IL‑17 induces NSCLC A549 cell proliferation via the upregulation of HMGA1, resulting in an increased cyclin D1 expression

  • Authors:
    • Chenhui Zhao
    • Yongting Li
    • Weiming Zhang
    • Dan Zhao
    • Ling Ma
    • Pei Ma
    • Fengming Yang
    • Yingwei Wang
    • Yongqian Shu
    • Wen Qiu
  • View Affiliations

  • Published online on: March 7, 2018     https://doi.org/10.3892/ijo.2018.4307
  • Pages: 1579-1592
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Non-small cell lung cancer (NSCLC) is considered to be an inflammation-associated carcinoma. Although interleukin‑17 (IL‑17) production contributes to the proliferation and growth of NSCLC, the mechanisms underlying IL‑17-induced NSCLC cell proliferation have not been fully elucidated. In the present study, by using ELISA and immunohistochemical analyses, we first found that the expression levels of IL‑17, IL‑17 receptor (IL‑17R), high-mobility group A1 (HMGA1) and cyclin D1 were elevated in the samples of patients with NSCLC. Subsequently, by RT-qPCR, western blot analysis and cell proliferation assay in vitro, we revealed that stimulation with recombinant human IL‑17 (namely IL‑17A) markedly induced the expression of HMGA1 and cyclin D1 in the A549 cells (a human lung adenocarcinoma cell line) and promoted cell proliferation. Furthermore, luciferase reporter and ChIP assays confirmed that upregulated HMGA1 directly bound to the cyclin D1 gene promoter and activated its transcription. Notably, the response element of HMGA1 binding to the cyclin D1 promoter was disclosed for the first time, at least to the best of our knowledge. Taken together, our findings indicate that the IL‑17/HMGA1/cyclin D1 axis plays an important role in NSCLC cell proliferation and may provide new insight into NSCLC pathogenesis and may thus aid in the development of novel therapeutic targets for NSCLC.

Introduction

Lung cancer, in which non-small cell lung cancer (NSCLC) accounts for approximately 85% of cases, is the most lethal type of cancer worldwide (13). Studies have suggested that NSCLC is an inflammation-associated carcinoma (3,4); however, although the production of pro-inflammatory cytokines or mediators in the NSCLC microenvironment formed by tumor cells, endothelial cells and infiltrating inflammatory cells has been reported (57), the roles of these molecules in NSCLC proliferation and growth remain largely obscure.

Interleukin 17 (IL-17), also known as IL-17A, is a newly identified pro-inflammatory cytokine (8,9). A number of studies have demonstrated that IL-17 production can promote cell proliferation and can thus contribute to NSCLC growth and development (1013). However, the precise mechanisms underlying IL-17-induced NSCLC cell proliferation are extremely complex (14,15), and are not yet fully understood.

As is known, the expression of proliferation-related genes is associated with the activation of certain molecules in diverse signaling pathways, including various transcription factors (1417). High-mobility group A1 (HMGA1) is a transcription factor which plays a crucial role in regulation of gene expression and biological process (18,19). Emerging evidence has indicated the significant upregulation of HMGA1 expression in several malignant types of cancer, such as bladder cancer, thyroid cancer and NSCLC (2022), and the overexpression of HMGA1 has also been shown to positively correlate with the cell proliferation and malignant status of NSCLC (23,24). Reportedly, cyclin D1 is widely overexpressed in certain types of human cancer, and several growth factors, such as epidermal growth factor (EGF) markedly enhance cancer cell proliferation by increasing cyclin D1 expression (25,26). Moreover, transcription factors, such as nuclear factor (NF)-κB can directly bind to the cyclin D1 gene promoter and result in cyclin D1 gene transcription and cell proliferation (26); the activation of the p15/cyclin D1 pathway also greatly promotes NSCLC carcinogenesis (27).

The present study demonstrated that the production of IL-17 and the expression levels of IL-17R, HMGA1 and cyclin D1 were significantly elevated in samples of patients with NSCLC. Moreover, positive correlations were also found between the expression of IL-17R, HMGA1 and cyclin D1. Therefore, we wished to determine whether stimulation with IL-17 would enhance NSCLC cell proliferation and increase the expression of HMGA1 and cyclin D1 by binding to IL-17R, as well as whether HMGA1 triggers cyclin D1 gene transcription. In addition, we aimed to elucidate the mechanisms involved in IL-17-induced NSCLC cell proliferation. For this purpose, we performed a series of experiments in order to shed light into these matters.

Materials and methods

Human specimens

Plasma samples from patients with NSCLC (n=40) and healthy volunteers (n=40) were collected from the First Affiliated Hospital of Nanjing Medical University (Nanjing, China). Patients were eligible if they were diagnosed with NSCLC by biopsy and had not been treated with chemotherapy or radiotherapy prior to sample collection. Patients were excluded if they suffered from any other disease (trauma, infections, allergies, autoimmune diseases or other inflammatory diseases and cancers). Informed consent was obtained from all patients participating in this research prior to the experiment. This study was approved by the Ethics Committee of Nanjing Medical University and conformed to the guidelines outlined by the Declaration of Helsinki. Specifically, venous blood samples were collected into K3EDTA tubes (Greiner Bio-One; Frickenhausen, Germany) and were then fractionated by centrifugation (10 min, 3,000 × g). The plasma was aliquoted and stored at −80°C prior to analysis. NSCLC tissue arrays (n=60, paired) were provided by the National Engineering Center for BioChips (Shanghai, China).

Cell lines, reagents and antibodies

The human NSCLC cell lines, A549 (Cat. no. CCL-185), H1299 (Cat. no. CRL-5803) and H1975 (Cat. no. CRL-5908) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The human adenocarcinoma cell lines, PC9 and SPC-A1, were purchased from the European Collection of Authenticated Cell Cultures (ECACC, Cat. no. 90071810) and the Institute of Biochemistry and Cell Biology of the Chinese Academy of Science (Cat. no. TCHu53), respectively. The human bronchial epithelial cell line (16HBE) was supplied by Dr Gruenert (California Pacific Medical Center, San Francisco, CA, USA). Recombinant human IL-17 (IL-17A) and anti-rabbit (Cat. no. HAF008) or anti-mouse (Cat. no. HAF007) HRP-conjugated secondary antibodies were provided by R&D Systems (Minneapolis, MN, USA). The anti-IL-17 (Cat. no. ab9565), anti-IL-17R (Cat. no. ab180904), anti-HMGA1 (Cat. no. ab129153) and anti-cyclin D1 (Cat. no. ab134175) antibodies were supplied by Abcam (Cambridge, UK). The DAB substrate kit, BCA assay kit and Lipofectamine 2000 reagent were from Thermo Fisher Scientific (Waltham, MA, USA). The cell counting kit-8 (CCK-8) was supplied by Dojindo Laboratories (Kumamoto, Japan). Crystal violet was from Sigma-Aldrich (St. Louis, MO, USA). The reverse transcription reagent kit, 2X Taq Master Mix and qPCR SYBR-Green master mix were purchased from Vazyme Biotech (Nanjing, China). The X-tremeGENE HP DNA transfection reagent was from Roche Applied Science (Mannheim, Germany). The dual-luciferase reporter assay system kit was obtained from Promega (Madison, WI, USA). The chromatin immunoprecipitation (ChIP) kit was provided by Cell Signaling Technology (Danvers, MA, USA).

Detection by ELISA

The plasma IL-17 concentration was measured using an anti-IL-17A coated ELISA kit (BMS2017; Thermo Fisher Scientific). Briefly, standard, control and plasma samples were added to the IL-17A antibody coated wells. Meantime, a biotinylated IL-17A antibody was added, incubating for 2 h at room temperature. The streptavidin-HRP was then added to all washed wells and incubated for 1 h, followed by washing and TMB substrate incubation for approximately 10 min. Finally, the enzyme reaction was terminated by stop solution (provided with the kit) and the absorbance at 450 nm (OD 450) of each well was measured on a microplate reader (ELX 800, Biotek, Winooski, VT, USA) (28).

PCR and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA from the NSCLC tissues and cells was isolated using TRIzol reagent (Thermo Fisher Scientific) and the cDNA was generated using the reverse transcription reagent kit (Vazyme Biotech). The PCR assay was performed with a 50 µl volume reaction containing 25 µl 2X Taq master mix, 1 µl forward primer (10 µM), 1 µl reverse primer (10 µM) and 1 µl cDNA on an ABI 2720 thermal cycler with the condition of 94°C/5 min, 35 cycles of 94°C/30 sec, 55°C/30 sec and 72°C/30 sec, 72°C/7 min. The amplification products were then analyzed by agarose gel electrophoresis. The qPCR experiment was performed with a 20 µl volume reaction containing 10 µl 2X qPCR SYBR-Green master mix, 0.4 µl forward primer (10 µM), 0.4 µl reverse primer (10 µM), 1 µl cDNA and 0.4 µl 50X ROX reference dye 1 on an ABI 7300 system in triplicate under the following conditions: 95°C/5 min, 40 cycles of 95°C/5 sec and 60°C/30 sec. The primers used are shown in Table I. The results were normalized to β-actin expression and analyzed using the 2−ΔΔCq method (29,30).

Table I

Specific primers for qPCR and plasmids construction.

Table I

Specific primers for qPCR and plasmids construction.

NamePrimers (5′→3′)
HMGA1Forward GCTGGTAGGGAGTCAGAAGG
Reverse TTGGTTTCCTTCCTGGAGTT
Cyclin D1Forward GCCACTTGCATGTTCG
Reverse GGGCTCCTCAGGTTCA
β-actinForward CAGCCATGTACGTTGCTATCCAGG
Reverse AGGTCCAGACGCAGGATGGCATG
pIRES2-HMGA1ForwardCCGCTCGAGCACTCTTCCACCTGCTCCTTa
ReverseCCGGAATTCATGGGTCACTGCTCCTCCTb
Cyclin D1-FLForwardCGGGGTACCCTGGACGGCTCTTTACGCc
ReverseCTAGCTAGCTCTGCTGCTCGCTGCTACTd
Truncate 1ForwardCGGGGTACCATGCTCTGAGGCTTGGCTATc
ReverseCTAGCTAGCTCTGCTGCTCGCTGCTACTd
Truncate 2ForwardCGGGGTACCAAATTCTAAAGGTGAAGGGACGc
ReverseCTAGCTAGCTCTGCTGCTCGCTGCTACTd
Truncate 3ForwardCGGGGTACCCTCAGGGATGGCTTTTGGc
ReverseCTAGCTAGCTCTGCTGCTCGCTGCTACTd

a Underlined letters indicate the following restriction sites: XhoI;

b EcoRI;

c KpnI;

d NheI.

Immunohistochemical (IHC) staining

The slides from the NSCLC tissue array were incubated with the antibodies against IL-17R (dilution 1:100), HMGA1 (dilution 1:250) and cyclin D1 (dilution 1:250), followed by incubation with secondary antibodies (dilution 1:500). The reaction was visualized with a DAB HRP substrate kit. Finally, sections were viewed under a light microscope (Eclipse 90i; Nikon, Tokyo, Japan). The tissues subjected to IHC were scored according to the staining intensity and stained area, and 5 randomly selected fields were analyzed. The scoring of the staining intensity was as follows: negative, 0; weak, 1; moderate, 2; and strong, 3. The scoring of the stained area was as follows: 0%, 0; 1–25%, 1; 26–50%, 2; 51–75%, 3; and 76–100%, 4. These scores were multiplied to produce the final score: 0–1, negative expression; 2–4, weak positive expression; and 6–12, strong positive expression (31,32).

Plasmid construction

The HMGA1 expression plasmid was constructed by inserting the complete open reading frame (ORF) of the human HMGA1 gene (NM_145899.2) into the pIRES2-EGFP vector (Clontech/Takara Bio, Shiga, Japan). The specific primer sequences are shown in Table I. The pGpU6/GFP/Neo vector carrying small hairpin RNA targeting HMGA1 (shHMGA1) was provided by GenePharma (Shanghai, China). The shRNA-targeted sequences of HMGA1 gene were as follows: shHMGA1-1, 5′-CAACTCCAGGAAGGAAACCAA-3′; shHMGA1-2, 5′-CCTTGGCCTCCAAGCAGGAAA-3′; shHMGA1-3, 5′-GAAGGAGGAAGAGGAGGG CAT-3′; and scrambled shRNA control (shCTR), 5′-GTTCTCCGAACGTGTCACGT-3′. In addition, the reporter plasmids carrying cyclin D1 full-length (FL) and truncated promoter plasmids were constructed by inserting the corresponding fragments into the pGL3-basic vector (Promega). The detailed primers are listed in Table I.

Cell culture, stimulation and transfection

The cells were maintained in DMEM with 10% FBS in an incubator containing 5% CO2 at 37°C. For IL-17 stimulation, the cells were cultured overnight and starved for 24 h; IL-17 was then added into the medium at various concentrations (0, 0.5, 5, 50 and 500 ng/ml) for different periods of time (according to the needs of distinct experiments). For plasmid transient transfection, 3×105 cells were seeded per well in a 6-well plate. A mixture of 3 µg plasmid and 6 µl transfection reagent was then added followed by incubation for 48 h. The transfection efficiency was determined by GFP expression at 24 h following transfection. For IL-17R siRNA (siIL-17R) transfection, the cells were seeded in a 6-well plate and cultured overnight, and the mixture of 100 pmol siIL-17R and 5 µl Lipofectamine 2000 was then added followed by 24 h of incubation. The siIL-17R was supplied by GenePharma and the sequences were as follows: forward, 5′-CCUGCAGCUGAACACCAAUTT-3′ and reverse, 5′-AUUGGUGUUCAGCUGCAGGTT-3′.

Western blot analysis

The cells were lysed using RIPA buffer (Beyotime, Beijing China) and the total protein concentration was measured by BCA assay. The protein samples were loaded (50 µg per well) and electrophoresed on a 10% SDS-PAGE gel and transferred onto PVDF membranes (Pall Corp., Port Washington, NY, USA). The blots were then blocked with 5% non-fat milk for 1 h at room temperature, and probed with the IL-17R, HMGA1 or cyclin D1 antibody overnight at 4°C, followed by incubation with the rabbit IgG HRP-conjuncated (dilution 1:1,000) antibody for 30 min at room temperature, and then exposed using regular X-ray film. The dilution of anti-IL-17R, anti-HMGA1 and anti-cyclin D1 antibodies was 1:500, 1:10,000 and 1:1,000 respectively. The control antibody was β-actin antibody (Cat. no. AF0003; Beyotime Beijing, China) and the dilution was 1:1,000. Autoradiograms were quantified by densitometry (Quantity One software; Bio-Rad, Hercules, CA, USA).

Prediction of HMGA1 response elements

The HMGA1 response elements on cyclin D1 gene promoter were predicted by using the online software JASPAR (http://jaspar.genereg.net/). Briefly, the matrix model of HMGA1 binding element was found and selected, and the promoter sequence of Cyclin D1 gene was then input into the scan window, with the relative profile score threshold set at about 80%. After scanning, the putative sites were displayed.

Luciferase reporter assay

The afore-mentioned promoter reporters were transfected into the A549 cells with a pRL-SV40 vector (Promega), separately. A dual-luciferase reporter reagent was used to measure the promoter activity according to the manufacturer's instructions and as previously described (33).

Chromatin immunoprecipitation (ChIP) assay

ChIP assay was performed using ChIP-grade HMGA1 antibody and ChIP-grade protein G agarose beads in accordance with the manufacturer's instructions provided with the SimpleChIP Plus Enzymatic Chromatin IP kit and as previously described (34). A non-specific rabbit IgG was used as a negative control. PCR and RT-qPCR were performed to analyze the cyclin D1 promoter in the ChIP materials. The primers for the cyclin D1 promoter fragment in the ChIP assay were as follows: forward, 5′-CCCCATAAATCATCCAGGC-3′; and reverse, 5′-CCCGAGCACCCACAATC-3′.

Cell proliferation assay

Cell proliferation was measured by CCK-8 and colony formation assays. For CCK-8 assay, based on the manufacturer's instructions, the optical density (OD) values at 450 nm were documented using a microplate reader (Biotek). For colony formation assay, the cells were seeded in a 6-well plate at 500 cells/per well. Following culture for 10 days, the cells were fixed and stained with 0.1% crystal violet. Visible colonies were counted.

Statistical analysis

All data are presented as the means ± SE. Data analysis was carried out using GraphPad Prism 6.01 (GraphPad Software, San Diego, CA, USA). The significant difference between 2 groups was determined by a Student's t-test. Multi-group comparisons were carried out by one-way ANOVA with Dunnett's post hoc test. Using a Chi-square test, the association of the clinical parameters of the patients with NSCLC with the expression of proteins was analyzed. The correlation between the IHC scores was determined by computing Pearson's correlation coefficient. A P-value <0.05 was considered to indicate a statistically significant difference.

Results

Elevated plasma IL-17 levels, and tissue IL-17R, HMGA1 and cyclin D1 expression levels in patients with NSCLC

At the beginning of the present study, we examined the concentration of IL-17 in plasma and the expression levels of IL-17R, HMGA1 and cyclin D1 in the tumor tissues from patients with NSCLC. Using ELISA, we found that the plasma IL-17 levels were significantly increased in the 40 cases of NSCLC (the clinical characteristics of the patients are summarized in Table II) compared with the 40 healthy donors (Fig. 1A). Moreover, a marked upregulation in the expression of IL-17R, HMGA1 and cyclin D1 in the NSCLC tissues in comparison with the adjacent normal tissues was demonstrated by IHC staining in the NSCLC tissue microarrays (n=60, Fig. 1B and C). Furthermore, we also discovered that the expression of IL-17R, HMGA1 and cyclin D1 was associated with the tumor size, lymph node metastasis and TNM stage in these patients with NSCLC (Table III). Notably, positive correlations were also found between the expression of the above-mentioned 3 genes in the NSCLC tissues (Fig. 1D). These data thus suggest that the production of IL-17, IL-17R, HMGA1 and cyclin D1 may probably contribute to the development of NSCLC.

Table II

The characteristics of the patients with non-small cell lung cancer (NSCLC) detected by ELISA.

Table II

The characteristics of the patients with non-small cell lung cancer (NSCLC) detected by ELISA.

CharacteristicsNo. (%)
Total40
Sex
 Male25 (62.5)
 Female15 (37.5)
Age
 <607 (17.5)
 ≥6033 (82.5)
Tumor size
 <5 cm16 (40)
 ≥5 cm24 (60)
Lymph node metastasis
 Negative11 (27.5)
 Positive29 (72.5)
TNM stage
 I3 (7.5)
 II11 (27.5)
 III16 (40)
 IV10 (25)
Pathological type
 Squamous carcinoma15 (37.5)
 Adenocarcinoma17 (42.5)
 Large cell carcinoma2 (5)
 Bronchioloalveolar carcinoma6 (15)

Table III

Association between IL-17R/HMGA1/cyclin D1 expression with the clinicopathological characteristics of the patients with non-small cell lung cancer (NSCLC).

Table III

Association between IL-17R/HMGA1/cyclin D1 expression with the clinicopathological characteristics of the patients with non-small cell lung cancer (NSCLC).

CharacteristicTotalIL-17R expression
P-valueaHMGA1 expression
P-valueaCyclin D1 expression
P-valuea
Weak and negativeStrongWeak and negativeStrongWeak and negativeStrong
60243621392535
Sex
 Male4515300.067917280.434617280.2899
 Female159641187
Age (years)
 <602611150.749710160.62311150.9298
 ≥6034132111231420
Tumor size
 <5 cm352213<0.0001b19160.0002b431<0.0001b
 ≥5 cm25223223214
Lymph node metastasis
 Negative3018120.0016b16140.0029b19110.0007b
 Positive30624525624
TNM stage
 I19163<0.0001b1180.0374b3160.0002b
 II277206211017
 III14113410122
Pathological type
 Squamous carcinoma206140.37286140.08617130.2566
 Adenocarcinoma20911515119
 Large cell carcinoma10377355
 Bronchioloalveolar carcinoma10643728

a Chi-square test;

b P<0.05; HMGA1, high-mobility group A1.

IL-17 induces A549 cell proliferation and upregulates HMGA1 or cyclin D1 expression

Given that IL-17, IL-17R, HMGA1 and cyclin D1 expression levels were all elevated in the patients with NSCLC, and the expression of IL-17R positively correlated with HMGA1 or cyclin D1 expression, we assumed that IL-17, as an extracellular stimulus, may trigger NSCLC cell proliferation and upregulate HMGA1 and cyclin D1 by binding to IL-17R. Firstly, to determine the most susceptible NSCLC cell line to IL-17 stimulation, we assessed IL-17R expression in different NSCLC cell lines. The results revealed that IL-17R was markedly overexpressed in the PC9, A549 and SPC-A1 cells in comparison with the human bronchial epithelial 16HBE cells, particularly in the A549 cells (Fig. 2A). Subsequently, we selected the A549 cells and treated the cells with human recombinant IL-17 (i.e., IL-17A) and found that A549 cell proliferation (examined by CCK-8 assay and colony formation assay) was prominently upregulated by IL-17 stimulation in a dose-dependent manner, particularly when the IL-17 concentration reached 50 and 500 ng/ml (Fig. 2B–D). In addition, to ascertain whether IL-17 increases HMGA1 and cyclin D1 expression as well as the optimal time-point for the IL-17-induced production of HMGA1 and cyclin D1, we stimulated the A549 cells with IL-17 (50 ng/ml) for different periods of time and detected the transcription and expression of the afore-mentioned two genes by RT-qPCR and western blot analysis. The results revealed that the mRNA and protein expression levels of HMGA1 and cyclin D1 were significantly increased at 2 h (HMGA1) or 3 h (cyclin D1) and both peaked at 6 h (Fig. 2E–G). These results indicate that IL-17 not only induces A549 cell proliferation, but also increases the expression of HMGA1 and cyclin D1.

IL-17R knockdown or IL-17 neutralization suppresses IL-17- induced A549 cell proliferation, HMGA1 and cyclin D1 upregulation

To further confirm that IL-17 stimulation promotes A549 cell proliferation and increases the expression of HMGA1 or cyclin D1 by binding to IL-17R, we subjected the A549 cells to siIL-17R transfection or IL-17 antibody incubation, prior to treatment with IL-17 and then examined cell proliferation and the levels of the two above-mentioned proteins. The results of CCK-8 assay and colony formation assay revealed that the viability (OD value) and the colony numbers of A549 cells were greatly multiplied following treatment with IL-17; however, these effects were notably reversed by the silencing of IL-17R with siIL-17R or by the neutralization of IL-17 with anti-IL-17 antibody (Fig. 3A–C). Similarly, transfection with siIL-17 or incubation with anti-IL-17 also significantly decreased the IL-17-induced mRNA and protein expression of HMGA1 and cyclin D1 in the A549 cells (Fig. 3D–F). These results further denote that IL-17 effectively promotes the proliferation, and increases the expression of HMGA1 and cyclin D1 in A549 cells through its interaction with IL-17R.

HMGA1 contributes to IL-17-induced A549 cell proliferation and cyclin D1 production

It has been reported that HMGA1 is a transcription factor which can activate the transcription of downstream target genes and finally increase their expression (35,36). Since our experiments verified that HMGA1 and cyclin D1 expression levels were increased in the process of IL-17-induced A549 cell proliferation, and the expression phase of HMGA1 was earlier than that of cyclin D1, we hypothesized that HMGA1 itself may enhance cyclin D1 transcription and expression, leading to an increment in cell proliferation, and that the absence of HMGA1 may impede the afore-mentioned phenomena mediated by IL-17. To confirm our hypothesis, we first constructed the HMGA1 overexpression plasmid (pIRES2-HMGA1) and the plasmid carrying small hairpin RNA targeting HMGA1 (shHMGA1) and examined the transfection efficiency of these plasmids (Fig. 4A–C). Subsequently, CCK-8 and colony formation assays were performed. As was expected, A549 cell proliferation was markedly elevated following HMGA1 overexpression, whereas the knockdown of HMGA1 markedly suppressed cell proliferation upon IL-17 stimulation (Fig. 4D–F). In addition, the mRNA and protein levels of cyclin D1 were eminently upregulated or downregulated when HMGA1 was overexpressed or silenced with IL-17 treatment, respectively (Fig. 4G–I), indicating that IL-17-induced HMGA1 expression exerts a promoting effect on the proliferation of and cyclin D1 expression in A549 cells mediated by IL-17.

IL-17 activates the cyclin D1 gene promoter through HMGA1 binding to its response element on the promoter

As mentioned earlier, IL-17 stimulation increased cyclin D1 expression via the transcription factor, HMGA1; hence, we wished to determine whether IL-17 activates the cyclin D1 gene promoter through HMGA1. For this purpose, we carried out luciferase reporter assay, and found that IL-17 markedly increased cyclin D1 promoter activity at 3 h (peaked at 6 h) after the A549 cells were stimulated (Fig. 5A). In addition, the overexpression of HMGA1 markedly activated the full length of the cyclin D1 promoter (cyclin D1-FL, −2,099 to +86 nt), whereas the activity of cyclin D1-FL markedly decreased in accordance with HMGA1 knockdown (Fig. 5B). Subsequently, to locate the region in which HMGA1 binds to on the cyclin D1 promoter, we first predicted three potential HMGA1 response elements (−1,700 to −1,691 nt, −1,026 to −1,017 nt, and −139 to −130 nt) using the online software JASPAR (http://jaspar.genereg.net/), and then constructed three truncated promoter reporters based on the prediction (Fig. 5C), which were truncate 1 (T1, −1,672 to +86 nt), truncate 2 (T2, −1,026 to +86 nt) and truncate 3 (T3, −139 to +86 nt). By luciferase assay, we confirmed that in the A549 cells treated with IL-17 or transfected with the HMGA1 overexpression plasmid, the activity of all cyclin D1 truncated promoters was markedly decreased compared to that of the cyclin D1-FL. However, no statistically significant differences were observed between the luciferase activity in these three truncated reporters (Fig. 5D and E), suggesting that the most effective HMGA1 binding element may be located in the region of −2,099 to −1,673 nt on the cyclin D1 promoter (probably −1,700 to −1,691 nt). Finally, to determine the exact binding of HMGA1 to the above-mentioned element, a ChIP assay was performed using antibody against HMGA1, and the region −1,752 to −1,622 nt (containing −1,700 to −1,691 nt) was then amplified by RT-qPCR. The results revealed that the binding of HMGA1 to the indicated fragment of the cyclin D1 promoter was prominently increased both in the A549 cells subjected to IL-17 stimulation or in those transfected with the HMGA1 overexpression vector; however, this binding was diminished when HMGA1 was silenced (Fig. 5F and G). These findings imply that IL-17 enhances cyclin D1 promoter activity via HMGA1, directly binding to its response element in the region −1,752 to −1,622 nt, which eventually results in an increased cyclin D1 expression and A549 cell proliferation.

Figure 5

Identification of cyclin D1 promoter activity in A549 cells upon IL-17 stimulation and the HMGA1 binding element on the cyclin D1 promoter. (A) A549 cells were transfected with the full-length promoter of cyclin D1 (cyclin D1-FL, −2,099 to +86 nt), followed by stimulation with IL-17 at 50 ng/ml for 3 or 6 h. Luciferase reporter assay was performed to examine the activity of the cyclin D1 promoter in A549 cells at different time-points. *P<0.05 and **P<0.01 vs. 0 h. (B) Cyclin D1-FL was co-transfected with pIRES2-HMGA1 or with shHMGA1 into A549 cells, followed by IL-17 stimulation. The activity of the cyclin D1-FL promoter was assessed by reporter assay. **P<0.01 vs. DMEM, ΔΔP<0.01 vs. pIRES2-EGFP, ##P<0.01 vs. shCTR + IL-17 group. (C) Schematic representation of the cyclin D1 promoter and the predicted HMGA1 response elements on it. The reporter plasmids carrying truncated promoter regions were constructed as indicated. (D and E) Using luciferase assay, the activity of cyclin D1-FL and three truncated promoters (cyclin D1-T1, cyclin D1-T2 and cyclin D1-T3) was measured either in the presence of (D) IL-17 stimulation or (E) HMGA1 overexpression. **P<0.01 vs. pGL3-cyclin D1-FL. (F and G) A549 cells were transfected with pIRES2-HMGA1 or with shHMGA1 followed by exposure to IL-17. Anti-HMGA1 was used to perform ChIP assay. (F) PCR and (G) RT-qPCR were then applied to quantify the binding of HMGA1 to the indicated region of the cyclin D1 promoter. **P<0.01 vs. DMEM, ΔΔP<0.01 vs. pIRES2-EGFP, ##P<0.01 vs. shCTR + IL-17 group. All data are shown as the means ± SE from 3 independent experiments. HMGA1, high-mobility group A1.

Disscussion

NSCLC is one of the most common types of malignancy worldwide (1,2). Accumulating evidence suggests that NSCLC is a typical inflammation-associated cancer (3,4,37,38), and IL-17 as a pro-inflammatory cytokine, has been reported to be closely associated with NSCLC cell proliferation and development (7,39); however, the mechanisms underlying IL-17-induced NSCLC cell proliferation have not yet been fully elucidated.

It has been well documented that cell proliferation is associated with extracellular stimuli and proliferative molecule expression (7,40,41). IL-17A (namely IL-17), as a stimulus, is mainly secreted by activated T cells, mononuclear cells, dendritic cells (DCs) and other cells, including tumor cells (5,6). Recent studies have revealed that IL-17 overproduction contributes to the inflammatory microenvironment for NSCLC cell proliferation and growth (5,11). Moreover, HMGA1 as a transcription factor and cyclin D1 as a proliferative protein can also promote cancer cell proliferation (4043). Hence, in this study, in order to better understand the pathogenesis of IL-17-induced NSCLC cell proliferation, we first detected the level of IL-17 in plasma, and the expression of IL-17R, HMGA1 as well as that of cyclin D1 in the tumor tissues of patients with NSCLC. Our results revealed the markedly elevated production of IL-17, IL-17R, HMGA1 and cyclin D1, and positive correlations between IL-17R, HMGA1 and cyclin D1 expression. Besides, we also confirmed the positive correlation between IL-17R, HMGA1 and cyclin D1 expression with tumor size, lymph node metastasis and the TNM stage of patients with NSCLC. These results indicate that the overexpression of these molecules mentioned above, not only exists in patients with NSCLC, but may also be related to NSCLC growth.

As is known, IL-17 plays a crucial role in controlling inflammation (8) and promoting tumor cell proliferation such as colitis-associated cancer (44) and NSCLC (39). Moreover, IL-17, as an extracellular stimulus, can activate several cell signaling pathways, such as p38/c-Fos and JNK/c-Jun (45), and HMGA1 has been reported to be a direct transcriptional target of c-Jun (46), indicating that IL-17 may promote the transcription of the HMGA1 gene. However, whether HMGA1 and cyclin D1 expression is upregulated in NSCLC cells upon IL-17 stimulation remains elusive. Our in vitro experiments demonstrated an enhanced proliferation of, as well as an increased HMGA1 and cyclin D1 expression in A549 cells exposed to IL-17. Additionally, IL-17R knockdown with siIL-17R or the neutralizing of IL-17 with anti-IL-17 antibody significantly decreased the proliferation and HMGA1 or cyclin D1 expression in the A549 cells. These data thus suggest that IL-17 markedly induces A549 cell proliferation through HMGA1 and cyclin D1 production.

Reportedly, HMGA1 protein acts within the nucleus of mammalian cells as an architectural transcription factor (40,42); however, the cytoplasmic/mitochondrial localization of HMGA1 protein in multiple cell types has also been found (35), suggesting that HMGA1 may undergo nucleocytoplasmic translocation during some biological processes. Moreover, HMGA1 can modulate gene expression by altering the chromatin structure and orchestrating the assembly of transcription factor complexes to augment target gene promoter activity (42). Furthermore, HMGA1 markedly facilitates the proliferation of several types of cancer cells, such as pancreatic cancer (36), breast cancer (47), ovarian cancer (48), colon cancer (49) and thyroid cancer (21). Additionally, cyclin D1 also regulates cyclin-dependent kinase (CDK)4 and CDK6 to promote cell cycle transition from the G1 to the S phase (5052). However, even though it has already been mentioned in the literature that during the process of pancreatic cancer cell proliferation, HMGA1 regulates the transcription of the cyclin D1 gene, which promotes cell cycle G1/S transition through CDK4 and CDK6 (36), the effects of HMGA1 on cyclin D1 gene transcription, expression and cell proliferation in NSCLC and the specific mechanisms involved have not yet been fully determined. In this study, the IL-17-induced expression phase of HMGA1 was slightly earlier than that of cyclin D1; we thus speculated that the upregulation of HMGA1 induced by IL-17 may have effect on cyclin D1 expression and the proliferation of A549 cells. By the overexpression or knockdown of HMGA1 in the presence of IL-17 stimulation, we found that the proliferation of and cyclin D1 expression in A549 cells were positively associated with HMGA1 expression, and so was the cyclin D1 promoter activity, suggesting that HMGA1 expression can trigger cyclin D1 gene transcription. Further experiments affirmed that HMGA1 can directly bind to the promoter of the cyclin D1 gene, and the site of HMGA1 binding to the cyclin D1 promoter within the region of −1,752 to −1,622 nt was uncovered for the first time, at least to the best of our knowledge. Collectively, these results suggest that IL-17-induced A549 cell proliferation is linked with HMGA1 boosting cyclin D1 gene transcription and expression, indicating that the activation of the HMGA1/cyclin D1 axis is indispensable in the mechanisms of NSCLC A549 cell proliferation upon IL-17 stimulation.

In conclusion, the present study verified that the expression level of IL-17, IL-17R, HMGA1 and cyclin D1 was significantly increased in samples from patients with NSCLC. Moreover, IL-17R, HMGA1 and cyclin D1 were positively associated with the malignancy grade of NSCLC. Besides, we revealed that IL-17 stimulation prominently upregulated the expression of HMGA1 and cyclin D1 in the A549 cells, and induced cell proliferation in vitro. Furthermore, elevated HMGA1 expression directly binds to its response element on the cyclin D1 gene promoter, resulting in cyclin D1 gene transcription and expression, and finally promoting A549 cell proliferation (Fig. 6). Overall, our data suggest that the IL-17/HMGA1/cyclin D1 axis promotes NSCLC cell proliferation, and may provide new insight into the pathogenesis of NSCLC.

Acknowledgments

The authors would like to thank Miss Samjhana Pandey for modifying the language.

Notes

[1] Funding

This study was supported by grants from the National Natural Science Foundations of China (nos. 81272532, 81472626 and 81672896).

[2] Availability of data and materials

The analyzed datasets generated during the study are available from the corresponding author on reasonable request.

[3] Authors' contributions

YS and WQ designed the study and CZ wrote the manuscript. CZ and YL carried out experiments. WZ collected and provided the samples of NSCLC patients. DZ, PM, LM and FY participated in the experiments and analyzed the data. YS and YW supervised the study. All authors have read and approved the final manuscript.

[4] Ethics approval and consent to participate

This study was approved by the Ethics Committee of Nanjing Medical University and conformed to the guidelines outlined by the Declaration of Helsinki. Informed consent was obtained from all patients participating in this research prior to the experiment.

[5] Consent for publication

Not applicable.

[6] Competing interests

The authors declare that they have no competing interests.

References

1 

Oh IJ and Ahn SJ: Multidisciplinary team approach for the management of patients with locally advanced non-small cell lung cancer: Searching the evidence to guide the decision. Radiat Oncol J. 35:16–24. 2017. View Article : Google Scholar : PubMed/NCBI

2 

McGranahan T and Nagpal S: A Neuro-oncologist's perspective on management of brain metastases in patients with EGFR mutant non-small cell lung cancer. Curr Treat Options Oncol. 18:222017. View Article : Google Scholar : PubMed/NCBI

3 

Zhu HX, Shi L, Zhang Y, Zhu YC, Bai CX, Wang XD and Zhou JB: Myocyte enhancer factor 2D provides a cross-talk between chronic inflammation and lung cancer. J Transl Med. 15:652017. View Article : Google Scholar : PubMed/NCBI

4 

Wu F, Xu J, Huang Q, Han J, Duan L, Fan J, Lv Z, Guo M, Hu G, Chen L, et al: The role of interleukin-17 in lung cancer. Mediators Inflamm. 2016:84940792016. View Article : Google Scholar : PubMed/NCBI

5 

Kwiecien I, Stelmaszczyk-Emmel A, Polubiec-Kownacka M, Dziedzic D and Domagala-Kulawik J: Elevated regulatory T cells, surface and intracellular CTLA-4 expression and interleukin-17 in the lung cancer microenvironment in humans. Cancer Immunol Immunother. 66:161–170. 2017. View Article : Google Scholar :

6 

Chang SH, Mirabolfathinejad SG, Katta H, Cumpian AM, Gong L, Caetano MS, Moghaddam SJ and Dong C: T helper 17 cells play a critical pathogenic role in lung cancer. Proc Natl Acad Sci USA. 111:5664–5669. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Wei L, Wang H, Yang F, Ding Q and Zhao J: Interleukin-17 potently increases non-small cell lung cancer growth. Mol Med Rep. 13:1673–1680. 2016. View Article : Google Scholar

8 

Kuwabara T, Ishikawa F, Kondo M and Kakiuchi T: The role of IL-17 and related cytokines in inflammatory autoimmune diseases. Mediators Inflamm. 2017:39080612017. View Article : Google Scholar : PubMed/NCBI

9 

Huang Q, Du J, Fan J, Lv Z, Qian X, Zhang X, Han J, Chen C, Wu F and Jin Y: The effect of proinflammatory cytokines on IL-17RA expression in NSCLC. Med Oncol. 31:1442014. View Article : Google Scholar : PubMed/NCBI

10 

Cheng S, Shao Z, Liu X, Guo L, Zhang X, Na Q, Chen X, Ma Y, Zheng J, Song B, et al: Interleukin 17A polymorphism elevates gene expression and is associated with increased risk of nonsmall cell lung cancer. DNA Cell Biol. 34:63–68. 2015. View Article : Google Scholar

11 

Cao Y, Zhao D, Li P, Wang L, Qiao B, Qin X, Li L and Wang Y: MicroRNA-181a-5p impedes IL-17-induced nonsmall cell lung cancer proliferation and migration through targeting VCAM-1. Cell Physiol Biochem. 42:346–356. 2017. View Article : Google Scholar : PubMed/NCBI

12 

Li Q, Han Y, Fei G, Guo Z, Ren T and Liu Z: IL-17 promoted metastasis of non-small-cell lung cancer cells. Immunol Lett. 148:144–150. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Kirshberg S, Izhar U, Amir G, Demma J, Vernea F, Beider K, Shlomai Z, Wald H, Zamir G, Shapira OM, et al: Involvement of CCR6/CCL20/IL-17 axis in NSCLC disease progression. PLoS One. 6:e248562011. View Article : Google Scholar : PubMed/NCBI

14 

Pan B, Shen J, Cao J, Zhou Y, Shang L, Jin S, Cao S, Che D, Liu F and Yu Y: Interleukin-17 promotes angiogenesis by stimulating VEGF production of cancer cells via the STAT3/GIV signaling pathway in non-small-cell lung cancer. Sci Rep. 5:160532015. View Article : Google Scholar : PubMed/NCBI

15 

Wu L, Chen X, Zhao J, Martin B, Zepp JA, Ko JS, Gu C, Cai G, Ouyang W, Sen G, et al: A novel IL-17 signaling pathway controlling keratinocyte proliferation and tumorigenesis via the TRAF4-ERK5 axis. J Exp Med. 212:1571–1587. 2015. View Article : Google Scholar : PubMed/NCBI

16 

Qiu W, Zhang Y, Liu X, Zhou J, Li Y, Zhou Y, Shan K, Xia M, Che N, Feng X, et al: Sublytic C5b-9 complexes induce proliferative changes of glomerular mesangial cells in rat Thy-1 nephritis through TRAF6-mediated PI3K-dependent Akt1 activation. J Pathol. 226:619–632. 2012. View Article : Google Scholar

17 

Gu K, Li MM, Shen J, Liu F, Cao JY, Jin S and Yu Y: Interleukin-17-induced EMT promotes lung cancer cell migration and invasion via NF-κB/ZEB1 signal pathway. Am J Cancer Res. 5:1169–1179. 2015.

18 

Sumter TF, Xian L, Huso T, Koo M, Chang YT, Almasri TN, Chia L, Inglis C, Reid D and Resar LM: The high mobility group A1 (HMGA1) transcriptome in cancer and development. Curr Mol Med. 16:353–393. 2016. View Article : Google Scholar : PubMed/NCBI

19 

Esposito F, De Martino M, D'Angelo D, Mussnich P, Raverot G, Jaffrain-Rea ML, Fraggetta F, Trouillas J and Fusco A: HMGA1-pseudogene expression is induced in human pituitary tumors. Cell Cycle. 14:1471–1475. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Lin Y, Chen H, Hu Z, Mao Y, Xu X, Zhu Y, Xu X, Wu J, Li S, Mao Q, et al: miR-26a inhibits proliferation and motility in bladder cancer by targeting HMGA1. FEBS Lett. 587:2467–2473. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Zhong J, Liu C, Zhang QH, Chen L, Shen YY, Chen YJ, Zeng X, Zu XY and Cao RX: TGF-β1 induces HMGA1 expression: The role of HMGA1 in thyroid cancer proliferation and invasion. Int J Oncol. 50:1567–1578. 2017. View Article : Google Scholar : PubMed/NCBI

22 

Sekimoto N, Suzuki A, Suzuki Y and Sugano S: Expression of miR-26a exhibits a negative correlation with HMGA1 and regulates cancer progression by targeting HMGA1 in lung adenocarcinoma cells. Mol Med Rep. 15:534–542. 2017. View Article : Google Scholar :

23 

Sarhadi VK, Wikman H, Salmenkivi K, Kuosma E, Sioris T, Salo J, Karjalainen A, Knuutila S and Anttila S: Increased expression of high mobility group A proteins in lung cancer. J Pathol. 209:206–212. 2006. View Article : Google Scholar : PubMed/NCBI

24 

Zhang Z, Wang Q, Chen F and Liu J: Elevated expression of HMGA1 correlates with the malignant status and prognosis of non-small cell lung cancer. Tumour Biol. 36:1213–1219. 2015. View Article : Google Scholar

25 

Musgrove EA, Caldon CE, Barraclough J, Stone A and Sutherland RL: Cyclin D as a therapeutic target in cancer. Nat Rev Cancer. 11:558–572. 2011. View Article : Google Scholar : PubMed/NCBI

26 

Qie S and Diehl JA: Cyclin D1, cancer progression, and opportunities in cancer treatment. J Mol Med (Berl). 94:1313–1326. 2016. View Article : Google Scholar

27 

Tian XP, Jin XH, Li M, Huang WJ, Xie D and Zhang JX: The depletion of PinX1 involved in the tumorigenesis of non-small cell lung cancer promotes cell proliferation via p15/cyclin D1 pathway. Mol Cancer. 16:742017. View Article : Google Scholar : PubMed/NCBI

28 

Shan K, Pang R, Zhao C, Liu X, Gao W, Zhang J, Zhao D, Wang Y and Qiu W: IL-17-triggered downregulation of miR-497 results in high HIF-1α expression and consequent IL-1β and IL-6 production by astrocytes in EAE mice. Cell Mol Immunol. 14:1–15. 2017.

29 

Qiu W, Zhou J, Zhu G, Zhao D, He F, Zhang J, Lu Y, Yu T, Liu L and Wang Y: Sublytic C5b-9 triggers glomerular mesangial cell apoptosis via XAF1 gene activation mediated by p300-dependent IRF-1 acetylation. Cell Death Dis. 5:e11762014. View Article : Google Scholar : PubMed/NCBI

30 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−Δ Δ C(T)) Method. Methods. 25:402–408. 2001. View Article : Google Scholar

31 

Al-Azhri J, Zhang Y, Bshara W, Zirpoli G, McCann SE, Khoury T, Morrison CD, Edge SB, Ambrosone CB and Yao S: Tumor expression of Vitamin D receptor and breast cancer histopathological characteristics and prognosis. Clin Cancer Res. 23:97–103. 2017. View Article : Google Scholar :

32 

Surowiak P, Materna V, Györffy B, Matkowski R, Wojnar A, Maciejczyk A, Paluchowski P, Dziegiel P, Pudełko M, Kornafel J, et al: Multivariate analysis of oestrogen receptor alpha, pS2, metallothionein and CD24 expression in invasive breast cancers. Br J Cancer. 95:339–346. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Zhang J, Li Y, Shan K, Wang L, Qiu W, Lu Y, Zhao D, Zhu G, He F and Wang Y: Sublytic C5b-9 induces IL-6 and TGF-β1 production by glomerular mesangial cells in rat Thy-1 nephritis through p300-mediated C/EBPβ acetylation. FASEB J. 28:1511–1525. 2014. View Article : Google Scholar

34 

He F, Zhou M, Yu T, Zhao D, Zhang J, Qiu W, Lu Y, Liu Y, Wang L and Wang Y: Sublytic C5b-9 triggers glomerular mesangial cell apoptosis in rat Thy-1 nephritis via Gadd45 activation mediated by Egr-1 and p300-dependent ATF3 acetylation. J Mol Cell Biol. 8:477–491. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Dement GA, Treff NR, Magnuson NS, Franceschi V and Reeves R: Dynamic mitochondrial localization of nuclear transcription factor HMGA1. Exp Cell Res. 307:388–401. 2005. View Article : Google Scholar : PubMed/NCBI

36 

Kolb S, Fritsch R, Saur D, Reichert M, Schmid RM and Schneider G: HMGA1 controls transcription of insulin receptor to regulate cyclin D1 translation in pancreatic cancer cells. Cancer Res. 67:4679–4686. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Vendramini-Costa DB and Carvalho JE: Molecular link mechanisms between inflammation and cancer. Curr Pharm Des. 18:3831–3852. 2012. View Article : Google Scholar : PubMed/NCBI

38 

Lee JJ, Kim HJ, Yang CS, Kyeong HH, Choi JM, Hwang DE, Yuk JM, Park K, Kim YJ, Lee SG, et al: A high-affinity protein binder that blocks the IL-6/STAT3 signaling pathway effectively suppresses non-small cell lung cancer. Mol Ther. 22:1254–1265. 2014. View Article : Google Scholar : PubMed/NCBI

39 

Pan B, Che D, Cao J, Shen J, Jin S, Zhou Y, Liu F, Gu K, Man Y, Shang L, et al: Interleukin-17 levels correlate with poor prognosis and vascular endothelial growth factor concentration in the serum of patients with non-small cell lung cancer. Biomarkers. 20:232–239. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Quintavalle C, Burmeister K, Piscuoglio S, Quagliata L, Karamitopoulou E, Sepe R, Fusco A, Terracciano LM, Andersen JB, Pallante P, et al: High mobility group A1 enhances tumorigenicity of human cholangiocarcinoma and confers resistance to therapy. Mol Carcinog. 56:2146–2157. 2017. View Article : Google Scholar : PubMed/NCBI

41 

Ahlin C, Lundgren C, Embretsén-Varro E, Jirström K, Blomqvist C and Fjällskog M: High expression of cyclin D1 is associated to high proliferation rate and increased risk of mortality in women with ER-positive but not in ER-negative breast cancers. Breast Cancer Res Treat. 164:667–678. 2017. View Article : Google Scholar : PubMed/NCBI

42 

Huso TH and Resar LM: The high mobility group A1 molecular switch: Turning on cancer - can we turn it off? Expert Opin Ther Targets. 18:541–553. 2014. View Article : Google Scholar

43 

Li Z, Qu L, Luo W, Tian Y, Zhai H, Xu K and Zhong H: Mig-6 is down-regulated in HCC and inhibits the proliferation of HCC cells via the P-ERK/Cyclin D1 pathway. Exp Mol Pathol. 102:492–499. 2017. View Article : Google Scholar : PubMed/NCBI

44 

Hyun YS, Han DS, Lee AR, Eun CS, Youn J and Kim HY: Role of IL-17A in the development of colitis-associated cancer. Carcinogenesis. 33:931–936. 2012. View Article : Google Scholar : PubMed/NCBI

45 

Fabre T, Kared H, Friedman SL and Shoukry NH: IL-17A enhances the expression of profibrotic genes through upregulation of the TGF-β receptor on hepatic stellate cells in a JNK-dependent manner. J Immunol. 193:3925–3933. 2014. View Article : Google Scholar : PubMed/NCBI

46 

Hommura F, Katabami M, Leaner VD, Donninger H, Sumter TF, Resar LM and Birrer MJ: HMG-I/Y is a c-Jun/activator protein-1 target gene and is necessary for c-Jun-induced anchorage-independent growth in Rat1a cells. Mol Cancer Res. 2:305–314. 2004.PubMed/NCBI

47 

Zhou WB, Zhong CN, Luo XP, Zhang YY, Zhang GY, Zhou DX and Liu LP: miR-625 suppresses cell proliferation and migration by targeting HMGA1 in breast cancer. Biochem Biophys Res Commun. 470:838–844. 2016. View Article : Google Scholar : PubMed/NCBI

48 

Liu Y, Wang Y, Zhang Y, Fu J and Zhang G: Knockdown of HMGA1 expression by short/small hairpin RNA inhibits growth of ovarian carcinoma cells. Biotechnol Appl Biochem. 59:1–5. 2012. View Article : Google Scholar : PubMed/NCBI

49 

Yang Q, Wang X, Tang C, Chen X and He J: H19 promotes the migration and invasion of colon cancer by sponging miR-138 to upregulate the expression of HMGA1. Int J Oncol. 50:1801–1809. 2017. View Article : Google Scholar : PubMed/NCBI

50 

Żuryń A, Litwiniec A, Safiejko-Mroczka B, Klimaszewska-Wiśniewska A, Gagat M, Krajewski A, Gackowska L and Grzanka D: The effect of sulforaphane on the cell cycle, apoptosis and expression of cyclin D1 and p21 in the A549 non-small cell lung cancer cell line. Int J Oncol. 48:2521–2533. 2016. View Article : Google Scholar : PubMed/NCBI

51 

Otto T and Sicinski P: Cell cycle proteins as promising targets in cancer therapy. Nat Rev Cancer. 17:93–115. 2017. View Article : Google Scholar : PubMed/NCBI

52 

Chikara S, Lindsey K, Dhillon H, Mamidi S, Kittilson J, Christofidou-Solomidou M and Reindl KM: Enterolactone induces G1-phase cell cycle arrest in nonsmall cell lung cancer cells by downregulating cyclins and cyclin-dependent kinases. Nutr Cancer. 69:652–662. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2018
Volume 52 Issue 5

Print ISSN: 1019-6439
Online ISSN:1791-2423

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhao C, Li Y, Zhang W, Zhao D, Ma L, Ma P, Yang F, Wang Y, Shu Y, Qiu W, Qiu W, et al: IL‑17 induces NSCLC A549 cell proliferation via the upregulation of HMGA1, resulting in an increased cyclin D1 expression. Int J Oncol 52: 1579-1592, 2018.
APA
Zhao, C., Li, Y., Zhang, W., Zhao, D., Ma, L., Ma, P. ... Qiu, W. (2018). IL‑17 induces NSCLC A549 cell proliferation via the upregulation of HMGA1, resulting in an increased cyclin D1 expression. International Journal of Oncology, 52, 1579-1592. https://doi.org/10.3892/ijo.2018.4307
MLA
Zhao, C., Li, Y., Zhang, W., Zhao, D., Ma, L., Ma, P., Yang, F., Wang, Y., Shu, Y., Qiu, W."IL‑17 induces NSCLC A549 cell proliferation via the upregulation of HMGA1, resulting in an increased cyclin D1 expression". International Journal of Oncology 52.5 (2018): 1579-1592.
Chicago
Zhao, C., Li, Y., Zhang, W., Zhao, D., Ma, L., Ma, P., Yang, F., Wang, Y., Shu, Y., Qiu, W."IL‑17 induces NSCLC A549 cell proliferation via the upregulation of HMGA1, resulting in an increased cyclin D1 expression". International Journal of Oncology 52, no. 5 (2018): 1579-1592. https://doi.org/10.3892/ijo.2018.4307