001; Fig. 3C). However, the results of western blot analysis (Fig. 3D) revealed a significant decrease in the protein expression of p-Smad3 in both types of miR-221-overexpressed cells (A549, P=0.000; HBE, P=0.000), with no difference in Smad3 protein expression (A549, P=0.074; HBE, P=0.064; Fig. 3E). These findings conclusively demonstrate that miR-221-overexpressing cells suppressed the activation of the TGF-β1/Smad3 signaling pathway.
Overexpression of miR-221 downregulates HMGA2 expression, suppresses the EMT and inhibits cell proliferation
Following the transfection of miR-221 mimics, the expression of HMGA2 was evaluated by qPCR and western blot analysis. The relative expression of HMGA2 was downregulated after overexpression of miR-221 (A549, P=0.013; HBE, P= 0.001; Fig. 4A). Western blot analysis revealed similar results to those observed in the qPCR results (A549, P=0.001; HBE, P=0.001; Fig. 4B and C).
qPCR and western blot analysis were then used to evaluate the effect of miR-221 overexpression on EMT regulation. As shown in Fig. 4D, the expression of N-cadherin (A549, P=0.042; HBE, P=0.014), vimentin (A549, P=0.000; HBE, P= 0.034), α-SMA (A549, P=0.007; HBE, P=0.001), collagen I (A549, P=0.017; HBE, P=0.006) and collagen III (A549, P=0.016; HBE, P=0.005) was significantly decreased, whereas E-cadherin expression(A549, P=0.042; HBE, P=0.049) was significantly increased following transfection with miR-221 mimics, compared with the control group. The results of western blot analysis showed that miR-221 overexpression had similar effects on the expression of E-cadherin (A549, P=0.005; HBE, P=0.012), N-cadherin (A549, P=0.000; HBE, P=0.002), vimentin (A549, P=0.011; HBE, P=0.010), α-SMA (A549, P=0.000; HBE, P=0.007), collagen I (A549, P=0.032; HBE, P=0.002) and collagen III (A549, P=0.001; HBE, P=0.003) as in qPCR (Fig. 4E and F). Taken together, these findings demonstrate that miR-221 overexpression suppressed the EMT in A549 and HBE cells.
Additionally, the effects of upregulating miR-221 on the proliferation of A549 and HBE cells were examined by MTT assay. Transfection of miR-221 mimics led to a significant decrease in the proliferation of A549 (P<0.01) and HBE (P<0.01) cells, and the anti-miR-221 group exhibited a significant increase in the proliferation of A549 (P<0.01) and HBE (P<0.05) cells (Fig. 4G). These data indicate that miR-221 plays a vital role in reducing the EMT in vitro.
miR-221 directly targets HMGA2 and downregulates the expression of HMGA2 in A549 and HBE cells
The bioinformatics tool, microRNA.org-Targets and Expression, was used to predict the targets for miR-221. HMGA2 was identified as a potential target of miR-221. Additionally, a dual-luciferase reporter gene assay was performed to examine whether HMGA2 was functionally targeted by miR-221. Fig. 5A shows that overexpression of miR-221 inhibited luciferase activity from the construct with the HMGA2-3′-UTR segment in both A549 (P=0.026) and HBE cells (P=0.011). No changes were observed in luciferase reporter activity when the cells were transfected with anti-miR-221 or the controls. This demonstrates that HMGA2 was a direct target of miR-221 in A549 and HBE cells.
In addition, we performed qPCR and western blot analysis to evaluate the expression of HMGA2 following the transfection of A549 and HBE cells with pre-miR-221 or anti-miR-221 mimics. As shown in Fig. 5B, pre-miR-221 significantly increased miR-221 expression (A549, P=0.022; HBE P=0.020), and anti-miR-221 decreased miR-221 expression (A549, P=0.006; HBE, P=0.009). By contrast, HMGA2 mRNA expression was downregulated in the pre-miR-221 group (A549, P=0.025; HBE P=0.012) and upregulated in the anti-miR-221 group (A549, P=0.010; HBE, P=0.032; Fig. 5C). The results of western blot analysis showed similar effects as miR-221 overexpression downregulated the expression of HMGA2 (pre-miR-221: A549, P=0.007; HBE, P=0.001; anti-miR-221: A549, P=0.003; HBE, P=0.000) as in qPCR (Fig. 5D and E).
miR-221 suppresses BLM-induced pulmonary fibrosis
Firstly, we examined the suppressive effect of miR-221 on lung fibrosis by H&E staining. As shown in Fig. 6A, tissues in the control group exhibited a continuous structure with an intact wall of bronchial mucous membrane and normal lung alveoli. However, the BLM and BLM + pre-Con groups had the thickest alveolar walls among all the groups. Furthermore, the lung mesenchyme in the BLM and BLM + pre-Con groups showed strong immunohistochemical staining for collagens and collagen fibers, indicating that the hallmark of the fibroblastic foci was present after BLM treatment. However, these characteristics of lung fibrosis were significantly reduced in the miR-221-treated groups. The tissue sections from miR-221-treated groups had thinner alveolar walls.
Additionally, western blot analysis and qPCR were performed to evaluate the expression of EMT-related proteins. MiR-221 significantly increased E-cadherin expression (P=0.021; P=0.002), and significantly decreased vimentin (P= 0.001; P= 0.004), α-SMA (P=0.005; P=0.005), collagen I (P=0.001; P=0.010), and collagen III (P=0.012; P=0.005) compared with BLM group and BLM+pre-Con group, respectively (Fig. 6B and C). The results of qPCR showed that miR-221 treatment had similar effects as those observed with western blot analysis on the BLM-induced downregulated expression of E-cadherin (compared with BLM, P=0.004, compared with BLM + pre-Con, P=0.001) and on the BLM-induced upregulated expression of other EMT-related proteins (vimentin, P= 0.005, P= 0.008; α-SMA, P=0.012, P=0.007; collagen I, P=0.000, P=0.001; collagen III, P=0.006, P=0.001) compared with BLM group and BLM+pre-Con group, respectively (Fig. 6D and E). Collectively, these findings suggest that miR-221 suppressed the EMT in a model of BLM-induced pulmonary fibrosis.
Discussion
In the present study, we detected the downregulation of miR-221 in human IPF tissues and examined the effects of miR-221 on pulmonary fibrosis as well as the mechanisms responsible for these effects. Our results indicated that TGF-β1 reduced the expression of miR-221 and upregulated the expression of HMGA2 in A549 and HBE cells as well as upregulating the expression of EMT-related proteins. Additionally, the overexpression of miR-221 in cells impaired the EMT induced by TGF-β1, which is mediated by directly targeting HMGA2. miR-221 also impaired the EMT in a model of BLM-induced pulmonary fibrosis.
BLM is an antineoplastic agent that causes fibrosis as a prominent side effect. BLM-induced pulmonary fibrosis is the most commonly used model of IPF for studying disease pathogenesis and for testing novel pharmaceutical compounds (28).
BLM-induced lung injury is characterized by inflammation followed by apoptosis of epithelial and endothelial cells, mesenchymal cell proliferation and the deposition of extracellular matrix resulting in the destruction of the lung architecture and the progressive loss of pulmonary function (29). However, different strains of mice show different sensitivities to BLM. For example, BLM-sensitive mice injured with BLM showed significant increases in miR-155 expression compared with the BLM-resistant BALB/c strain (30). Using a single mouse strain may be a potential limitation of our study. Even so, the fact that many miRNAs and genes found in mice have molecular and functional homologues in vertebrates, including humans, means that genetic discoveries in animal models may be generalizable to our understanding of IPF and assist in the identification of potential therapies for this challenging disease (30).
miRNAs are reportedly associated with pulmonary fibrosis (20). Members of the miR-200 family and miR-205 are decreased when cells undergo EMT (17). miR-124 targets Slug to regulate EMT and to promote the metastasis of breast cancer (18). The increased expression of miR-155 has been demonstrated in a mouse model of lung fibrosis (19). Liu et al showed that mice with BLM-induced pulmonary fibrosis exhibited a significant increase in miR-21 levels, which was associated with increased TGF-β levels (20). Furthermore, the expression of members of the miR-29 family was decreased in the lungs of patients with IPF compared with that in normal individuals (21). miR-221 is also associated with organ fibrosis. It has been reported that miR-221 was downregulated in fibrotic kidneys after unilateral ureteral occlusion (31). The expression of miR-221/222 also increased with the progression of liver fibrosis, and significantly correlated with the mRNA expression of collagen I and α-SMA in human fibrotic livers (26). Notably, Lino Cardenas et al reported that miR-221 is downregulated in a model of BLM-induced pulmonary fibrosis by miRNA expression profiling (30). Furthermore, tissue microarray analysis of IPF tissues has also confirmed the downregulation of miR-221. In the present study, we focused on the effects of miR-221 on pulmonary fibrosis as well as the mechanisms responsible for these effects.
EMT is a process in which epithelial cells lose their epithelial phenotype, acquire fibroblast-like properties, and display reduced cell adhesion and increased motility. In our study, E-cadherin was used as an epithelial marker, and N-cadherin, vimentin and α-SMA were used as mesenchymal markers. They were all used to estimate the EMT condition, in combination with the analysis of collagen I/III deposition. miR-221 led to the upregulation of E-cadherin and the downregulation of N-cadherin, vimentin and α-SMA. In other words, miR-221 inhibited the EMT process in pulmonary fibrosis. This finding differs from some previous studies. Stinson et al demonstrated that adding miR-221/222 results in a decrease in E-cadherin and increase in vimentin that is consistent with an EMT in breast cancer (32). Liu et al reported that miR-221 facilitates the TGF-β1-induced EMT in human bladder cancer cells by targeting STMN1 (24). In addition, miR-221/222 has been found target adiponectin receptor 1 to promote the EMT in breast cancer (23). These findings may be due to the fact that miR-221 targets different downstream receptors to induce different effects on EMT.
HMGA2 is a transcription factor that is induced by the TGF-β1/Smad3 signaling pathway during the EMT process (3). It has been reported that miRNA let-7d (33), miR-33b (34), miR-15, miR-16, miR-26 and miR-196a-2 (35,36) all target HMGA to regulate EMT. In this study, for the first time to the best of our knowledge, we confirmed that HMGA2 is a direct target of miR-221. This finding is important as it enhances our understanding of the role of miR-221 in BLM-induced EMT and pulmonary fibrosis.
In conclusion, miR-221 inhibits the EMT process in BLM-induced pulmonary fibrosis through the TGF-β1/Smad3 signaling pathway, and HMGA2 is the direct target of miR-221. These findings may provide novel insights into the pathogenesis of IPF. In addition, as miRNAs have multiple targets, the therapeutic manipulation of miRNA may have multiplicative effects on gene expression and on the fibrotic phenotype in the lung, which warrants further investigation by our group.
References
Selman M, Pardo A and Kaminski N: Idiopathic pulmonary fibrosis: aberrant recapitulation of developmental programs? PLoS Med. 5:e622008. View Article : Google Scholar : PubMed/NCBI | |
Song X, Liu W, Xie S, Wang M, Cao G, Mao C and Lv C: All-transretinoic acid ameliorates bleomycin-induced lung fibrosis by downregulating the TGF-β1/Smad3 signaling pathway in rats. Lab Invest. 93:1219–1231. 2013. View Article : Google Scholar : PubMed/NCBI | |
Pandit KV, Corcoran D, Yousef H, Yarlagadda M, Tzouvelekis A, Gibson KF, Konishi K, Yousem SA, Singh M, Handley D, et al: Inhibition and role of let-7d in idiopathic pulmonary fibrosis. Am J Respir Crit Care Med. 182:220–229. 2010. View Article : Google Scholar : PubMed/NCBI | |
Kriz W, Kaissling B and Le Hir M: Epithelial-mesenchymal transition (EMT) in kidney fibrosis: fact or fantasy? J Clin Invest. 121:468–474. 2011. View Article : Google Scholar : PubMed/NCBI | |
Willis BC, Liebler JM, Luby-Phelps K, Nicholson AG, Crandall ED, du Bois RM and Borok Z: Induction of epithelial-mesenchymal transition in alveolar epithelial cells by transforming growth factor-beta1: potential role in idiopathic pulmonary fibrosis. Am J Pathol. 166:1321–1332. 2005. View Article : Google Scholar : PubMed/NCBI | |
Kalluri R and Weinberg RA: The basics of epithelial-mesenchymal transition. J Clin Invest. 119:1420–1428. 2009. View Article : Google Scholar : PubMed/NCBI | |
Hu WQ, Wang LW, Yuan JP, Yan SG, Li JD, Zhao HL, Peng CW, Yang GF and Li Y: High expression of transform growth factor beta 1 in gastric cancer confers worse outcome: results of a cohort study on 184 patients. Hepatogastroenterology. 61:245–250. 2014.PubMed/NCBI | |
Vincent T, Neve EP, Johnson JR, Kukalev A, Rojo F, Albanell J, Pietras K, Virtanen I, Philipson L, Leopold PL, et al: A SNAIL1-SMAD3/4 transcriptional repressor complex promotes TGF-beta mediated epithelial-mesenchymal transition. Nat Cell Biol. 11:943–950. 2009. View Article : Google Scholar : PubMed/NCBI | |
Sime PJ, Marr RA, Gauldie D, Xing Z, Hewlett BR, Graham FL and Gauldie J: Transfer of tumor necrosis factor-alpha to rat lung induces severe pulmonary inflammation and patchy interstitial fibrogenesis with induction of transforming growth factor-beta1 and myofibroblasts. Am J Pathol. 153:825–832. 1998. View Article : Google Scholar : PubMed/NCBI | |
Serini G and Gabbiani G: Mechanisms of myofibroblast activity and phenotypic modulation. Exp Cell Res. 250:273–283. 1999. View Article : Google Scholar : PubMed/NCBI | |
Schürch W, Seemayer TA and Gabbiani G: The myofibroblast: a quarter century after its discovery. Am J Surg Pathol. 22:141–147. 1998. View Article : Google Scholar : PubMed/NCBI | |
Munger JS, Huang X, Kawakatsu H, Griffiths MJ, Dalton SL, Wu J, Pittet JF, Kaminski N, Garat C, Matthay MA, et al: The integrin alpha v beta 6 binds and activates latent TGF beta 1: a mechanism for regulating pulmonary inflammation and fibrosis. Cell. 96:319–328. 1999. View Article : Google Scholar : PubMed/NCBI | |
D'Alessandro-Gabazza CN, Kobayashi T, Boveda-Ruiz D, Takagi T, Toda M, Gil-Bernabe P, Miyake Y, Yasukawa A, Matsuda Y, Suzuki N, et al: Development and preclinical efficacy of novel transforming growth factor-β1 short interfering RNAs for pulmonary fibrosis. Am J Respir Cell Mol Biol. 46:397–406. 2012. View Article : Google Scholar | |
Dong XS, Hu XB, Liu W, Sun YQ and Liu Z: Effects of RNA interference-induced Smad3 gene silencing on pulmonary fibrosis caused by paraquat in mice. Exp Biol Med (Maywood). 237:548–555. 2012. View Article : Google Scholar | |
Xiao J, Meng XM, Huang XR, Chung AC, Feng YL, Hui DS, Yu CM, Sung JJ and Lan HY: miR-29 inhibits bleomycin-induced pulmonary fibrosis in mice. Mol Ther. 20:1251–1260. 2012. View Article : Google Scholar : PubMed/NCBI | |
Roush S and Slack FJ: The let-7 family of microRNAs. Trends Cell Biol. 18:505–516. 2008. View Article : Google Scholar : PubMed/NCBI | |
Gregory PA, Bert AG, Paterson EL, Barry SC, Tsykin A, Farshid G, Vadas MA, Khew-Goodall Y and Goodall GJ: The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1. Nat Cell Biol. 10:593–601. 2008. View Article : Google Scholar : PubMed/NCBI | |
Liang YJ, Wang QY, Zhou CX, Yin QQ, He M, Yu XT, Cao DX, Chen GQ, He JR and Zhao Q: MiR-124 targets Slug to regulate epithelial-mesenchymal transition and metastasis of breast cancer. Carcinogenesis. 34:713–722. 2013. View Article : Google Scholar | |
Pottier N, Maurin T, Chevalier B, Puisségur MP, Lebrigand K, Robbe-Sermesant K, Bertero T, Lino Cardenas CL, Courcot E, Rios G, et al: Identification of keratinocyte growth factor as a target of microRNA-155 in lung fibroblasts: implication in epithelial-mesenchymal interactions. PLoS One. 4:e67182009. View Article : Google Scholar : PubMed/NCBI | |
Liu G, Friggeri A, Yang Y, Milosevic J, Ding Q, Thannickal VJ, Kaminski N and Abraham E: miR-21 mediates fibrogenic activation of pulmonary fibroblasts and lung fibrosis. J Exp Med. 207:1589–1597. 2010. View Article : Google Scholar : PubMed/NCBI | |
Cushing L, Kuang P and Lü J: The role of miR-29 in pulmonary fibrosis. Biochem Cell Biol. 93:109–118. 2015. View Article : Google Scholar | |
Su A, He S, Tian B, Hu W and Zhang Z: MicroRNA-221 mediates the effects of PDGF-BB on migration, proliferation, and the epithelial-mesenchymal transition in pancreatic cancer cells. PLoS One. 8:e713092013. View Article : Google Scholar : PubMed/NCBI | |
Hwang MS, Yu N, Stinson SY, Yue P, Newman RJ, Allan BB and Dornan D: miR-221/222 targets adiponectin receptor 1 to promote the epithelial-to-mesenchymal transition in breast cancer. PLoS One. 8:e665022013. View Article : Google Scholar : PubMed/NCBI | |
Liu J, Cao J and Zhao X: miR-221 facilitates the TGFbeta1-induced epithelial-mesenchymal transition in human bladder cancer cells by targeting STMN1. BMC Urol. 15:362015. View Article : Google Scholar : PubMed/NCBI | |
Glowacki F, Savary G, Gnemmi V, Buob D, Van der Hauwaert C, Lo-Guidice JM, Bouyé S, Hazzan M, Pottier N, Perrais M, et al: Increased circulating miR-21 levels are associated with kidney fibrosis. PLoS One. 8:e580142013. View Article : Google Scholar : PubMed/NCBI | |
Ogawa T, Enomoto M, Fujii H, Sekiya Y, Yoshizato K, Ikeda K and Kawada N: MicroRNA-221/222 upregulation indicates the activation of stellate cells and the progression of liver fibrosis. Gut. 61:1600–1609. 2012. View Article : Google Scholar : PubMed/NCBI | |
Hecker L, Vittal R, Jones T, Jagirdar R, Luckhardt TR, Horowitz JC, Pennathur S, Martinez FJ and Thannickal VJ: NADPH oxidase-4 mediates myofibroblast activation and fibrogenic responses to lung injury. Nat Med. 15:1077–1081. 2009. View Article : Google Scholar : PubMed/NCBI | |
Moeller A, Ask K, Warburton D, Gauldie J and Kolb M: The bleomycin animal model: a useful tool to investigate treatment options for idiopathic pulmonary fibrosis? Int J Biochem Cell Biol. 40:362–382. 2008. View Article : Google Scholar | |
Weiss DJ, Strandjord TP, Liggitt D and Clark JG: Perflubron enhances adenovirus-mediated gene expression in lungs of transgenic mice with chronic alveolar filling. Hum Gene Ther. 10:2287–2293. 1999. View Article : Google Scholar : PubMed/NCBI | |
Lino Cardenas CL, Kaminski N and Kass DJ: Micromanaging microRNAs: using murine models to study microRNAs in lung fibrosis. Drug Discov Today Dis Models. 10:e145–e151. 2013. View Article : Google Scholar | |
Di J, Jiang L, Zhou Y, Cao H, Fang L, Wen P, Li X, Dai C and Yang J: Ets-1 targeted by microrna-221 regulates angiotensin II-induced renal fibroblast activation and fibrosis. Cell Physiol Biochem. 34:1063–1074. 2014. View Article : Google Scholar : PubMed/NCBI | |
Stinson S, Lackner MR, Adai AT, Yu N, Kim HJ, O'Brien C, Spoerke J, Jhunjhunwala S, Boyd Z, Januario T, et al: miR-221/222 targeting of trichorhinophalangeal 1 (TRPS1) promotes epithelial-to-mesenchymal transition in breast cancer. Sci Signa. l4:pt52011. | |
Liu Q, Liu T, Zheng S, Gao X, Lu M, Sheyhidin I and Lu X: HMGA2 is down-regulated by microRNA let-7 and associated with epithelial-mesenchymal transition in oesophageal squamous cell carcinomas of Kazakhs. Histopathology. 65:408–417. 2014. View Article : Google Scholar : PubMed/NCBI | |
Zhang P, Bai H, Liu G, Wang H, Chen F, Zhang B, Zeng P, Wu C, Peng C, Huang C, et al: MicroRNA-33b, upregulated by EF24, a curcumin analog, suppresses the epithelial-to-mesenchymal transition (EMT) and migratory potential of melanoma cells by targeting HMGA2. Toxicol Lett. 234:151–161. 2015. View Article : Google Scholar : PubMed/NCBI | |
De Martino I, Visone R, Fedele M, Petrocca F, Palmieri D, Martinez Hoyos J, Forzati F, Croce CM and Fusco A: Regulation of microRNA expression by HMGA1 proteins. Oncogene. 28:1432–1442. 2009. View Article : Google Scholar : PubMed/NCBI | |
Kaddar T, Rouault JP, Chien WW, Chebel A, Gadoux M, Salles G, Ffrench M and Magaud JP: Two new miR-16 targets: caprin-1 and HMGA1, proteins implicated in cell proliferation. Biol Cell. 101:511–524. 2009. View Article : Google Scholar : PubMed/NCBI |