Open Access

miR‑302c‑3p and miR‑520a‑3p suppress the proliferation of cervical carcinoma cells by targeting CXCL8

  • Authors:
    • Hong-Mei Ding
    • Hong Zhang
    • Juan Wang
    • Jin-Hua Zhou
    • Fang-Rong Shen
    • Ru-Ning Ji
    • Jia-Yin Shi
    • You-Guo Chen
  • View Affiliations

  • Published online on: March 5, 2021     https://doi.org/10.3892/mmr.2021.11961
  • Article Number: 322
  • Copyright: © Ding et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

The aim of the present study was to identify the differentially expressed microRNAs (miRs) in cervical carcinoma (CC) tissues and cells and to explore the function of miR‑302c‑3p and miR‑520a‑3p in the proliferation of CC cells. Potential dysregulated miRNAs in CC tissues and tumour‑adjacent tissues were detected. Reverse transcription‑quantitative PCR (RT‑qPCR) was performed to determine the expression of miR‑302c‑3p, miR‑520a‑3p and CXCL8 in CC tissues and cell lines. The target genes of the miRNAs were predicted using miRTarBase and verified by luciferase reporter assays. RT‑qPCR and western blotting were performed to measure the expression of C‑X‑C motif ligand (CXCL)8 after transfection. The effect on proliferation was verified by Cell Counting Kit assay and ethynyl‑2‑deoxyuridine staining. Flow cytometry was utilised to assess the effect on apoptosis. In the present study, miR‑302c‑3p and miR‑520a‑3p were markedly downregulated in CC cell lines compared to the normal cervical cell line H8. Functionally, overexpression of miR‑302c‑3p and/or miR‑520a‑3p inhibited proliferation and promoted the apoptosis of CC cell lines in vitro, while the knockdown of miR‑302c‑3p and/or miR‑520a‑3p had the opposite effect. Furthermore, miR‑302c‑3p and miR‑520a‑3p could both bind to CXCL8. Inhibition of CXCL8 in combination with miR‑302c‑3p and/or miR‑520a‑3p overexpression exerted proliferation‑suppressive and apoptosis‑stimulating effects on CC cells, whereas restoring CXCL8 attenuated the miR‑302c‑3p‑ and miR‑520a‑3p‑induced anti‑proliferative and pro‑apoptotic effects. miR‑302c‑3p and miR‑520a‑3p suppress the proliferation of CC cells by downregulating the expression of CXCL8, which may provide a novel target for the treatment of CC.

Introduction

Cervical carcinoma (CC) is one of the leading causes of cancer-related death in females (1), with an increasing incidence in relatively young females (2). It is of great importance to investigate the mechanisms of tumourigenesis and development of CC to facilitate its therapy.

As a type of small non-coding RNA, microRNAs (miRNAs) can post-transcriptionally modify target gene expression by binding to 3′-untranslated regions (3′-UTRs), followed by translational inhibition or degradation of mRNAs (3). miRNAs can either be cancer-promoting, by inhibiting anti-oncogenes, or cancer-suppressing, by inhibiting oncogenes (3). Accumulating evidence has proven that miRNAs can impact tumour metastasis in a broad spectrum of human malignancies. For instance, excessive maturation of miR-25-3p via m6A modification, which can be induced by cigarette smoking, promotes the development of pancreatic cancer (4), and miR-375 has been described as a crucial regulator of phagocyte infiltration (5). Moreover, miRNAs have been reported to modulate tumour proliferation by regulating target genes. MiRNA-145, for instance, was reported to inhibit the proliferation of non-small cell lung cancer cells by targeting c-Myc (6). However, the roles of miRNAs, especially proliferation-relevant miRNAs, in CC remain to be clarified.

miR-302c-3p and miR-520a-3p are known as tumour suppressors in several types of cancer, including glioma (7), renal cell carcinoma (8), and hepatocellular carcinoma (9). However, the biological functions of miR-302c-3p and miR-520a-3p in CC, particularly in CC proliferation, are still unclear. Moreover, given that miR-302 and miR-520 can regulate the natural killer group 2 D ligands major histocompatibility complex class I chain-related proteins A and B and unique long 16-binding protein 2 to counter the resistance of Kasumi-1 cells to natural killer cells (10), it remains unclear whether miR-302c-3p and miR-520a-3p can act co-operatively to regulate CC metastasis and proliferation.

C-X-C motif ligand (CXCL)8 (CXCL8), also known as interleukin-8 (IL-8), is a pro-inflammatory CXC chemokine that is associated with the promotion of neutrophil chemotaxis and degranulation (11). Under normal circumstances, the expression of CXCL8 in tissues is low or undetectable; however, increased expression of CXCL8 is detected in some human solid tumours, such as cervical cancer (12), ovarian cancer (13,14), and non-small cell lung cancer (15). CXCL8 produced by cancer cells in response to epithelial-mesenchymal transition (EMT) is involved in various biological cell phenotypes, such as cell proliferation, migration and metastasis (16). More importantly, in microsatellite-unstable colorectal cancer, CXCL8 production and cell proliferation is enhanced by the loss of miR-484 (17), indicative of a regulatory role for CXCL8 and miRNAs. Although CXCL8 is not a novel target in CC, as it has previously been reported to be upregulated in CC (18), the present study focused on investigating the relationship between miR-302c-3p, miR-520a-3p and CXCL8.

In the present study, differentially expressed miRNAs between CC tissues and adjacent normal tissues were screened by literature review and based on the author's unpublished data (data not shown). Of the 25 selected miRNAs, the effect of miR-302c-3p and miR-520a-3p on CC cell proliferation was investigated. The aim of the present study was to explore the cooperative effects of miR-302c-3p and miR-520a-3p on CC cells to gain a deeper understanding of CC proliferation and provide a potential target for the treatment of CC.

Materials and methods

Patient samples

In total, 20 patients with recently diagnosed (and previously untreated) CC at the Department of Obstetrics and Gynaecology of The First Affiliated Hospital of Soochow University from July 2016 to August 2017 were selected in a single-centre study and had a median age of 51 years (range, 39–75). The CC tissues and tumour-adjacent tissues were collected from the selected patients following diagnostic evaluation. Written informed consent was obtained from each patient prior to the experiment. The protocols were also approved by the local ethics committee of The First Affiliated Hospital of Soochow University. All the clinical samples collected in the present study are squamous cell carcinoma.

Cell culture

Human CC cell lines (HeLa-S3 and C-33A), immortalized cervical epithelial cell line (H8) and human embryonic kidney cells (293T) were obtained from the Cell Resource Center of the Chinese Academy of Sciences (Shanghai, China). Cells were cultured in DMEM (HyClone, Cytiva) containing 10% foetal bovine serum (Gibco, Thermo Fisher Scientific) and 100 U/ml penicillin/streptomycin (HyClone, Cytiva) in a 37°C constant incubator with 95% air and 5% CO2.

RNA extraction and reverse transcription-quantitative PCR (RT-qPCR)

Total RNA of tissues and cell lines was extracted using the RNeasy Plus Universal Tissue kit (Sangon Biotech Co.) based on the manufacturer's instructions. miRNAs from CC cell lines were extracted using the miRNeasy Mini Kit (Sangon Biotech Co). PCR primers for 25 potentially dysregulated miRNAs and U6 were synthesized by Guangzhou RiboBio.

Primers for CXCL8 and GAPDH were synthesized by Takara (Sangon Biotech Co.) (Table I). cDNA was constructed using the PrimeScript RT reagent kit (Takara Biotechnology Co., Ltd.). Real-time PCR was performed using SYBR premix Ex Taq II (Takara Biotechnology Co., Ltd.), and fluorescence intensity was detected in a Light Cycler 480 system (Roche Applied Science) using the following thermocycling conditions: 95°C for 10 min, 40 cycles of 95°C for 15 sec and 60°C for 1 min. GAPDH was used as the internal control. The comparative Cq (ΔΔCq) method (19) was used to calculate the fold change for each miRNA/mRNA. U6 and GAPDH were treated as internal controls. The following formulas were used to calculate the expression fold changes (X): ΔCq=Cq (target miRNA/mRNA)-Cq (U6/GAPDH), ΔΔCq=ΔCq (target miRNAs/mRNA)-ΔCq (target miRNAs/mRNA), X=2−ΔΔCq.

Table I.

Primers for RT-qPCR.

Table I.

Primers for RT-qPCR.

Gene name Primer sequence (5′→3′)
miR-302c-3pRT primer GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCACTG
Forward GCGTGCTTCCATGTTTCAGTGG
Reverse CAGTGCAGGGTCCGAGGTAT
miR-520a-3pRT primer CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGTCCAAA
Forward ACACTCCAGCTGGGAAAGTGCTTCCC
Reverse CTCAACTGGTGTCGTGGA
CXCL8Forward CAGAGCAACGTGCTCCAAAGTC
Reverse GAAGCGTTGCTGTCGGTTCA
U6Forward CTCGCTTCGGCAGCACA
Reverse AACGCTTCACGAATTTGCGT
GAPDHForward CTGGGCTACACTGAGCACC
Reverse AAGTGGTCGTTGAGGGCAATG

[i] RT-qPCR, reverse transcription-quantitative PCR; miR, microRNA; CXCL8, C-X-C motif ligand 8.

miRNAs, siRNAs and plasmids

Human miR-302c-3p and miR-520a-3p mimics as well as scrambled miR-302c-3p mimics, miR-520a-3p mimics and small interfering RNAs were obtained from Guangzhou RiboBio. A CXCL8 eukaryotic expression vector (CXCL8/pcDNA3.1) was generated by inserting the open reading frame of CXCL8 into pcDNA3.1, using the empty vector as a negative control. For luciferase reporters, the 3′-UTR of CXCL8 was amplified from human genomic DNA before the miR-302c-3p and miR-520a-3p binding sites within the CXCL8 3′-UTR were mutated to remove complementarity. The mutant or wild-type 3′-UTR of CXCL8 were cloned into the psiCHECK-2 luciferase vector (cat. no. 78260; Promega Corporation). All plasmids were confirmed by sequencing.

Cell proliferation assay

Cell counting kit (CCK-8, Merck KGaA) and ethynyl-2-deoxyuridine (EdU, Guangzhou RiboBio) staining were both utilised to measure the proliferation ability of each cell line under different conditions. For the CCK-8 assay, 5×103 cells in 100 µl were transferred to each well of a 96-well plate. Cells were cultured at 37°C before CCK-8 solution (10 µl) was added to each well 24, 48, 72, and 96 h later. Subsequently, the cells were incubated at 37°C for an additional 4 h before OD values (450 nm) were measured using a microplate reader (Bio-Rad Laboratories, Inc.). For the EdU assay, the cells were transfected with miR-302 and miR-520 mimic or inhibitor (100 nM) using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) and incubated with 100 µl of 50 µM EdU per well for 2 h at 37°C. Cells were visualized by fluorescence microscopy and the ratio of EdU/DAPI was calculated to analyse the EdU assay. Experiments were repeated at least three times.

Flow cytometry assay

Cell apoptosis was assessed with the Annexin V-FITC apoptosis detection kit (Elabscience). Flow cytometry was performed with FACSCalibur (BD Biosciences) and all experiments were performed at least three times.

Luciferase assay

The potential direct target genes of miR-302c-3p and miR-520a-3p were predicted by miRTarBase (mirtarbase.mbc.nctu.edu.tw/php/index.php). For the luciferase reporter assays, 293T cells were seeded onto 24-well plates before miR-302c-3p or miR-520a-3p mimics (100 nM) and wild-type or mut-type CXCL8 3′-UTR (1.5 µg) were co-transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). After transfection for 48 h, cells were collected and lysed for luciferase assays. The intensity of luciferase activity was measured using the Dual-Luciferase Reporter Assay System (Promega Corporation). Renilla luciferase was used for normalization. Each experiment was performed at least three times.

Western blot analysis

Whole-cell lysates were prepared using RIPA buffer (Beyotime Institute of Biotechnology). Extracts were mixed with SDS-PAGE loading buffer and denatured by boiling for 5 min. Equal amounts of protein (~30 µg) were separated on 10% SDS-PAGE gels and transferred onto polyvinylidene fluoride (PVDF) membranes (Bio-Rad Laboratories, Inc.). Blots were blocked using 5% bovine serum albumin (BSA, Gibco; Thermo Fisher Scientific, Inc.) for 2 h and incubated overnight at 4°C with primary antibodies against CXCL8 (1:1,000; cat. no. ab154390; Abcam) and β-actin (1:5,000; cat. no. 4970S; Cell Signaling Technology, Inc.). PVDF membranes were washed with Tris-buffered saline (TBS) supplemented with 0.05% Tween-20 before incubation with HRP-conjugated secondary antibody (1:2,000; cat. no. 7074S; Cell Signaling Technology, Inc.) for 2 h at room temperature. Signals were visualized using enhanced chemiluminescence reagents (Thermo Fisher Scientific, Inc.). Densitometric analysis of the blot bands was performed using ImageJ 1.48 software, and the intensity values were normalized against the values of the β-actin loading control. All experiments were performed at least three times.

Statistical analysis

Data were analysed using SPSS software (version 19; IBM Corp.). Continuous data sets are expressed as the mean ± SEM. Comparisons between two groups were analysed using t-tests. One-way ANOVA was used for comparison of three or more groups, with additional post-hoc Tukey's tests to account for multiple comparisons. Statistical analysis of categorical variables was performed using the χ2 test. Correlations between miR-302c-3p and miR-520a-3p expression levels and CC profile and between miR-302c-3p, miR-520a-3p and CXCL8 expression levels were determined by Pearson's linear correlation analysis. P<0.05 was considered to indicate a statistically significant difference.

Results

miR-302c-3p and miR-520a-3p are downregulated in CC cell lines

To investigate the potentially dysregulated miRNAs between clinical CC tissues and tumour-adjacent tissues, RT-qPCR was performed to measure the expression of 25 mature miRNA sequences in both CC tissues and tumour-adjacent tissues (Fig. 1A). Two highly downregulated miRNAs, miR-302c-3p and miR-520a-3p, were notable due to their tumour-suppressing roles in other cancer cells (7,18). Furthermore, the expression of miR-302c-3p and miR-520a-3p was examined in 20 pairs of clinical CC tissues and tumour-adjacent normal tissues. The data showed that miR-302c-3p and miR-520a-3p were downregulated in CC tissues compared with adjacent tissues (Fig. 1B and C; ***P<0.001, **P<0.01). Pearson's linear correlation analysis revealed that miR-302c-3p and miR-520a-3p expression levels in adjacent normal tissues were positively correlated with those in normal tissues (Fig. 1D and E; P=0.0051, P=0.0025). The expression levels of miR-302c-3p and miR-520a-3p were measured in two CC cell lines (HeLa-S3 and C-33A), as well as in the immortalized cervical epithelial cell line H8. It was found that miR-302c-3p and miR-520a-3p were both downregulated in HeLa-S3 and C-33A cells (Fig. 1F-G; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). These results demonstrate that the expressions of miR-302c-3p and miR-520a-3p are downregulated in both CC tissues and cell lines.

miR-302c-3p and miR-520a-3p inhibit the proliferation of CC

miR-302c-3p is reported to inhibit the growth of hepatocellular carcinoma (20), while miR-520a-3p inhibits the proliferation of non-small cell lung cancer cells (18). To investigate whether miR-302c-3p or miR-520a-3p is involved in the proliferation of CC, CCK-8 and EdU assays were performed using cells transfected with mimics or inhibitors of miR-302c-3p and miR-520a-3p. The transfection efficiency of both overexpression and knockdown of miR-302c-3p and miR-520a-3p were verified using RT-qPCR (Figs. 2A and S1A; ****P<0.0001). A significant decrease in cell proliferation was observed in both HeLa-S3 and C-33A cells transfected with miR-302c-3p/miR-520a-3p mimics (Fig. 2B; *P<0.05, **P<0.01), whereas the cells treated with miR-302c-3p and miR-520a-3p inhibitors had increased proliferation (Fig. S1B; **P<0.01) compared with the control groups (blank cells were treated with an equivalent volume of PBS). Co-transfection of miR-302c-3p and miR-520a-3p mimics led to cooperative suppression of cell proliferation, which was greater than that of cells transfected with miR-302c-3p or miR-520a-3p alone. Results consistent with these observations were also obtained from the EdU staining assay (Figs. 2C and S1C; **P<0.01, ****P<0.0001, *P<0.05). Tumour tissue growth requires the rate of cell proliferation to exceed that of cell death; thus, the apoptosis-associated functions of miR-302c-3p and miR-520a-3p were detected using flow cytometry. As expected, both HeLa-S3 and C-33A cells (Fig. 2D; **P<0.01, ****P<0.0001) transfected with miR-302c-3p/miR-520a-3p mimics showed significant increases in cell apoptosis, whereas the cells treated with miR-302c-3p/miR-520a-3p inhibitor showed decreases in cell apoptosis (Fig. S1D; **P<0.01, ****P<0.0001 vs. control). These results demonstrated that miR-302c-3p and miR-520a-3p can suppress the growth and promote the apoptosis of CC cells in an independent or cooperative manner.

CXCL8 is a direct target of miR-302c-3p and miR-520a-3p

To understand the proliferation-suppressive role of miR-302c-3p and miR-520a-3p, the potential target genes of miR-302c-3p and miR-520a-3p were predicted by using miRTarBase. Among the candidates, CXCL8 has been reported to be upregulated in various types of carcinomas (21,22) and contributes to cancer cell proliferation (23,24). Therefore, CXCL8 was selected for further evaluation and RT-qPCR demonstrated that CC tissues had much higher CXCL8 expression than tumour-adjacent tissues (Fig. 3A; ****P<0.0001). Pearson's linear correlation analysis found that CXCL8 was negatively correlated with miR-302c-3p and miR-520a-3p (Fig. 3B; P=0.0002, P=0.0065). Moreover, RT-qPCR measured the relative expressions of CXCL8 and miR-302c-3p/miR-520a-3p, which showed that high expression of miR-302c-3p or miR-520a-3p corresponds to low expression of CXCL8 (Fig. S2A; **P<0.01). RT-qPCR and western blot analysis revealed that the mRNA and protein expression levels of CXCL8 were increased in HeLa-S3 and C-33A cells compared with H8 cells (Fig. 3C; **P<0.01, ***P<0.001). To investigate whether miR-302c-3p and miR-520a-3p regulate CXCL8 expression in CC cells, HeLa-S3 and C-33A cells were transfected with miR-302c-3p and miR-520a-3p mimics before measurement of CXCL8 expression. CXCL8 was downregulated in response to transfection of miR-302c-3p and miR-520a-3p mimics into CC cells (Fig. 3D and E; *P<0.05, **P<0.01). Furthermore, a luciferase reporter assay was performed to identify the binding of CXCL8 with miR-302c-3p or miR-520a-3p. The results revealed that miR-302c-3p mimics and miR-520a-3p mimics inhibited the luciferase reporter activity of the wild-type CXCL8 3′-UTR construct (Fig. 3F; **P<0.01). Collectively, these data indicated that CXCL8 is a direct common target of miR-302c-3p and miR-520a-3p.

CXCL8 promotes the proliferation and decreases the apoptosis of CC cells

As previously described, CXCL8 has been reported to be involved in cell proliferation-promoting and apoptosis-suppressive behaviour in cancerous cells (23,24). To investigate whether CXCL8 is a tumour-related cytokine in HeLa-S3 and C-33A cells, the effect of CXCL8 on CC cell proliferation was detected by the CCK-8 assay. Briefly, the HeLa-S3 and C-33A cell lines were treated with CXCL8 siRNA or negative control (NC) or with pcDNA3.1-CXCL8 or pcDNA3.1, and then both CCK-8 and EdU staining assays were performed. Compared with the levels in cells treated with si-NC, the mRNA and protein levels of CXCL8 were decreased in cells transfected with si-CXCL8, whereas cells treated with pcDNA3.1-CXCL8 (pcDNA3.1 used as control) showed increased expression (Fig. 4A; **P<0.01). The up- and downregulation of CXCL8 correspondingly increased or decreased the proliferation ability of HeLa-S3 and C-33A cells compared with the controls (Figs. 4B and C and S3A; *P<0.05, ****P<0.0001). To investigate whether CXCL8 can decrease CC cell apoptosis, flow cytometry was also performed. A significant decrease in apoptosis was observed in both HeLa-S3 and C-33A cells transfected with pcDNA3.1-CXCL8, whereas the cells treated with si-CXCL8 showed the opposite effects (Figs. 4D and S3B; ***P<0.001, ****P<0.0001).

Downregulation of CXCL8 by miR-302c-3p and miR-520a-3p inhibits CC cell proliferation

To confirm whether CXCL8 downregulation is the mechanism by which miR-302c-3p and miR-520a-3p suppress proliferation and promote apoptosis in CC cells, HeLa-S3 and C-33A cells were co-transfected with pcDNA3.1-CXCL8 or pcDNA3.1 and miR-302c-3p/miR-520a-3p mimics. As expected, restoration of CXCL8 partially blocked the miR-302c-3p and miR-520a-3p-mediated suppression of CC cell proliferation and promotion of apoptosis (Figs. 5A and B and 6; **P<0.01, ***P<0.001, ****P<0.0001, *P<0.05). In summary, these results indicated that CXCL8 is a functional target of miR-302c-3p and miR-520a-3p to suppress the proliferation of CC cells.

Discussion

To the author's best knowledge, the ability of miR-302c-3p and miR-520a-3p to efficiently target CXCL8 and thus modulate the proliferation of CC cells has not been reported before. Although previous studies have revealed that miR-302c-3p can suppress cell proliferation in glioma (7), renal cell carcinoma (8) and hepatocellular carcinoma (9), and miR-520a-3p can suppress cell proliferation in non-small cell lung cancer (18), breast cancer (25) and osteosarcoma (26), the functions of miR-302c-3p and miR-520a-3p in CC are still unknown. In the present study, the expression of miR-302c-3p and miR-520a-3p was measured in CC tissues and adjacent tissues, which revealed that both of these miRs were downregulated in CC cells and tissues. Transfection of CC cells demonstrated that miR-302c-3p and miR-520a-3p could inhibit the proliferation and enhance the apoptosis of CC cells. These results show that miR-302c-3p and miR-520a-3p are important proliferation suppressors and apoptosis promoters in CC.

CXCL8 is upregulated in a variety of solid tumours, including gastric cancer (21), ovarian cancer (27), non-small cell lung cancer (28) and breast cancer (29) and is reported to be relevant to a broad spectrum of biological behaviours of cancer cells, such as increased proliferation (30), invasion (31) and metastasis (32). In addition, CXCL8 has also been reported to be associated with the severity of cervical cancer malignancy (33,34). It has been reported that inhibition of CXCL8 is associated with inhibition of angiogenesis in CC (35). Overexpression of CXCL8 can increase the proliferation and survival of cancer cells through autocrine signalling pathways: MAPK (36,37), focal adhesion kinase and sarcoma signalling (38). Queries about the function of CXCL8 in CC, together with the evidence of the proliferation-promoting activity of CXCL8 in other carcinomas, prompted further investigation of this predicted target gene of miR-302c-3p and miR-520a-3p. In the present study, it was found that CXCL8 is upregulated both in CC cells and clinical CC tissues. Knockdown of CXCL8 attenuated the proliferation and increased the apoptosis of HeLa-S3 and C-33A cells. Importantly, CXCL8 is directly targeted by miR-302c-3p and miR-520a-3p, and the inhibition of cell proliferation induced by miR-302c-3p and miR-520a-3p can be abrogated by CXCL8 overexpression in CC cell lines.

The findings of the present study provide direct evidence that the downregulation of CXCL8 induced by miR-302c-3p and miR-520a-3p results in decreased proliferation and increased apoptosis activity in CC cells. Specifically, it was found that miR-302c-3p and miR-520a-3p synergistically downregulated CXCL8. Members of the primate-specific miRNA family, miR-302c-3p and miR-520-3p share similar seed sequences. Accumulating evidence has indicated that miRNAs may target multiple genes in a coordinated way. Therefore, only a subset of collaborating miRNAs can be identified on the basis of miRNA expression analysis. To explore the full interaction of miRNAs, a more efficient screening method should be performed; however, methods for such studies are currently unavailable. The present study was limited in several aspects, as relevant data concerning migration, invasion and angiogenesis in CC were missing. However, this can be a direction for future work to explore the possible role of both miR-302c-3p and miR-520a-3p in CC.

There are several limitations that are noteworthy. Firstly, in the present study, expression of CXCL8 was lower in C33A cells compared with that in Hela-S3 cells. However, TCGA data show that HPV-positive cases, e.g., Hela cells derived from HPV-positive adenocarcinoma cells, have decreased expression of CXCL8 compared to HPV-negative cases, e.g., C-33A cells derived from HPV-negative squamous cell carcinoma cells. This discrepancy may possibly arise due to the varieties and differences between tumor samples and cell lines in TCGA data. Considering the discrepancy, further measurements and analysis on the expression of CXCL8 among CC cells can form a future study. Secondly, it has been reported that inhibition of CXCL8 is associated with inhibition of angiogenesis (37). In the present study, the effect of miR-302c-3p and miR-520a-3p on proliferation and apoptosis of CC cells was the main focus. Although no related data concerning angiogenesis was mentioned, this could serve as the future direction for study. Moreover, although no relevant data concerning the migration and invasion of CC cells is presented it is a promising direction for future research.

The present study demonstrated that miR-302c-3p and miR-520a-3p were downregulated in CC cell lines and clinical CC tissues. Furthermore, the overexpression of miR-302c-3p and miR-520a-3p suppressed CC cell proliferation and promoted CC cell apoptosis in vitro by targeting CXCL8. The miR-302c/520a-CXCL8 axis deepens the understanding of the mechanisms underlying the proliferation of tumour cells and may provide a potential therapeutic strategy for the targeted treatment of CC. Furthermore, as many studies have documented that CXCL8 is overexpressed in a large set of diseases in advanced stages, suppressing the effects of CXCL8 may have important implications for the systemic treatment of aggressive and metastatic diseases.

Supplementary Material

Supporting Data

Acknowledgements

Not applicable.

Funding

This work was supported by the National Natural Science Foundation of China (grant no. 81672560).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

HMD, HZ and YGC conceptualized the study and designed the experiments. JW and JHZ performed the experiments. FRS, RNJ and JYS analyzed the data. HMD, HZ and JYS provided critical materials. HMD, HZ and JYS wrote the manuscript. YGC supervised the study. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Written informed consent was obtained from all patients prior to the experiment. The protocols were approved by the local ethics committee of The First Affiliated Hospital of Soochow University (approval no. SH20181203).

Patient consent for publication

Not applicable.

Competing interests

The authors declared that they have no competing interests.

References

1 

DiPaolo JA and Alvarez-Salas LM: Advances in the development of therapeutic nucleic acids against cervical cancer. Expert Opin Biol Ther. 4:1251–1264. 2004. View Article : Google Scholar : PubMed/NCBI

2 

Torre LA, Bray F, Siegel RL, Ferlay J, Lortet-Tieulent J and Jemal A: Global cancer statistics, 2012. CA Cancer J Clin. 65:87–108. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

4 

Zhang J, Bai R, Li M, Ye H, Wu C, Wang C, Li S, Tan L, Mai D, Li G, et al: Excessive miR-25-3p maturation via N6-methyladenosine stimulated by cigarette smoke promotes pancreatic cancer progression. Nat Commun. 10:18582019. View Article : Google Scholar : PubMed/NCBI

5 

Frank AC, Ebersberger S, Fink AF, Lampe S, Weigert A, Schmid T, Ebersberger I, Syed SN and Brüne B: Apoptotic tumor cell-derived microRNA-375 uses CD36 to alter the tumor-associated macrophage phenotype. Nat Commun. 10:11352019. View Article : Google Scholar : PubMed/NCBI

6 

Chen Z, Zeng H, Guo Y, Liu P, Pan H, Deng A and Hu J: miRNA-145 inhibits non-small cell lung cancer cell proliferation by targeting c-Myc. J Exp Clin Cancer Res. 29:1512010. View Article : Google Scholar : PubMed/NCBI

7 

Wang Y, Wei Y, Tong H, Chen L, Fan Y, Ji Y, Jia W, Liu D and Wang G: miR-302c-3p suppresses invasion and proliferation of glioma cells via down-regulating metadherin (MTDH) expression. Cancer Biol Ther. 16:1308–1315. 2015. View Article : Google Scholar : PubMed/NCBI

8 

Gu DH, Mao JH, Pan XD, Zhu H, Chen X, Zheng B and Shan Y: microRNA-302c-3p inhibits renal cell carcinoma cell proliferation by targeting Grb2-associated binding 2 (Gab2). Oncotarget. 8:26334–26343. 2017. View Article : Google Scholar : PubMed/NCBI

9 

Yang L, Guo Y, Liu X, Wang T, Tong X, Lei K, Wang J, Huang D and Xu Q: The tumor suppressive miR-302c-3p inhibits migration and invasion of hepatocellular carcinoma cells by targeting TRAF4. J Cancer. 9:2693–2701. 2018. View Article : Google Scholar : PubMed/NCBI

10 

Min D, Lv XB, Wang X, Zhang B, Meng W, Yu F and Hu H: Downregulation of miR-302c and miR-520c by 1,25(OH)2D3 treatment enhances the susceptibility of tumour cells to natural killer cell-mediated cytotoxicity. Br J Cancer. 109:723–730. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Liu Q, Li A, Tian Y, Wu JD, Liu Y, Li T, Chen Y, Han X and Wu K: The CXCL8-CXCR1/2 pathways in cancer. Cytokine Growth Factor Rev. 31:61–71. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Jia L, Li F, Shao M, Zhang W, Zhang C, Zhao X, Luan H, Qi Y, Zhang P, Liang L, et al: IL-8 is upregulated in cervical cancer tissues and is associated with the proliferation and migration of HeLa cervical cancer cells. Oncol Lett. 15:1350–1356. 2018.PubMed/NCBI

13 

Sanguinete MMM, Oliveira PH, Martins-Filho A, Micheli DC, Tavares-Murta BM, Murta EFC and Nomelini RS: Serum IL-6 and IL-8 correlate with prognostic factors in ovarian cancer. Immunol Invest. 46:677–688. 2017. View Article : Google Scholar : PubMed/NCBI

14 

Yung MM, Tang HW, Cai PC, Leung TH, Ngu SF, Chan KK, Xu D, Yang H, Ngan HY and Chan DW: GRO-α and IL-8 enhance ovarian cancer metastatic potential via the CXCR2-mediated TAK1/NFκB signaling cascade. Theranostics. 8:1270–1285. 2018. View Article : Google Scholar : PubMed/NCBI

15 

Qu J, Cheng T, Liu L, Heng J, Liu X, Sun Z, Wang W, Li K and Yang N: Mast cells induce epithelial-to-mesenchymal transition and migration in non-small cell lung cancer through IL-8/Wnt/beta-catenin pathway. J Cancer. 10:55672019. View Article : Google Scholar : PubMed/NCBI

16 

Tang CP, Zhou HJ, Qin J, Luo Y and Zhang T: MicroRNA-520c-3p negatively regulates EMT by targeting IL-8 to suppress the invasion and migration of breast cancer. Oncol Rep. 38:3144–3152. 2017. View Article : Google Scholar : PubMed/NCBI

17 

Mei Q, Xue G, Li X, Wu Z, Li X, Yan H, Guo M, Sun S and Han W: Methylation-induced loss of miR-484 in microsatellite-unstable colorectal cancer promotes both viability and IL-8 production via CD137L. J Pathol. 236:165–174. 2015. View Article : Google Scholar : PubMed/NCBI

18 

Yu J, Tan Q, Deng B, Fang C, Qi D and Wang R: The microRNA-520a-3p inhibits proliferation, apoptosis and metastasis by targeting MAP3K2 in non-small cell lung cancer. Am J Cancer Res. 5:802–811. 2015.PubMed/NCBI

19 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Zhu K, Pan Q, Jia LQ, Dai Z, Ke AW, Zeng HY, Tang ZY, Fan J and Zhou J: miR-302c inhibits tumor growth of hepatocellular carcinoma by suppressing the endothelial-mesenchymal transition of endothelial cells. Sci Rep. 4:55242014. View Article : Google Scholar : PubMed/NCBI

21 

Lin C, He H, Liu H, Li R, Chen Y, Qi Y, Jiang Q, Chen L, Zhang P, Zhang H, et al: Tumour-associated macrophages-derived CXCL8 determines immune evasion through autonomous PD-L1 expression in gastric cancer. Gut. 68:1764–1773. 2019. View Article : Google Scholar : PubMed/NCBI

22 

Jayatilaka H, Tyle P, Chen JJ, Kwak M, Ju J, Kim HJ, Lee JSH, Wu PH, Gilkes DM, Fan R and Wirtz D: Synergistic IL-6 and IL-8 paracrine signalling pathway infers a strategy to inhibit tumour cell migration. Nat Commun. 8:155842017. View Article : Google Scholar : PubMed/NCBI

23 

Li MQ, Luo XZ, Meng YH, Mei J, Zhu XY, Jin LP and Li DJ: CXCL8 enhances proliferation and growth and reduces apoptosis in endometrial stromal cells in an autocrine manner via a CXCR1-triggered PTEN/AKT signal pathway. Hum Reprod. 27:2107–2116. 2012. View Article : Google Scholar : PubMed/NCBI

24 

Zhu YM, Webster SJ, Flower D and Woll PJ: Interleukin-8/CXCL8 is a growth factor for human lung cancer cells. Br J Cancer. 91:1970–1976. 2004. View Article : Google Scholar : PubMed/NCBI

25 

Li J, Wei J, Mei Z, Yin Y, Li Y, Lu M and Jin S: Suppressing role of miR-520a-3p in breast cancer through CCND1 and CD44. Am J Transl Res. 9:146–154. 2017.PubMed/NCBI

26 

Wang X, Xu Y, Chen X and Xiao J: [ARTICLE WITHDRAWN] Dexmedetomidine inhibits osteosarcoma cell proliferation and migration, and promotes apoptosis by regulating miR-520a-3p. Oncol Res. 26:495–502. 2018. View Article : Google Scholar : PubMed/NCBI

27 

Shathasivam P, Kollara A, Spybey T, Park S, Clarke B, Ringuette MJ and Brown TJ: VEPH1 expression decreases vascularisation in ovarian cancer xenografts and inhibits VEGFA and IL8 expression through inhibition of AKT activation. Br J Cancer. 116:1065–1076. 2017. View Article : Google Scholar : PubMed/NCBI

28 

Wang S, Campbell J, Stenmark MH, Zhao J, Stanton P, Matuszak MM, Ten Haken RK and Kong FS: Plasma levels of IL-8 and TGF-β1 predict radiation-induced lung toxicity in non-small cell lung cancer: A validation study. Int J Radiat Oncol Biol Phys. 98:615–621. 2017. View Article : Google Scholar : PubMed/NCBI

29 

Wang Y, Liu J, Jiang Q, Deng J, Xu F, Chen X, Cheng F, Zhang Y, Yao Y, Xia Z, et al: Human adipose-derived mesenchymal stem cell-secreted CXCL1 and CXCL8 facilitate breast tumor growth by promoting angiogenesis. Stem Cells. 35:2060–2070. 2017. View Article : Google Scholar : PubMed/NCBI

30 

Cheng J, Li Y, Liu S, Jiang Y, Ma J, Wan L, Li Q and Pang T: CXCL8 derived from mesenchymal stromal cells supports survival and proliferation of acute myeloid leukemia cells through the PI3K/AKT pathway. FASEB J. 33:4755–4764. 2019. View Article : Google Scholar : PubMed/NCBI

31 

Li X, Wang Y, Wei P, Shi D, Wen S, Wu F, Liu L, Ye N and Zhou H: Bisphenol A affects trophoblast invasion by inhibiting CXCL8 expression in decidual stromal cells. Mol Cell Endocrinol. 470:38–47. 2018. View Article : Google Scholar : PubMed/NCBI

32 

Tong H, Ke JQ, Jiang FZ, Wang XJ, Wang FY, Li YR, Lu W and Wan XP: Tumor-associated macrophage-derived CXCL8 could induce ERα suppression via HOXB13 in endometrial cancer. Cancer Lett. 376:127–136. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Osiagwu DD, Azenabor AE, Osijirin AA, Awopetu PI and Oyegbami FR: Evaluation of interleukin 8 and interleukin 10 cytokines in liquid based cervical cytology samples. Pan Afr Med J. 32:1482019. View Article : Google Scholar : PubMed/NCBI

34 

Yan R, Shuai H, Luo X, Wang X and Guan B: The clinical and prognostic value of CXCL8 in cervical carcinoma patients: Immunohistochemical analysis. Biosci Rep. 37:BSR201710212017. View Article : Google Scholar : PubMed/NCBI

35 

Zhang W, Wu Q, Wang C, Yang L, Liu P and Ma C: AKIP1 promotes angiogenesis and tumor growth by upregulating CXC-chemokines in cervical cancer cells. Mol Cell Biochem. 448:311–320. 2018. View Article : Google Scholar : PubMed/NCBI

36 

Glynn PC, Henney E and Hall IP: The selective CXCR2 antagonist SB272844 blocks interleukin-8 and growth-related oncogene-alpha-mediated inhibition of spontaneous neutrophil apoptosis. Pulm Pharmacol Ther. 15:103–110. 2002. View Article : Google Scholar : PubMed/NCBI

37 

Li A, Dubey S, Varney ML, Dave BJ and Singh RK: IL-8 directly enhanced endothelial cell survival, proliferation, and matrix metalloproteinases production and regulated angiogenesis. J Immunol. 170:3369–3376. 2003. View Article : Google Scholar : PubMed/NCBI

38 

Eitel J, Heise T, Thiesen U and Dersch P: Cell invasion and IL-8 production pathways initiated by YadA of Yersinia pseudotuberculosis require common signalling molecules (FAK, c-Src, Ras) and distinct cell factors. Cell Microbiol. 7:63–77. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

May-2021
Volume 23 Issue 5

Print ISSN: 1791-2997
Online ISSN:1791-3004

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Ding H, Zhang H, Wang J, Zhou J, Shen F, Ji R, Shi J and Chen Y: miR‑302c‑3p and miR‑520a‑3p suppress the proliferation of cervical carcinoma cells by targeting CXCL8. Mol Med Rep 23: 322, 2021.
APA
Ding, H., Zhang, H., Wang, J., Zhou, J., Shen, F., Ji, R. ... Chen, Y. (2021). miR‑302c‑3p and miR‑520a‑3p suppress the proliferation of cervical carcinoma cells by targeting CXCL8. Molecular Medicine Reports, 23, 322. https://doi.org/10.3892/mmr.2021.11961
MLA
Ding, H., Zhang, H., Wang, J., Zhou, J., Shen, F., Ji, R., Shi, J., Chen, Y."miR‑302c‑3p and miR‑520a‑3p suppress the proliferation of cervical carcinoma cells by targeting CXCL8". Molecular Medicine Reports 23.5 (2021): 322.
Chicago
Ding, H., Zhang, H., Wang, J., Zhou, J., Shen, F., Ji, R., Shi, J., Chen, Y."miR‑302c‑3p and miR‑520a‑3p suppress the proliferation of cervical carcinoma cells by targeting CXCL8". Molecular Medicine Reports 23, no. 5 (2021): 322. https://doi.org/10.3892/mmr.2021.11961
a