This article is mentioned in:

Introduction

Nemaline myopathy (NM) is a genetically and clinically heterogeneous form of myopathy, which has an incidence rate of ~1/50,000 live births worldwide (1). In China, <50 cases, as determined by clinical analyses and pathohistological examinations, have been reported in the literature since the first case in 1990 (2–6). In a previous study, in 4,127 patients with suspected myopathy who received muscle biopsies, the occurrence of NM was only ~0.29% (28 cases) (2), thus suggesting that NM is a rare disorder in Chinese populations. To date, at least eight genes, including nebulin (NEB), skeletal muscle α-actin 1 (ACTA1), cofilin-2, troponin T1, β-tropomyosin, slow-muscle α-tropomyosin, kelch repeat and BTB domain-containing 13 and kelch-like family member 40, have been reported to cause NM (7). The majority of these genes encode sarcomeric thin filament proteins. Among these causal genes, ~50% of the autosomal recessive mutations associated with NM were attributed to the NEB gene, whereas 20% of the associated autosomal dominant or autosomal recessive mutations were attributed to the ACTA1 gene (7). To gain insight into the pathogenesis of NM, several animal models, including mouse (8) and zebrafish (9), have been established, and various therapeutic approaches are under investigation (10).

In addition to clinical studies regarding NM, mechanistic studies regarding molecular and genetic pathogenesis have been conducted (11). However, only two compound heterozygous variants (c.9052 G>A, c.24579G>A) in the NEB gene have been identified to date in two patients with NM in a Chinese family (6). No mutations in the other aforementioned genes, to the best of our knowledge, have been detected in patients with NM in China. Although genetic testing is recommended in patients with congenital myopathy, its clinical application has been limited by the cost and time-consuming nature of conventional sequencing. The present study adapted the targeted exome capture technique for rapid sequencing of potential mutations in a patient with congenital myopathy. The present study identified a de novo missense mutation in ACTA1 in a Chinese Han patient with a milder NM phenotype, and also compared the clinical manifestations in previously reported cases with the same mutation.

Materials and methods

Patient information

The patient was an 11-year-old girl presenting with muscle weakness, she was the second child born to a healthy nonconsanguineous 24-year-old mother and 27-year-old father. There was no family history of neuromuscular or other inherited diseases. Creatine kinase measurements and electromyography assessment were performed routinely in the hospital. Written informed consent was obtained from the patient's parents. The present study was approved by the ethics committee of Wenzhou Medical University (Wenzhou, China).

Targeted gene exome sequencing

Genomic DNA was isolated from the peripheral blood leukocytes of the patient and her parents using Wizard® Genomic DNA Purification kit (Promega Corporation, Madison, WI, USA). The BestSeq target-capture sequencing panel, which contains 125 known causal genes for inherited muscle diseases, was used to analyze the DNA of the patient and her parents (conducted by Huakang Gene Institute, Beijing, China). Polymerase chain reaction and Sanger sequencing using primers for the ACAT1 N117S mutation (forward, CGCGTAGCCCTCATAAATGG; reverse, CGACGAGGCTCAGAGCAAGA) were also performed by Huakang Gene Institute to confirm the mutation.

Results

The patient was found to have delayed gross motor skills. She could walk independently at two years old and continued to exhibit progressive improvement in motor development during childhood. Her fine motor activities were adequate; however, her knee jerk reaction and ankle reflex could not be obtained. In addition, her biceps and triceps reflexes could not be obtained. No positive pyramidal sign was detected. The patient had difficulty walking upstairs, and could not jump. No sensory disturbance was identified. Her intellectual capacity was equivalent to that of an 11-year-old child. Her height and body weight were in the normal range. Furthermore, an electromyogram indicated possible myogenic damage. Her serum creatine kinase level was 25 U/l, which is slightly lower than the normal reference range (26-140 U/l).

The clinical manifestations of this patient suggested an undiagnosed myopathy. To identify potential mutation(s), either a de novo mutation or a recessive mutation associated with muscular diseases, BestSeq target-capture sequencing was conducted using DNA samples from the patient and her parents. In the panel of 125 known causal genes for inherited muscle diseases, a missense mutation in exon 3 of the ACTA1 gene at chromosome 1q42.13 (NM_001100.3) was identified. In addition, the mutation (c.350A>G; p.Asn117Ser) was confirmed to be a de novo mutation since it was only detected in the patient (Fig. 1A), and not her parents (Fig. 1B and C).

Figure 1 A causal mutation of skeletal muscle α-actin 1 identified in a Chinese patient. (A-C) De novo missense mutation was confirmed in the patient by Sanger sequencing. (D) The N117 residue is highly evolutionarily conserved, as shown by multiple sequence alignment. (E) The 3D structural model is established using PyMOL Molecular Graphics System. Position of N117 (in red) in the three dimensional representation of the α-actin monomer (Protein Database Bank code 1ATN). The N117 was designated as N115 in 1ATN since the first two amino acids of the protein were removed in the 3D structural model.

The identified mutation was predicted to be damaging or disease-causing using three commonly used tools: SIFT (http://sift.jcvi.org/; affecting protein function with a score of 0.00), PolyPhen-2 (http://genetics.bwh.harvard.edu/pph2/; possibly damaging, with a score of 0.921), and MutationTaster (http://www.mutationtaster.org/; disease-causing with a probability score of 0.99999). The N117 residue (as indicated by the arrow; Fig. 1D) is located in the nucleotide-binding domain of the sugar kinase/heat shock protein 70/actin superfamily, which is evolutionarily conserved from human to Caenorhabditis elegans as shown by multiple sequence alignment (Fig. 1D). Based upon three-dimensional structural analysis using PyMOL Molecular Graphics system, version 1.3 (www.pymol.org), N117 (designated as N115 since the first two amino acids were removed in the crystal structure) was located near the nucleotide-binding cleft and was thus predicted to affect nucleotide binding (Fig. 1E).

Notably, the same mutation (p.N117S) in the ACTA1 gene has previously been identified as a pathogenic locus (rs121909520) in Australian patients with an autosomal dominant inheritance pattern of NM (12–14), and was associated with a typical or severe phenotype (Table I). The three affected individuals succumbed at 36, 18, and 3 years of age, respectively. Conversely, the patient presented in the current study exhibited a much milder phenotype (Table I), thus suggesting a genetic heterogeneity or the existence of genetic modifiers.

Table I Phenotypic comparison of patients with the N117S skeletal muscle α-actin 1 mutation.

Table I

Phenotypic comparison of patients with the N117S skeletal muscle α-actin 1 mutation.

Author (year)	Patient	Age	Type of mutation	Phenotype	Reference
Nowak et al (1999)	#7 (mother), family 6	33 (deceased)	Autosomal dominant	Typical NM	(12)
	#8 (child), family 6	18 (deceased)	Autosomal dominant	Typical NM	(12)
	#9 (child), family 6	3 (deceased)	Autosomal dominant	Severe NM	(12)
Yang et al (2016)	Proband (sporadic case)	11 (alive)	De novo dominant	Mild NM could walk freely, could not jump	Present study

[i] NM, nemaline myopathy.

Discussion

NM (OMIM, #161800) is a novel form of congenital myopathy that was described in 1963 (15), and is characterized by abnormal thread- or rod-like structures in muscle fibers upon histological examination. In the Human Gene Mutation Database professional database (http://www.hgmd.cf.ac.uk/ac/index.php), a total of 196 mutations in the ACTA1 gene, including 181 missense mutations, 10 indels and five splicing events, have been curated. ACTA1 mutations (OMIM, *102610) have been reported to induce several subtypes of myopathy, including nemaline myopathy 3 and congenital myopathy with excess of thin myofilaments or cores (OMIM, #161800), and congenital myopathy with fiber-type disproportion 1 (OMIM, #255310).

In general, two clinical groups of NM can be readily distinguished: i) Typical NM is the most common form (46% of all NM cases), presenting as infantile hypotonia and muscle weakness; and ii) severe NM, which is observed in 16% of NM cases, and is characterized by an absence of spontaneous movement or respiration at birth, arthrogryposis, and mortality in the first months of life (16). Mutations in the ACTA1 gene account for ~20% of typical NM cases and ~50% of severe NM cases (16). In the present study, NM was derived from a de novo mutation, and the patient presented with non-progressive muscle weakness. Compared with previously reported patients with the same mutation, the phenotype of the patient described in the present study appears much milder.

The N117S mutation is mostly associated with milder, typical NM since it is located near the nucleotide-binding cleft, and is predicted to affect nucleotide binding, a defect that may result in a decreased polymerization propensity (14). It has also been observed that the N117S mutant was not readily integrated into stress fibers, since the mutant produced a diffuse cytoplasmic staining in the majority of undifferentiated myoblasts (17). In addition, compared with the wild-type gene, the N117S mutant has been reported to have reduced copolymerization capacity with wild-type actin (18).

In conclusion, to the best of our knowledge, the present study is the first to identify a pathogenic mutation in ACTA1 in a Chinese patient with suspected myopathy. The present study benefited from exome-target capture and next-generation sequencing technology, as recently applied in NM and other inherited diseases (19–22). Further application of this approach will be helpful for the identification of several undiagnosed patients with this type of highly heterogeneous disorder.

Acknowledgments

The present study was supported by research funding from the Chinese Ministry of Health Project (grant no. 201302002 to X.C) and Wenzhou Medical University Research Funding (to P.Y.).

References