Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Oncology Letters
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-1074 Online ISSN: 1792-1082
Journal Cover
November-December 2010 Volume 1 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-December 2010 Volume 1 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy

  • Authors:
    • Kouichi Nakazaki
    • Yasumasa Kato
    • Takahide Taguchi
    • Yoshizaki Inayama
    • Yukari Ishiguro
    • Norio Kondo
    • Chouichi Horiuchi
    • Atuko Sakakibara
    • Mamoru Tsukuda
  • View Affiliations / Copyright

    Affiliations: Department of Otorhinolaryngology, Shonan General Hospital, Yokosuka 237-0067, Japan, Department of Oral Function and Molecular Biology, Ohu University School of Dentistry, Tomita-machi, Koriyama 963-8611, Japan, Department of Otorhinolaryngology and Head and Neck Surgery, Yokohama City University School of Medicine, Yokohama 236-0004, Japan, Department of Pathology, Yokohama City University Hospital, Yokohama 236-0004, Japan, Department of Biology and Function in Head and Neck, Yokohama City University Graduate School of Medicine, Yokohama 236-0004, Japan
  • Pages: 1017-1020
    |
    Published online on: September 23, 2010
       https://doi.org/10.3892/ol.2010.188
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Gefitinib (ZD1839, Iressa®) is an orally active agent that inhibits the tyrosine kinase activity of epidermal growth factor receptor (EGFR). Gefitinib has shown a high efficacy in patients with non-small cell lung carcinoma and specific mutations in the ATP-binding pocket of EGFR. These mutations, however, are extremely rare in squamous cell carcinomas of the head and neck (SCCHN). We previously showed that SCCHN cell lines with a heterozygous mutation (G/G→G/A) at nucleotide 2607 of EGFR are more sensitive to gefitinib than wild-type cell lines (79.5% higher IC50). To determine the relationship between the G/G and G/A genotypes, we assessed the EGFR gene copy number and the EGFR mRNA half-life in 16 different SCCHN cell lines. Fluorescence in situ hybridization showed that the EGFR copy number was significantly higher in the nine 2607G/A cell lines than in the seven 2607G/G cell lines (3.59±2.14 vs. 1.58±0.32 copies, a 2.27-fold difference). Similarly, the half life of EGFR mRNA was 2.24-fold higher in cell lines with the 2607G/A genotype than in those with wild-type. By contrast, the EGFR protein levels were inversely correlated with mRNA abundance. These findings suggest that sensitivity to gefitinib of cells with the heterozygous mutation (2607G/G→G/A) was closely associated with gene amplification, the prolongation of mRNA half-life and a decrease in EGFR protein.

Introduction

Epidermal growth factor receptor (EGFR) is a 170-kDa transmembrane glycoprotein receptor that exhibits tyrosine kinase activity, which regulates cell growth. EGFR expression was frequently observed in squamous cell carcinomas of the head and neck (SCCHN) (1). Since EGFR signaling was found to control not only cell growth, but also angiogenesis and DNA repair (2,3), it may be a molecular target in patients with SCCHN (4,5).

Gefitinib (ZD1839, Iressa®), an anilinoquinazoline-based inhibitor specific for EGFR tyrosine kinase, was shown to have clinical efficacy in patients with non-small cell lung carcinoma (NSCLC) (1). Since mutations in the tyrosine kinase domain of the EGFR gene were reported to increase the binding affinity of gefitinib, the presence of EGFR mutations in this domain is predictive of the clinical benefits of gefitinib treatment for NSCLC patients (6,7). Gefitinib has also shown clinical efficacy in some patients without EGFR mutations (4,5). Thus, in such patients, EGFR gene amplifications are critical for gefitinib efficacy (6,7). Previous studies have shown that mutations in the kinase domain of the EGFR gene occur less frequently in SCCHN than in NSCLC (1,4). The clinical efficacy of gefitinib is due not only to its direct action on EGFR tyrosine kinase, but on its indirect action through activation of the immune system (9). For example, to demonstrate the direct action of EGFR tyrosine kinase, it was shown that SCCHN cell lines with heterozygous mutations (G/G→G/A) at nucleotide 2607 of EGFR are more sensitive to gefitinib than wild-type EGFR (4). To further investigate these observations, the mechanism by which the G/A mutation confers sensitivity to gefitinib was examined.

Materials and methods

Cell lines and cell culture

The 16 human SCCHN cell lines and their sites of origin included YCU-M862, YCU-M911 and KCC-M871, from tumors of the mesopharynx; YCU-H891, from a tumor of the hypopharynx; KCC-L871 and YCU-L891, from tumors of the larynx; KCC-T871, YCU-T891, YCU-T892 and KCC-T873, from tumors of the tongue; KCC-TCM902, KCC-TCM903 and KCC-TCM901, from metastatic tumors of 3 tongue carcinomas; KCC-OR891, from tumors of the oral floor; and KCC-MS871 and YCU-MS861, from tumors of the maxillary sinus. The cell lines were maintained in RPMI-1640 supplemented with 10% fetal bovine serum and cultured at 37°C in a humidified atmosphere of 5% CO2/95% air.

Fluorescence in situ hybridization (FISH)

The cells were fixed in carunor solution, placed on glass slides and hybridized with LSI EGFR Dual Color Probe (Abbott Molecular, CA, USA) (1,2). The signals were counted for 60 cells in each cell line and data were expressed as mean ± SD.

mRNA half life

Each cell line was treated with 5 μg/ml actinomycin D (Wako Pure Chemical Industries, Osaka, Japan) and total RNA was purified using Isogen RNA purification kit (Nippon Gene, Tokyo, Japan). Total RNA was then reverse-transcribed to cDNA using avian myeloblastosis virus (AMV) reverse transcriptase (Takara, Tokyo, Japan) and amplified by real-time quantitative PCR (Stratagene® MX3000P; Agilent Technologies, Santa Clara, CA, USA) with Stratagene Brilliant II Fast SYBR® Green QPCR Master Mix (Agilent Technologies). The specific primer sets are shown in Table I. The amplification protocol consisted of 30 cycles of denaturation at 95°C for 30 sec, annealing at 55°C for 1 min and extension at 72°C for 30 sec.

Table I

QPCR primer sets.

Table I

QPCR primer sets.

GenesSequence (5′→3′)
EGFRForward: TTCGATGATCAACTCACGGAAC
Reverse: GCCACCCATATGTACCATCGAT
β-actinForward: CAGCTGAGAGGGAAATCGTG
Reverse: GCTGGTTGCCAATAGTGAATG
Statistical analysis

The groups were compared using paired Student’s t-tests and Chi-square tests. Linear regression analysis was used to compare the EGFR mRNA half life with the EGFR gene copy number, the steady state levels of EGFR mRNA and the EGFR protein levels. P<0.05 was considered to be statistically significant.

Results

EGFR copy number

The 16 SCCHN cell lines were divided into two groups: those heterozygous for the mutation (G/A) at nucleotide 2607 of the EGFR gene (9 cell lines) and those with the wild-type (G/G) sequence (7 cell lines). The mean number of EGFR copies in the cell lines was 3.59±2.14 and 1.58±0.32, respectively (Fig. 1, Table II) (4), or 2.27-fold higher in cell lines with the mutant sequence. It was found that 10 of the 16 cell lines had ≥2 copies of the EGFR gene, whereas the other 6 had <2 copies. The Chi-square test showed a statistically significant correlation between the G/A mutation and EGFR copy number (Table III). The EGFR copy number was significantly higher in YCU-OR891 than in the remaining cell lines.

Figure 1

Status of the EGFR gene in SCCHN cell lines carrying the G/A and G/G genotypes at codon 2607. (A and B) Number of copies of the EGFR gene, as determined by FISH. Representative results are shown. (A) YCU-MS861, 2.02 copies/cell. (B) KCC-TCM903, 1.13 copies/cell. (C and D) EGFR mRNA half-life, determined following the addition of actinomycin D (5 μg/ml). Representative results are shown. (C) KCC-T871, 6 h. (D) YCU-H891, 13 h. (E) Average mRNA half life in the seven cell lines with the G/G genotype and the nine cell lines with the G/A genotype. Error bars indicate SD. *P<0.05.

Table II

A summary of EGFR protein, mRNA, gefitinib IC50 value, SNP, FISH copy number ratio and mRNA half life.

Table II

A summary of EGFR protein, mRNA, gefitinib IC50 value, SNP, FISH copy number ratio and mRNA half life.

Cell lineEGFR proteinaEGFR mRNAIC50 valueaGenotype at 2607bFISH X/YmRNA half life (h)
YCU-MS8610.150.2066.3G/G1.134.3
YCU-M8621.850.5964.8G/G1.335.4
KCC-M8710.460.1052.1G/G1.473.9
KCC-L8710.580.0458.0G/G1.545.6
YCU-T8922.254.4364.8G/G1.683.0
YCU-M9110.950.5561.4G/G1.825.2
KCC-T8732.960.8585.0G/G2.125.6
KCC-TCM9030.380.2551.4G/A2.026.0
KCC-T8710.600.0944.4G/A2.556.0
KCC-TCM9010.770.2543.9G/A2.805.8
YCU-H8910.212.3869.0G/A2.8913.0
YCU-L8910.911.1452.2G/A2.898.5
YCU-T8910.562.4656.0G/A2.8918.0
KCC-MS8710.231.3541.6G/A3.5315.0
KCC-TCM9020.251.1650.2G/A3.6011.2
YCU-OR8910.470.1653.6G/A9.168.5
Average0.851.0057.22.717.8

a Data from Taguchi et al (1).

b SNP, single nucleotide polymorphisms.

Table III

Heterozygous EGFR mutants contain a high copy number of EGFR.

Table III

Heterozygous EGFR mutants contain a high copy number of EGFR.

Copy no.G/GG/A
≥219
<260

[i] Chi-square test, p=0.00044.

Association between EGFR copy number and mRNA half life

Real-time qPCR analysis revealed that the EGFR gene copy number was positively correlated with the steady state levels of EGFR mRNA and the EGFR mRNA half life (Fig. 2C). Notably, the mRNA half life was inversely correlated with EGFR protein concentration (Fig. 2A).

Figure 2

Linear regression analysis between EGFR mRNA half life and (A) EGFR gene copy number, (B) the steady state levels of EGFR mRNA and (C) EGFR protein levels. EGFR mRNA levels were determined following cell culture with actinomycin D (5 μg/ml). The EGFR protein levels were from our previously published results (4).

Discussion

The efficacy of gefitinib in patients with NSCLC was thought to depend on specific EGFR gene mutations as opposed to the concentration of EGFR protein. In particular, mutations in the tyrosine kinase domain, consisting of exons 18–21, were regarded as critical for a response to gefitinib. Dominant mutations or deletions of 2–15 nucleotides between codons 740 and 753 in exon 19 were found to increase the tyrosine kinase inhibitory activity of gefitinib due to conformational changes at the ATP-binding site (4). We found that a number of SCCHN cell lines have the G/A genotype, consisting of a heterozygous G→A transition at nucleotide 2607 in exon 20 of the EGFR gene (4). Cell lines with the G/A genotype were significantly more sensitive to gefitinib (lower IC50 values) than cell lines with the wild-type G/G genotype (P=0.016). We then focused on the relationship between gene expression and sensitivity to gefitinib in vitro. The FISH assay showed that cell lines carrying the G/A mutation have a significantly higher EGFR copy number than wild-type cell lines. Moreover, the steady state levels of EGFR mRNA were higher in cells with the G/A genotype than in those with the G/G genotype, suggesting a close correlation between the EGFR copy number and the steady state levels of EGFR mRNA. Notably, concentrations of EGFR protein were inversely correlated with the EGFR mRNA half life and steady state levels.

The G/A mutation proved to be synonymous, which may be due to impaired translation as opposed to protein instability. Generally, synonymous mutations are thought to be silent. However, cells with the G/A mutation produce less EGFR protein than those with the G/G wild-type, thereby suggesting that the mutation affected the translation rate. A previous study showed that a synonymous GAA to GAG mutation resulted in a 3-fold difference in the rate of translation due to the binding properties of tRNA to each codon (10). Moreover, a silent synonymous mutation in the MDR1 (multidrug resistance 1)/ABCB1 gene, which encodes P-glycoprotein, does not alter the mRNA or protein levels, but affects protein conformation, thereby altering the interaction between the substrate and inhibitor (11). Thus, synonymous mutations may affect mRNA structure and stability, the kinetics of translation and alternative splicing (12). We found that the heterozygous G/G→G/A mutation at codon 2607 of the EGFR gene was correlated with gene amplification, prolongation of EGFR mRNA half life and an increase in the steady state concentrations of EGFR mRNA. Additionally, the mutation was inversely correlated with the EGFR protein level, suggesting that this mutation affects translation efficacy. Although cell lines carrying the G/A mutation were more sensitive to gefitinib, we did not observe a significant correlation between gefitinib IC50 and the EGFR molecular status, including the copy number and the mRNA half life, due to the narrow range of IC50 values in a limited number of cell lines. However, combined with our previous findings, which demonstrated that G/A mutants exhibited a higher sensitivity to gefitinib, the down-regulation of EGFR protein expression, possibly due to a reduced translation efficacy, may be closely associated with gefitinib efficacy. Since the efficacy of gefitinib is thought to be independent of the EGFR protein concentration, but dependent on EGFR mutations in the tyrosine kinase domain, the structure of EGFR protein may have been altered by the synonymous mutation. Further studies are required to clearly determine the relationship between the efficacy of gefitinib and the protein structure of G/A mutants of the EGFR protein.

References

1 

Eisbruch A, Blick M, Lee JS, Sacks PG and Gutterman J: Analysis of the epidermal growth factor receptor gene in fresh human head and neck tumors. Cancer Res. 47:3603–3605. 1987.PubMed/NCBI

2 

Wheeler RH, Spencer S, Buchsbaum D and Robert F: Monoclonal antibodies as potentiators of radiotherapy and chemotherapy in the management of head and neck cancer. Curr Opin Oncol. 11:187–190. 1999. View Article : Google Scholar : PubMed/NCBI

3 

Schlessinger J: Cell signaling by receptor tyrosine kinases. Cell. 103:211–225. 2000. View Article : Google Scholar : PubMed/NCBI

4 

Taguchi T, Tsukuda M, Imagawa-Ishiguro Y, Kato Y and Sano D: Involvement of EGFR in the response of squamous cell carcinoma of the head and neck cell lines to gefitinib. Oncol Rep. 19:65–71. 2008.PubMed/NCBI

5 

Kondo N, Ishiguro Y, Kimura M, Sano D, Fujita K, Sakakibara A, Taguchi T, Toth G, Matsuda H and Tsukuda M: Antitumor effect of gefitinib on head and neck spuamous cell carcinoma enhanced by trastuzumab. Oncol Rep. 20:373–378. 2008.PubMed/NCBI

6 

Paez JG, Janne PA, Lee JC, et al: EGFR mutations in lung cancer: correlation with clinical response to gefitinib therapy. Science. 304:1497–1500. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Lynch TJ, Bell DW, Sordella R, et al: Activating mutations in the epidermal growth factor receptor underlying responsiveness of non-small-cell lung cancer to gefitinib. N Engl J Med. 350:2129–2139. 2004. View Article : Google Scholar : PubMed/NCBI

8 

Helfrich BA, Raben D, Varella-Garcia M, et al: Activating mutations in the epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor gefitinib (ZD 1839, Iressa) in non-small cell lung cancer cell correlates with gene copy number and EGFR mutations but not EGFR protein levels. Clin Cancer Res. 12:7117–7125. 2006. View Article : Google Scholar

9 

Ozawa S, Kato Y, Ito S, Komori R, Shiiki N, Tsukinoki K, Ozono S, Maehata Y, Taguchi T, Imagawa-Ishiguro Y, Tsukuda M, Kubota E and Hata R: Restoration of BRAK/CXCL14 gene expression by gefitinib is associated with antitumor efficacy of the drug in head and neck squamous cell carcinoma. Cancer Sci. 100:2202–2209. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Sorensen MA and Pedersen S: Absolute in vivo translation rates of individual codons in Escherichia coli. The two glutamic acid codons GAA and GAG are translated with a threefold difference in rate. J Mol Biol. 222:265–280. 1991. View Article : Google Scholar : PubMed/NCBI

11 

Kimchi-Sarfaty C, Oh JM, Kim IW, Sauna ZE, Calcagno AM, Ambudkar SV and Gottesman MM: A ‘silent’ polymorphism in the MDR1 gene changes substrate specificity. Science. 315:525–528. 2007.

12 

Sauna ZE, Kimchi-Sarfaty C, Ambudkar SV and Gottesman MM: Silent polymorphisms speak: how they affect pharmacogenomics and the treatment of cancer. Cancer Res. 67:9609–9612. 2007. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Nakazaki K, Kato Y, Taguchi T, Inayama Y, Ishiguro Y, Kondo N, Horiuchi C, Sakakibara A and Tsukuda M: Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy. Oncol Lett 1: 1017-1020, 2010.
APA
Nakazaki, K., Kato, Y., Taguchi, T., Inayama, Y., Ishiguro, Y., Kondo, N. ... Tsukuda, M. (2010). Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy. Oncology Letters, 1, 1017-1020. https://doi.org/10.3892/ol.2010.188
MLA
Nakazaki, K., Kato, Y., Taguchi, T., Inayama, Y., Ishiguro, Y., Kondo, N., Horiuchi, C., Sakakibara, A., Tsukuda, M."Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy". Oncology Letters 1.6 (2010): 1017-1020.
Chicago
Nakazaki, K., Kato, Y., Taguchi, T., Inayama, Y., Ishiguro, Y., Kondo, N., Horiuchi, C., Sakakibara, A., Tsukuda, M."Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy". Oncology Letters 1, no. 6 (2010): 1017-1020. https://doi.org/10.3892/ol.2010.188
Copy and paste a formatted citation
x
Spandidos Publications style
Nakazaki K, Kato Y, Taguchi T, Inayama Y, Ishiguro Y, Kondo N, Horiuchi C, Sakakibara A and Tsukuda M: Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy. Oncol Lett 1: 1017-1020, 2010.
APA
Nakazaki, K., Kato, Y., Taguchi, T., Inayama, Y., Ishiguro, Y., Kondo, N. ... Tsukuda, M. (2010). Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy. Oncology Letters, 1, 1017-1020. https://doi.org/10.3892/ol.2010.188
MLA
Nakazaki, K., Kato, Y., Taguchi, T., Inayama, Y., Ishiguro, Y., Kondo, N., Horiuchi, C., Sakakibara, A., Tsukuda, M."Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy". Oncology Letters 1.6 (2010): 1017-1020.
Chicago
Nakazaki, K., Kato, Y., Taguchi, T., Inayama, Y., Ishiguro, Y., Kondo, N., Horiuchi, C., Sakakibara, A., Tsukuda, M."Heterozygous mutation (G/G→G/A) at nt 2607 of the EGFR gene is closely associated with increases in EGFR copy number and mRNA half life, but impaired EGFR protein synthesis in squamous cell carcinomas of the head and neck – implication for gefitinib efficacy". Oncology Letters 1, no. 6 (2010): 1017-1020. https://doi.org/10.3892/ol.2010.188
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team