Whole exome sequencing identifies novel candidate mutations in a Chinese family with left ventricular noncompaction

  • Authors:
    • Ye Zhou
    • Zhiyong Qian
    • Jing Yang
    • Meng Zhu
    • Xiaofeng Hou
    • Yao Wang
    • Hongping Wu
    • Jiangang Zou
  • View Affiliations

  • Published online on: March 19, 2018     https://doi.org/10.3892/mmr.2018.8777
  • Pages: 7325-7330
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Left ventricular noncompaction (LVNC) is an inherited cardiomyopathy involving numerous genes. To identify novel candidate causal mutations, a whole exome sequencing study was performed on a Chinese LVNC family. Exons of the most prevalent pathogenic genes of LVNC (myosin heavy chain 7 and actin, α‑cardiac muscle 1) were sequenced, although no mutations were identified. Following this, Burrows‑Wheeler Aligner, PICARD and Genome Analysis Toolkit (v.2.8) were used to analyze the exome sequencing data. Non‑silent single nucleotide variants (SNVs) that were identified in patients with LVNC, although not in the healthy individual, were investigated further using SNV prioritization via the integration of genomic data (SPRING) based on P‑values. Co‑expressed gene enrichment analysis was performed using Genotype Tissue Expression (GTEx) data in order to investigate the potential roles of the genes containing SNVs in the myocardium. In the Chinese LVNC family, seven novel SNVs were identified that were only present in patients with LVNC and annotated by SPRING with P<0.05. Among these SNVs, hemicentin 1 [c. thymine (T) 9776 cytosine (C)], tolloid like 2 [c. cytosine (C) 2615 thymine (T)], fms related tyrosine kinase 3 [c. guanine (G) 976 adenine (A)] and nucleotide binding protein like [c. guanine (G) 91 thymine (T)] were located in conserved regions and annotated as deleterious by PolyPhen2, LRT and MutationTaster database analyses. Based on GTEx data, it was revealed that NUBPL was co‑expressed with almost all previously established LVNC pathogenic genes. Furthermore, the results of the present study demonstrated that genes co‑expressed with NUBPL were additionally enriched in the Notch signaling pathway. In addition, the results revealed numerous novel mutations that may be causal SNVs for the development of LVNC in the family involved in the present study.

Introduction

Left ventricular noncompaction (LVNC) is an inherited cardiomyopathy that is characterized by a thick spongy endocardial layer and a thin compacted epicardial layer of the left ventricular myocardium, numerous prominent trabeculations and deep intertrabecular recesses (1). With the introduction of various diagnostic methods, LVNC has become a common cardiomyopathy in population, but the exact prevalence of LVNC has yet to be determined ranging from 0.01 to 0.3% (26). Symptoms exhibited by patients with LVNC may vary from no symptoms to severe heart failure, malignant arrhythmias, circulatory embolism and sudden mortality (1,7). The mortality rate of adult patients with LVNC is 5–12% per year (4,8,9). LVNC is widely considered to be a genetic cardiomyopathy in which myocardial dysplasia is observed during embryogenesis. Despite the diagnosis of LVNC having been improved following the introduction of echocardiography, cardiac magnetic resonance imaging and computed tomography (10), the etiology and mechanism underlying LVNC remain undetermined. LVNC is genetically heterogeneous in humans, and numerous genes have been revealed to be associated with LVNC, including: Myosin heavy chain 7 (MYH7); tafazzin (TAZ); mindbomb E3 ubiquitin protein ligase 1 (MIB1); sodium voltage-gated channel-α subunit 5 (SCN5A); myosin binding protein C, cardiac (MYBPC3); tropomyosin 1 (TPM1); tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein-ε (YWHAE); actin, α-cardiac muscle 1 (ACTC1); and troponin T2, cardiac type (TNNT2) (1113). Previous studies have revealed part of the pathogenesis of LVNC. For example, Luxán, et al (14) found that MIB1 mutations could prevent trabecular maturation and compaction and induce LVNC by NOTCH signaling pathway. Finsterer (15) found that MYH7 was the most important pathogenic genes belonging to sarcomere proteins gene accounting for 22% of all LVNC mutations. The more causal genes and pathogenic mechanisms are found, the more possible it is to find effective treatments. Recently, a novel mutation in MYH7 [c. cytosine (C) 1492 guanine (G)] was identified via whole exome sequencing (WES) as a potential causal mutation in a Chinese family suffering from LVNC (11). However, the already established mutations associated with LVNC are only exhibited in subset of patients suffering from LVNC, and thus the genetic basis of LVNC has not been fully determined. The aim of the present study was to further investigate the potential causal mutations of LVNC by performing WES on a Chinese family with LVNC.

Materials and methods

Patients and clinical characteristics

In the present study, the enrolled individuals (2 male and 2 female, age ranging between 19 and 50 years) were a nuclear family from Jiangsu Province, China. A 19-year-old male (patient II2) was the proband and exhibited no symptoms of chest pain or dizziness; however, a heart murmur was detected during a regular check-up in 2015. Following further physical examination, the proband sought medical treatment at Huai'an First People's Hospital and The First Affiliated Hospital of Nanjing Medical University (Nanjing, China). During treatment, the patient underwent echocardiography and 12-lead electrocardiography, and two observers carefully and independently examined the results. The patient met the following echocardiographic diagnostic criteria for LVNC: (i) A noncompacted/compacted ratio for a two-layered endocardium of >2; (ii) left ventricular deep endomyocardial trabeculations; and (iii) deep recesses filled with blood visualized on color Doppler imaging (16,17). Subsequently, the parents of the proband, in addition to other relatives, underwent a general medical history review, physical examination and echocardiography. A brief questionnaire was additionally administered in order to collect information on family history. Finally, it was determined that the father (I1) of the proband additionally matched the criteria of a LVNC diagnosis (Fig. 1), whereas the mother of the proband (I2) and the sister (II1) were revealed to be healthy.

Ethics statement

The present study was supported and approved by the Human Ethics Committee of The First Affiliated Hospital of Nanjing Medical University, and written informed consent was provided by the subjects prior to medical examination.

WES and mutation analysis
Samples collection and DNA extraction

Blood samples from the proband and his parents were collected during August 2015 in The First Affiliated Hospital of Nanjing Medical University and analyzed. Genomic DNA was extracted using a Genomic DNA Purification kit (Qiagen, Inc., Valencia, CA, USA).

Genome sequencing

Exons of MYH7 and ACTC1 were sequenced by the Department of Epidemiology and Biostatistics, School of Public Health, Nanjing Medical University via Sanger sequencing to identify whether the family trio harbored mutations in the already established LVNC-associated causal genes; however, no mutations were revealed in said genes. Thus, the sequencing results suggested that unknown mutations may be responsible for the development of LVNC. Therefore, WES was subsequently performed using the TruSeq® DNA HS Sample Preparation Kit on the Illumina TruSeq Exome Enrichment platform kit libraries (Illumina, Inc., San Diego, CA, USA), which includes 20,794 target genes, with the aim of targeting 62 Mb genomic regions using 95-base DNA probes. In addition to covering the RefSeq and Ensembl coding sequences, the enriched sequences also include 28 Mb of RefSeq untranslated regions (UTR). Following this, genomic libraries were prepared, according to the manufacturer's protocol. First, 100–500-bp DNA fragments were prepared using genomic DNA (5 mg) in elution buffer (80 ml) via sonication at 200 W and for 30 sec (10 cycles) at 4°C using a Bioruptor (Diagenode Inc., Denville, NJ, USA). Following this, DNA fragments ranging between 150 and 250 bp were isolated via 2% gel electrophoresis. End repair was performed using T4 DNA poly and Klenow poly cleave 3′ (supplied with the TruSeq® DNA HS Sample Preparation kit) followed by a size selection procedure (as set out in the TruSeq Enrichment Guide and instructions in the MinElute Gel Extraction kit). An additional adenosine base was then added to the 3′ end by Klenow 3′ to 5′ exo minus (3′→5′ exo-), and following this, DNA fragments containing the Illumina multiPE-adaptor (Illumina, Inc.) were isolated (PE Adapters sequence: 5′P-GATCGGAAGAGCGGTTCAGCAGGAATGCCGAG, 5′ACACTCTTTCCCTACACGACGCTCTTCCGATCT; TruSeq® DNA HS Sample Preparation kit). Following this, DNA products were amplified via 12 cycles of polymerase chain reaction (PCR) using Illumina multiPE primer #1 (PE-1.0: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATC* T-3′; 1 ml; 25 mM; Illumina, Inc.), Illumina multiPE primer #2 (PE-2.0: 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATC* T-3′; 1 ml; 0.5 mM; Illumina, Inc.) and Illumina index primer (1 ml; 25 mM; Illumina, Inc.) to generate DNA libraries. The thermocycling conditions were: 98°C for 30 sec followed by 10 cycles of 98°C (10 sec), 60°C (30 sec), 72°C (30 sec), 72°C (5 min) and holding at 10°C.

Following this, the Illumina HiSeq1500 (Ilumina, Inc.) was used to sequence the enriched DNA libraries according to the manufacturer's protocol. Burrows-Wheeler Aligner (18) was subsequently utilized to align the sequences to the human reference genome (http://hgdownload.cse.ucsc.edu/goldenPath/hg19/chromosomes/). Picard software (version 2.14.1, https://broadinstitute.github.io/picard/) was used to exclude PCR duplicates, and following this, new regional realignment and recalibration of quality scoring was performed using the Genome Analysis Toolkit (GATK; v.2.8) (19). Variations were identified by GATK using recommended parameters (https://gatkforums.broadinstitute.org/gatk/profile/GATK_Team). Integrative Genomics Viewer (IGV; https://igv.org/), a highly efficient and specialized tool for examining integrated genomic datasets, was used to determine genetic variations based on genomic position (20). Following this, known variants listed by the HAPMAP (http://www.internationalgenome.org/category/hapmap/), 1000 Genomes Project (http://www.internationalgenome.org/) or Project of dbSNP137 (http://varianttools.sourceforge.net/Annotation/DbSNP) were excluded. In the following analysis, the remaining single nucleotide variants (SNVs) were investigated further to identify whether they were present only in the patients suffering from LVNC and not in the healthy subjects in the family (the sister and mother of the proband). Following this, the remaining variants of nonsynonymous single nucleotides identified by SNV prioritization via the integration of genomic data (SPRING) (21) were prioritized for further analysis.

Statistical analysis

P-values were calculated by SPRING, combining six deleterious scores (LRT, SIFT, PolyPhen2, PhyloP, GERP and Mutation Taster) and five associated scores from multiple sources of genomic data (including protein-protein interactions, gene ontology, protein sequences, gene pathway annotations and protein domain annotations). Co-expression analysis was performed based on data obtained from Genotype-Tissue Expression (GTEx; gtexportal.org) on the ventricular myocardium. The R package ‘clusterProfiler’ (22) was used to perform Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis. P<0.05 was considered to indicate a statistically significant result.

Results

Clinical characteristics

The proband (II2) exhibited no symptoms, and the electrocardiogram results were normal. The echocardiogram of the proband demonstrated prominent trabeculations associated with deep recesses in the apex and bicuspid aortic valve. A thickened endocardial layer and a thin epicardial layer were additionally observed (Fig. 2). The father (I1) of the proband was diagnosed with LVNC by echocardiography, which revealed a noncompacted area in the lateral wall of the left ventricle. The father of the proband additionally did not exhibit any clinical symptoms, and the electrocardiogram results were normal. The mother and sister of the proband were validated as healthy by electrocardiographic and echocardiographic testing.

Mutation screening

A total of 8,354 MB high-quality reads were obtained for patient II2, 2,689 M reads for patient I1 and 7,408 M reads for healthy control I2. A total of 21,337 variants or indels were detected in the proband, 18,230 were detected in the father of the proband additionally suffering from LVNC (I1) and 17,865 were detected in the healthy mother of the proband (I2). Following exclusion of variants revealed in multiple databases (HAPMAP, dbSNP137 and 1000 Genomes Project), 1,633, 1,750 and 1,524 variants or indels were retained, respectively. For subsequent analysis, synonymous variants and non-frameshift indels were excluded. Finally, a total of 43 non-silent coding variants (LIN7C, PDCD6, FLT3, NALCN, HMCN1, TLL2, NUBPL, LIM2, OSBPL8, SH3PXD2A, ATP13A5, SPTB, NUP188, C16orf71, FKBP9, TP53BP2, MVP, LRRC3B, ARID1B, TXNIP, NR5A2, MUC5B, ANKAR, MGAT4C, USP24, DOK1, HMGN2, ANKRD20A4, SSC5D, ATP9A, DLG5, TAX1BP1, ZNF814, SMC1B, ELAVL3, PLEKHH2, REPIN1, TCEANC2, PLEKHA4, DOK3, PCDHA5, ZNF707 and MUC12) were revealed to be present in the two patients suffering from LVNC and not in the healthy control. SPRING was then used to prioritize the disease-causing nonsynonymous SNVs, and seven SNVs with P<0.05 were subsequently identified: hemicentin 1 (HMCN1) [c. thymine (T)9776C], programmed cell death 6 (PDCD6) [c. adenine (A)418T], tolloid like 2 (TLL2) (c.C2615T), lin-7 homolog C, crumbs cell polarity complex component (LIN7C) (c.C91T), fms related tyrosine kinase 3 (FLT3) (c.G976A), sodium leak channel, non-selective (NALCN) (c.G4975A) and nucleotide binding protein like (NUBPL) (c.G91T; Table I). In addition, the results demonstrated that TLL2 (c.C2615T) and FLT3 (c.G976A) are located in conserved regions and are annotated as deleterious by the SIFT, PolyPhe2, LRT and MutationTaster databases. Furthermore, NUBPL (c.G91T) and HMCN1 (c.T9776C) were revealed to be located in conserved regions and annotated as deleterious by the PolyPhe2, LRT and MutationTaster databases. However, these variants (Table I) have not been previously reported in the Human Gene Mutation Database (www.hgmd.org). Following this, the reliability of the seven identified mutations was further validated by investigating the mapping quality around these mutations using IGV (data not shown; are available from the corresponding author on reasonable request).

Table I.

Single nucleotide variants with P<0.05 and their categorization, as determined by single nucleotide variants prioritization via the integration of genomic data analysis.

Table I.

Single nucleotide variants with P<0.05 and their categorization, as determined by single nucleotide variants prioritization via the integration of genomic data analysis.

Location of mutationGeneAmino acid changeP-valuePhyloPSIFTPolyPhen2LRTMutation taster
Chr1: 186059938 T>CHMCN1p.L3259P 2.05×10−2ConservedTolerateDeleteriousDeleteriousDeleterious
Chr5: 311458 A>TPDCD6p.R140W 7.57×10−3NeutralDeleteriousDeleteriousNeutralDeleterious
Chr10: 98133400 G>ATLL2p.S872L 4.44×10−2ConservedDeleteriousDeleteriousDeleteriousDeleterious
Chr11: 27523414 G>ALIN7Cp.P31S 5.40×10−3ConservedTolerateDeleteriousNeutralDeleterious
Chr13: 28623581 C>TFLT3p.G326R 1.13×10−2ConservedDeleteriousDeleteriousDeleteriousDeleterious
Chr13: 101710339 C>TNALCNp.D1659N 1.73×10−2ConservedToleratePossibly damagingDeleteriousDeleterious
Chr14: 32295867 G>TNUBPLp.A31S 4.86×10−2ConservedTolerateDeleteriousDeleteriousDeleterious

[i] Chr, chromosome; HMCN1, hemicentin 1; PDCD6, programmed cell death 6; TLL2, tolloid like 2; LIN7C, lin-7 homolog C, crumbs cell polarity complex component; FLT3, fms related tyrosine kinase 3; NALCN, sodium leak channel, non-selective; NUBPL, nucleotide binding protein like; SPRING, single nucleotide variant prioritization via the integration of genomic data.

Co-expressed gene enrichment analysis

Co-expression analysis on the seven identified genes and previously revealed LVNC-associated genes was performed using on data from the ventricular myocardium in GTEx (https://www.gtexportal.org/home/). The results demonstrated that NUBPL was co-expressed with almost all of the established LVNC-associated genes, including SCN5A, MYH7, ACTC1, YWHAE, MYBPC3, TAZ, MIB1 and TPM1. A further gene, PDCD6, was revealed to be co-expressed with the established LVNC-associated genes SCN5A, MYH7, ACTC1, YWHAE, MYBPC3, TAZ and MIB1, although not TPM1. KEGG pathway analysis revealed that genes co-expressed with NUBPL and PDCD6 were enriched in the Notch signaling pathway (data not shown; are available from the corresponding author on reasonable request).

Discussion

WES is an important tool for genetic research; however, investigations regarding LVNC using WES have not been extensively performed. In the present study, WES was performed on a Chinese family with members suffering from LVNC and seven novel mutations were revealed that, to the best of our knowledge, have not previously been reported to be associated with LVNC. Among them, TLL2 (c.C2615T) and FLT3 (c.G976A) are located in conserved regions and were revealed to be deleterious by SIFT, PolyPhe2, LRT and MutationTaster database analyses. Thus, these mutations may represent potential causal mutations of LVNC.

TLL2 encodes an astacin-like zinc-dependent metalloprotease that is a subfamily member of the bone morphogenetic protein-1 (BMP-1)/tolloid (TLD) protein family. The BMP-1/TLD protein family is conserved from Drosophila to Homo sapiens. and includes BMP-1, TLD, TLL-1 and TLL-2 proteins, which are encoded for by the BMP1, TLL1 and TLL2 genes, respectively (23). TLL-1 and TLL-2 are important for normal morphogenesis and extracellular matrix deposition (24). Previous studies have revealed that TLL-1 is highly expressed in the endocardium and developing septa of the mouse heart and is involved in the regulation of heart morphogenesis via activation of transforming growth factor-β (TGF-β)-like molecules (25,26). In addition, mutations in TLL1 have been demonstrated to be associated with atrial septal defects in humans (27). Despite the structure of TLL-2 being similar to that of TLL-1, TLL-2 is predominantly expressed in the developing skeletal muscle, where it activates latent myostatin and regulates muscle growth (23,25,28). Therefore, it may be suggested that the novel SNV (c.C2615T) in TLL2 revealed in the present study may be associated with heart development in humans; however, further research is required to investigate this result.

FLT3 encodes for a membrane-bound receptor tyrosine kinase that is associated with hematopoietic cell proliferation and differentiation (29,30). In addition, a further study revealed that FLT3 expression is upregulated following myocardial infarction in mouse hearts and that the activation of FLT3 by FLT3 ligand protects cardiomyocytes from oxidative stress-induced apoptosis via a protein kinase B-dependent mechanism (31). However, whether mutations in FLT3 lead to abnormal myocardial development remains undetermined.

Despite other novel mutations in conserved regions of genes not being annotated as deleterious by SIFT, PolyPhe2, LRT and the MutationTaster database analyses, it was revealed that a number of said mutations are associated with cardiac function. In the present study, a mutation in HMCN1 (c.T9776C), which encodes for an extracellular protein belonging to the immunoglobulin superfamily, was annotated as deleterious by PolyPhe2, LRT and the MutationTaster databases (32). Furthermore, HMCN1 has previously been revealed to be predominantly expressed in the vascular endothelial cells of coronary arteries and sparsely expressed in the endocardial endothelium in the mouse heart, which may have an important role in myocardial remodeling following myocardial infarction by affecting cardiac fibroblast migration via TGF-β1 signaling (33). Furthermore, a previous study using animal models and induced pluripotent stem cell-derived cardiomyocytes demonstrated that abnormal regulation of TGF-β may represent a potential mechanism underlying LVNC (34). Thus, it may be suggested that there may be an association between HMCN1 and LVNC.

The mutation in NUBPL (c.G91T) was revealed to be deleterious by PolyPhe2, LRT and MutationTaster database analyses. The results of the present study revealed that NUBPL is co-expressed with genes that have been previously demonstrated to be associated with LVNC, including SCN5A, MYH7, ACTC1, YWHAE, MYBPC3, TAZ, MIB1 and TPM1, although not TNNT2, based on GTEx. In addition, enrichment analysis revealed that NUBPL is enriched in the Notch pathway. Notably, Luxán et al (14) demonstrated that Notch pathway dysfunction may lead to LVNC. Furthermore, NUBPL encodes for a protein that is required for nicotinamide adenine dinucleotide dehydrogenase (human complex I) assembly in the respiratory chain (35). Loeffen et al (36) and Benit et al (37) demonstrated that human complex I deficiency is associated with hypertrophic cardiomyopathy. Therefore, it may be suggested that mutations in NUBPL may induce human complex I deficiency and abnormal myocardial development. Based on the previous evidence and the results of the present study, it may be hypothesized that NUBPL represents a potential causal gene of LVNC.

Furthermore, the present study identified PDCD6 as an additional gene that is enriched in the Notch signaling pathway. PDCD6 is a calcium-binding modulator associated with cell proliferation and death (38). Numerous studies have revealed that PDCD6 is associated with tumors; however, the underlying mechanism remains unclear (3942). Furthermore, one study demonstrated that overexpression of PDCD6 suppressed angiogenesis in vitro via the phosphatidylinositol 3-kinase/protein kinase mTOR/ribosomal protein S6 kinase B1 pathway (43). However, as PDCD6 was annotated by the LRT database analysis as neutral, it is less likely to be a causal gene of LVNC.

In conclusion, the results of the present study revealed numerous novel mutations [TLL2 (c.C2615T), FLT3 (c.G976A), NUBPL (c.G91T) and PDCD6 (c.A418T)] that may be associated with LVNC in a Chinese family. Among them, mutations in NUBPL are more likely to represent causal SNVs for LVNC. Considering that this was an exploratory study using a small sample population, additional investigations, including expanding the sample size and performing reverse transcription-PCR, may be required to verify the preliminary results of the present study and to determine the mechanisms underlying the pathogenesis of LVNC.

Acknowledgements

Not applicable.

Funding

The present study was supported by the Cardiovascular disease clinical medical research center of Jiangsu, China (grant no. KFSN201403-05).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

YZ, ZQ, JY and JZ performed the study and were major contributors to writing the manuscript. MZ analyzed and interpreted the patient data regarding LVNC. XH, YW and HW collected clinical data. All authors read and approved the final manuscript.

Ethics approval and consent to participate

The present study was supported and approved by the Human Ethics Committee of The First Affiliated Hospital of Nanjing Medical University, and written informed consent was provided by the subjects prior to medical examination.

Consent for publication

Written informed consent was provided by the subjects prior to medical examination.

Competing interests

All authors declare that there are no competing interests.

Glossary

Abbreviations

Abbreviations:

LVNC

left ventricular noncompaction

WES

whole exome sequencing

GATK

Genome Analysis Toolkit

SNVs

single nucleotide variants

MYH7

myosin heavy chain 7

TAZ

tafazzin

MIB1

mindbomb E3 ubiquitin protein ligase 1

SCN5A

sodium voltage-gated channel α-subunit 5

MYBPC3

myosin binding protein C, cardiac

TPM1

tropomyosin 1

YWHAE

tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein-ε

ACTC1

actin, α-cardiac muscle 1

TNNT2

troponin T2, cardiac type

SPRING

single nucleotide variant prioritization via the integration of genomic data

PCR

polymerase chain reaction

IGV

integrative genomics viewer

GTEx

genotype-tissue expression

KEGG

Kyoto Encyclopedia of Genes and Genomes

BMP-1/TLD

bone morphogenetic protein-1/tolloid

TGF-β

transforming growth factor-β

References

1 

Sarma RJ, Chana A and Elkayam U: Left ventricular noncompaction. Prog Cardiovasc Dis. 52:264–273. 2010. View Article : Google Scholar : PubMed/NCBI

2 

Cheng TO: Left ventricular noncompaction cardiomyopathy: Three decades of progress. Int J Cardiol. 174:227–229. 2014. View Article : Google Scholar : PubMed/NCBI

3 

Ronderos R, Avegliano G, Borelli E, Kuschnir P, Castro F, Sanchez G, Perea G, Corneli M, Zanier MM, Andres S, et al: Estimation of prevalence of the left ventricular noncompaction among adults. Am J Cardiol. 118:901–905. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Ritter M, Oechslin E, Sütsch G, Attenhofer C, Schneider J and Jenni R: Isolated noncompaction of the myocardium in adults. Mayo Clin Proc. 72:pp. 26–31. 1997; View Article : Google Scholar : PubMed/NCBI

5 

Ozkutlu S, Ayabakan C, Celiker A and Elshershari H: Noncompaction of ventricular myocardium: A study of twelve patients. J Am Soc Echocardiogr. 15:1523–1528. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Stollberger C, Blazek G, Winkler-Dworak M and Finsterer J: Sex differences in left ventricular noncompaction in patients with and without neuromuscular disorders. Rev Esp Cardiol. 61:130–136. 2008.(In Spanish). View Article : Google Scholar : PubMed/NCBI

7 

Oechslin EN, Attenhofer Jost CH, Rojas JR, Kaufmann PA and Jenni R: Long-term follow-up of 34 adults with isolated left ventricular noncompaction: A distinct cardiomyopathy with poor prognosis. J Am Coll Cardiol. 36:493–500. 2000. View Article : Google Scholar : PubMed/NCBI

8 

Stollberger C, Blazek G, Wegner C and Finsterer J: Neurological comorbidity affects prognosis in left ventricular hypertrabeculation/noncompaction. Heart Lung. 41:594–598. 2012. View Article : Google Scholar : PubMed/NCBI

9 

Peters F, Khandheria BK, Botha F, Libhaber E, Matioda H, Dos Santos C, Govender S, Meel R and Essop MR: Clinical outcomes in patients with isolated left ventricular noncompaction and heart failure. J Card Fail. 20:709–715. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Paterick TE, Umland MM, Jan MF, Ammar KA, Kramer C, Khandheria BK, Seward JB and Tajik AJ: Left ventricular noncompaction: A 25-year odyssey. J Am Soc Echocardiogr. 25:363–375. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Yang J, Zhu M, Wang Y, Hou X, Wu H, Wang D, Shen H, Hu Z and Zou J: Whole-exome sequencing identify a new mutation of MYH7 in a Chinese family with left ventricular noncompaction. Gene. 558:138–142. 2015. View Article : Google Scholar : PubMed/NCBI

12 

Zaragoza MV, Arbustini E and Narula J: Noncompaction of the left ventricle: Primary cardiomyopathy with an elusive genetic etiology. Curr Opin Pediatr. 19:619–627. 2007. View Article : Google Scholar : PubMed/NCBI

13 

Klaassen S, Probst S, Oechslin E, Gerull B, Krings G, Schuler P, Greutmann M, Hurlimann D, Yegitbasi M, Pons L, et al: Mutations in sarcomere protein genes in left ventricular noncompaction. Circulation. 117:2893–2901. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Luxán G, Casanova JC, Martinez-Poveda B, Prados B, D'Amato G, MacGrogan D, Gonzalez-Rajal A, Dobarro D, Torroja C, Martinez F, et al: Mutations in the NOTCH pathway regulator MIB1 cause left ventricular noncompaction cardiomyopathy. Nat Med. 19:193–201. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Finsterer J: Cardiogenetics, neurogenetics, and pathogenetics of left ventricular hypertrabeculation/noncompaction. Pediatr Cardiol. 30:659–681. 2009. View Article : Google Scholar : PubMed/NCBI

16 

Jenni R, Oechslin E, Schneider J, Attenhofer Jost C and Kaufmann PA: Echocardiographic and pathoanatomical characteristics of isolated left ventricular non-compaction: A step towards classification as a distinct cardiomyopathy. Heart. 86:666–671. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Tian T, Liu Y, Gao L, Wang J, Sun K, Zou Y, Wang L, Zhang L, Li Y, Xiao Y, Song L and Zhou X: Isolated left ventricular noncompaction: Clinical profile and prognosis in 106 adult patients. Heart Vessels. 29:645–652. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Li H and Durbin R: Fast and accurate long-read alignment with Burrows-Wheeler transform. Bioinformatics. 26:589–595. 2010. View Article : Google Scholar : PubMed/NCBI

19 

DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, Philippakis AA, del Angel G, Rivas MA, Hanna M, et al: A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet. 43:491–498. 2011. View Article : Google Scholar : PubMed/NCBI

20 

Thorvaldsdottir H, Robinson JT and Mesirov JP: Integrative Genomics Viewer (IGV): High-performance genomics data visualization and exploration. Brief Bioinform. 14:178–192. 2013. View Article : Google Scholar : PubMed/NCBI

21 

Wu J, Li Y and Jiang R: Integrating multiple genomic data to predict disease-causing nonsynonymous single nucleotide variants in exome sequencing studies. PLoS Genet. 10:e10042372014. View Article : Google Scholar : PubMed/NCBI

22 

R Core Team: R: A language and environment for statistical computingR Foundation for Statistical Computing. Vienna: 2014

23 

Lee SJ: Genetic analysis of the role of proteolysis in the activation of latent myostatin. PLoS One. 3:e16282008. View Article : Google Scholar : PubMed/NCBI

24 

Bayley CP, Ruiz Nivia HD, Dajani R, Jowitt TA, Collins RF, Rada H, Bird LE and Baldock C: Diversity between mammalian tolloid proteinases: Oligomerisation and non-catalytic domains influence activity and specificity. Sci Rep. 6:214562016. View Article : Google Scholar : PubMed/NCBI

25 

Clark TG, Conway SJ, Scott IC, Labosky PA, Winnier G, Bundy J, Hogan BL and Greenspan DS: The mammalian Tolloid-like 1 gene, Tll1, is necessary for normal septation and positioning of the heart. Development. 126:2631–2642. 1999.PubMed/NCBI

26 

Sieron AL and Stanczak P: ASD-lessons on genetic background from transgenic mice with inactive gene encoding metalloprotease, Tolloid-like 1 (TLL1). Med Sci Monit. 12:RA17–RA22. 2006.PubMed/NCBI

27 

Stanczak P, Witecka J, Szydlo A, Gutmajster E, Lisik M, Augusciak-Duma A, Tarnowski M, Czekaj T, Czekaj H and Sieron AL: Mutations in mammalian tolloid-like 1 gene detected in adult patients with ASD. Eur J Hum Genet. 17:344–351. 2009. View Article : Google Scholar : PubMed/NCBI

28 

Scott IC, Blitz IL, Pappano WN, Imamura Y, Clark TG, Steiglitz BM, Thomas CL, Maas SA, Takahara K, Cho KW and Greenspan DS: Mammalian BMP-1/Tolloid-related metalloproteinases, including novel family member mammalian Tolloid-like 2, have differential enzymatic activities and distributions of expression relevant to patterning and skeletogenesis. Dev Biol. 213:283–300. 1999. View Article : Google Scholar : PubMed/NCBI

29 

Stirewalt DL and Radich JP: The role of FLT3 in haematopoietic malignancies. Nat Rev Cancer. 3:650–665. 2003. View Article : Google Scholar : PubMed/NCBI

30 

Garg M, Nagata Y, Kanojia D, Mayakonda A, Yoshida K, Keloth SH, Zang ZJ, Okuno Y, Shiraishi Y, Chiba K, et al: Profiling of somatic mutations in acute myeloid leukemia with FLT3-ITD at diagnosis and relapse. Blood. 126:2491–2501. 2015. View Article : Google Scholar : PubMed/NCBI

31 

Pfister O, Lorenz V, Oikonomopoulos A, Xu L, Häuselmann SP, Mbah C, Kaufmann BA, Liao R, Wodnar-Filipowicz A and Kuster GM: FLT3 activation improves post-myocardial infarction remodeling involving a cytoprotective effect on cardiomyocytes. J Am Coll Cardiol. 63:1011–1019. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Omer WH, Narita A, Hosomichi K, Mitsunaga S, Hayashi Y, Yamashita A, Krasniqi A, Iwasaki Y, Kimura M and Inoue I: Genome-wide linkage and exome analyses identify variants of HMCN1 for splenic epidermoid cyst. BMC Med Genet. 15:1152014. View Article : Google Scholar : PubMed/NCBI

33 

Chowdhury A, Herzog C, Hasselbach L, Khouzani HL, Zhang J, Hammerschmidt M, Rudat C, Kispert A, Gaestel M, Menon MB, et al: Expression of fibulin-6 in failing hearts and its role for cardiac fibroblast migration. Cardiovasc Res. 103:509–520. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Kodo K, Ong SG, Jahanbani F, Termglinchan V, Hirono K, InanlooRahatloo K, Ebert AD, Shukla P, Abilez OJ, Churko JM, et al: iPSC-derived cardiomyocytes reveal abnormal TGF-β signalling in left ventricular non-compaction cardiomyopathy. Nat Cell Biol. 18:1031–1042. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Calvo SE, Tucker EJ, Compton AG, Kirby DM, Crawford G, Burtt NP, Rivas M, Guiducci C, Bruno DL, Goldberger OA, et al: High-throughput, pooled sequencing identifies mutations in NUBPL and FOXRED1 in human complex I deficiency. Nat Genet. 42:851–858. 2010. View Article : Google Scholar : PubMed/NCBI

36 

Loeffen J, Elpeleg O, Smeitink J, Smeets R, Stockler-Ipsiroglu S, Mandel H, Sengers R, Trijbels F and van den Heuvel L: Mutations in the complex I NDUFS2 gene of patients with cardiomyopathy and encephalomyopathy. Ann Neurol. 49:195–201. 2001. View Article : Google Scholar : PubMed/NCBI

37 

Benit P, Beugnot R, Chretien D, Giurgea I, De Lonlay-Debeney P, Issartel JP, Corral-Debrinski M, Kerscher S, Rustin P, Rötig A and Munnich A: Mutant NDUFV2 subunit of mitochondrial complex I causes early onset hypertrophic cardiomyopathy and encephalopathy. Human Mutat. 21:582–586. 2003. View Article : Google Scholar

38 

Park SH, Lee JH, Lee GB, Byun HJ, Kim BR, Park CY, Kim HB and Rho SB: PDCD6 additively cooperates with anti-cancer drugs through activation of NF-κB pathways. Cell Signal. 24:726–733. 2012. View Article : Google Scholar : PubMed/NCBI

39 

He YQ, Zhou B, Shi SQ, Zhang L and Li WM: Genetic variation in PDCD6 and susceptibility to lung cancer. Asian Pac J Cancer Prev. 13:4689–4693. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Zhang K, Zhou B, Shi S, Song Y and Zhang L: Variations in the PDCD6 gene are associated with increased uterine leiomyoma risk in the Chinese. Genet Test Mol Biomarkers. 17:524–528. 2013. View Article : Google Scholar : PubMed/NCBI

41 

Zhou B, Zhang P, Tang T, Zhang K, Wang Y, Song Y, Liao H and Zhang L: Prognostic value of PDCD6 polymorphisms and the susceptibility to bladder cancer. Tumour Biol. 35:7547–7554. 2014. View Article : Google Scholar : PubMed/NCBI

42 

Zhou B, Bai P, Xue H, Zhang Z, Shi S, Zhang K, Wang Y, Wang K, Quan Y, Song Y and Zhang L: Single nucleotide polymorphisms in PDCD6 gene are associated with the development of cervical squamous cell carcinoma. Fam Cancer. 14:1–8. 2015. View Article : Google Scholar : PubMed/NCBI

43 

Rho SB, Song YJ, Lim MC, Lee SH, Kim BR and Park SY: Programmed cell death 6 (PDCD6) inhibits angiogenesis through PI3K/mTOR/p70S6K pathway by interacting of VEGFR-2. Cell Signal. 24:131–139. 2012. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2018
Volume 17 Issue 5

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhou Y, Qian Z, Yang J, Zhu M, Hou X, Wang Y, Wu H and Zou J: Whole exome sequencing identifies novel candidate mutations in a Chinese family with left ventricular noncompaction. Mol Med Rep 17: 7325-7330, 2018.
APA
Zhou, Y., Qian, Z., Yang, J., Zhu, M., Hou, X., Wang, Y. ... Zou, J. (2018). Whole exome sequencing identifies novel candidate mutations in a Chinese family with left ventricular noncompaction. Molecular Medicine Reports, 17, 7325-7330. https://doi.org/10.3892/mmr.2018.8777
MLA
Zhou, Y., Qian, Z., Yang, J., Zhu, M., Hou, X., Wang, Y., Wu, H., Zou, J."Whole exome sequencing identifies novel candidate mutations in a Chinese family with left ventricular noncompaction". Molecular Medicine Reports 17.5 (2018): 7325-7330.
Chicago
Zhou, Y., Qian, Z., Yang, J., Zhu, M., Hou, X., Wang, Y., Wu, H., Zou, J."Whole exome sequencing identifies novel candidate mutations in a Chinese family with left ventricular noncompaction". Molecular Medicine Reports 17, no. 5 (2018): 7325-7330. https://doi.org/10.3892/mmr.2018.8777