Open Access

Grape seed proanthocyanidins induce mitochondrial pathway‑mediated apoptosis in human colorectal carcinoma cells

  • Authors:
    • Chen Zhang
    • Weili Chen
    • Xuhao Zhang
    • Yanbing Zheng
    • Fengli Yu
    • Yulong Liu
    • Yi Wang
  • View Affiliations

  • Published online on: September 18, 2017     https://doi.org/10.3892/ol.2017.6992
  • Pages: 5853-5860
  • Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.

Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Grape seed proanthocyanidins (GSPs) have been reported to possess a wide array of pharmacological and biochemical properties. Recently, GSPs have been reported to inhibit various types of colorectal cancer; however, the mechanism(s) involved remain unclear. The present study investigated the effects of GSPs on HCT‑116 human colorectal carcinoma cell line. Exposure of these cells to GSPs for 48 h resulted in a significant concentration‑dependent inhibition of cell viability. Further investigation indicated that GSPs induced apoptosis of these cells. Analyses of mRNA expression levels using reverse transcription‑quantitative polymerase chain reaction and protein expression levels by western blotting revealed that this was associated with increased expression levels of p53 tumor suppressor protein, cytochrome c, and pro‑apoptotic proteins, apoptosis regulator Bax (Bax) and Bcl‑2 homologous antagonist/killer. Furthermore, decreased expression levels of the anti‑apoptotic protein, B cell lymphoma‑2 and activation of caspase‑2, caspase‑3 and caspase‑9 were demonstrated. GSP‑induced loss of mitochondrial membrane potential was also detected by JC‑1 assay. These findings suggested that GSPs induced colon cancer cell apoptosis via the mitochondrial signaling pathway. This provided evidence indicating that GSPs may provide potential chemotherapeutic agents for colorectal cancer.

Introduction

Colorectal cancer (CRC) is a type of cancer that is most associated with dietary factors, and has the third highest mortality rate of common malignancies in males and females (13). Due to the continued urbanization of the population, the morbidity and mortality rates associated with CRC are increasing gradually worldwide. In addition to genetic factors, eating habits and environmental factors markedly influence the relative risk for the occurrence, and development of colon cancer (4,5). Although CRC incidence rates have decreased to a certain degree, there is certain evidence indicating that current therapies are expensive and induce debilitating side effects; in addition, recurrence rates of >50% have been reported, primarily due to the development of acquired chemoresistance to conventional chemotherapeutic regimens (6,7).

Grape seeds are an effective source of proanthocyanidins (8). Grape seed proanthocyanidins (GSPs) are primarily composed of dimers, trimers and oligomers of monomeric anthocyanidin (9,10). There are a number of biological functions of GSPs, including antimutagenic, anti-inflammatory, anti-angiogenic and anticarcinogenic activities (1115). Previous studies have demonstrated that GSPs have cytotoxic effects in numerous cancer cell lines; however, the mechanisms underlying these anticancer effects remain uncharacterized (1618).

Apoptosis, or programmed cell death, serves a key role in regulating the development and growth of normal cells, and is often dysregulated in cancer cells (19). p53, the tumor suppressor protein, serves an essential role in apoptosis and acts as a suppressor of transformation (20,21), in addition, the expression level of p53 has been revealed to be induced by DNA damage (22). In turn, p53 orchestrates a global transcriptional response that counters cell proliferation or induces apoptosis (2325). GSPs have been demonstrated to protect against stress-induced changes in the expression levels of p53 and the anti-apoptotic protein, B cell lymphoma-2 (Bcl-2), in human oral epithelial (26), and liver (27) cells. The Bcl-2 family of proteins consists of pro- and anti-apoptotic regulators of apoptosis. The established mode of action of each separate entity involves protecting or disrupting mitochondrial integrity, thereby activating, or inhibiting the release of downstream factors, including cytochrome c from the mitochondrion; these stimulate apoptosis (28). The apoptosis regulator Bax (Bax) and Bcl-2 homologous antagonist/killer (Bak) genes encode apoptosis-promoting members of the Bcl-2 gene family. The Bcl-2 protein is known to form heterodimers with the Bax protein in vivo and the molar ratio of Bcl-2 to Bax determines whether apoptosis is induced or inhibited in target tissues (29). The Bax protein, considered to be one of the primary targets of p53, controls cell death by its participation in the disruption of mitochondria and the subsequent release of cytochrome c (30). Bak also regulates the release of cytochrome c. Cytochrome c release, in turn, activates caspase-9 and −3 (31). Cleaved caspase-3 is regarded as a proximate mediator of apoptosis, whereas caspase-2 triggered Bax-Bak-dependent and -independent cell death in colon cancer cells treated with resveratrol (32). Caspase family proteins serve a key role in the downstream events involved in p53-mediated apoptosis (33). Clustering of the initiator caspases activates the effector caspases, which trigger apoptosis (34).

The present study investigated the molecular mechanisms underlying GSP-induced apoptosis in the HCT-116 colon cancer cell line. Exposure of these cells to various concentrations of GSPs resulted in profound changes in morphology, proliferation and apoptosis. The present study investigated the involvement of p53, cytochrome c, Bcl-2 family proteins and caspases in this process, and the results indicated that GSPs may provide a novel approach to the treatment of CRC.

Materials and methods

Cell lines and culture

The HCT-116 human CRC cell line (Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China) was cultured with McCoy's 5A (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) supplemented with 10% (vol/vol) heat-inactivated fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 IU penicillin and 100 µg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.) in a humidified incubator at 37°C in 5% CO2. The HF-91 human fibroblast cell line (Type Culture Collection of the Chinese Academy of Sciences) was cultured in DEME/H (Sigma-Aldrich; Merck KGaA) supplemented with 10% (vol/vol) heat-inactivated FBS (Gibco; Thermo Fisher Scientific, Inc.), 100 IU penicillin and 100 µg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.) in a humidified incubator at 37°C in 5% CO2. HCT-116 and HF-91 cells were plated in 96-well cell culture plates at 5×103 cells/well, and incubated for 24 h. Triplicate wells were then treated with GSPs at various concentrations (25, 50 or 100 µg/ml), 25 µg/ml 5-fluorouracil (5-Fu) as a positive control or PBS as the negative solvent control for 48 h prior to the analyses described below.

Reagents and antibodies

GSPs were purchased from Sigma-Aldrich (Merck KGaA; 20315-25-7). The antibodies used for western blotting were as follows: Mouse anti-caspase-2 (sc-5292), mouse anti-caspase-3 (sc-7272), mouse anti-caspase-9 (sc-56073), mouse anti-Bcl-2 (sc-7382), mouse anti-Bax (sc-20067), mouse anti-β-actin (sc-47778), rabbit anti-Bak (sc-7873), rabbit anti-mouse IgG-horseradish peroxidase (HRP; sc-358914) and mouse anti-rabbit IgG-HRP (sc-2357). All antibodies were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA).

Cell viability

HCT-116 and HF-91 cells were plated in 96-well cell culture plates at 5×103 cells/well and incubated for 24 h at 37°C. Triplicate wells were then treated with GSPs at various concentrations (25, 50 or 100 µg/ml), 25 µg/ml 5-Fu as a positive control or PBS as the negative solvent control. Cell viability was determined after 48 h by adding 10 µl (5 mg/ml) cell proliferation reagent (MTT; Sigma-Aldrich; Merck KGaA) and incubating for 24 h at 37°C until a purple precipitate was visible. The precipitate was then solubilized by adding dimethyl sulfoxide (Sigma-Aldrich; Merck KGaA). The absorbance was evaluated at 570 nm using a microplate reader. The percentage inhibition of cell viability was determined using the following formula: Percentage inhibition=1-optical density (OD)treatment group/ODsolvent control ×100%.

Annexin V analysis

Annexin V and fluorescein isothiocyanate (FITC) staining was performed using a commercial Annexin V-FITC kit (BD Biosciences, Franklin Lakes, NJ, USA). Briefly, cells were treated with GSPs (25, 50 or 100 µg/ml), 25 µg/ml 5-Fu as a positive control or PBS as a solvent control for 48 h. The cells were then harvested, washed twice with cold PBS and resuspended in binding buffer at a concentration of 5×105 cells/ml. A 100-µl aliquot containing 5×104 cells was incubated in the dark with 5 µl Annexin V-FITC and 5 µl propidium iodide (PI) at room temperature for 15 min. Subsequently, 400 µl binding buffer was added and the cells were viewed (5 fields for each group) using a fluorescence microscope (Olympus Corporation, Tokyo, Japan) at magnification ×400. Viable cells were stained green and apoptotic cells were stained red. This experiment was repeated three times.

JC-1 assay

JC-1 analysis was performed using a commercial Mitochondrial Membrane Potential Detection JC-1 kit (BD Biosciences). Briefly, cells were treated with GSPs (25, 50 or 100 µg/ml), 25 µg/ml 5-Fu as a positive control or PBS as a solvent control for 48 h prior to harvesting, washing twice with cold PBS and resuspending in binding buffer at a concentration of 1×106 cells/ml. A 100-µl aliquot was incubated with 5 µl JC-1 and 5 µl PI in the dark at room temperature for 15 min. Subsequently, 400 µl binding buffer was added and the cells were analyzed using a flow cytometer (Beckman Coulter, Inc., Brea, CA, USA). Cells negative for JC-1 and PI were considered to be viable; JC-1+/PI+ cells were in early apoptosis; JC-1+/PI- cells were necrotic or in late apoptosis. This experiment was repeated three times.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from treated cells using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.). First-strand cDNA was reverse transcribed using the PrimeScript™ RT reagent kit (Takara Bio, Inc., Otsu, Japan), in accordance with the manufacturer's protocols. Relative expression levels of mRNA were determined by qPCR using the primer sequences presented in Table I and a Thermo® PikoReal 96 system (Thermo Fisher Scientific., Inc.). GAPDH was used as the endogenous reference gene. cDNA was subjected to 40 PCR cycles of 94°C for 30 sec, 60°C for 30 sec and 72°C for 45 sec using FastStart Universal SYBR Green Master (Roche Diagnostics, Basel, Switzerland). Experiments were performed in triplicate and data were analyzed using Pikoreal software version 2.1. The average cycle threshold (Cq) values of the target genes were normalized to GAPDH gene expression level as 2−ΔΔCq (35). Changes in expression levels were presented either as fold increases or as the ratio of the target gene expression in the treated cells to its expression level in the control cells.

Table I.

Quantitative polymerase chain reaction primer sequences.

Table I.

Quantitative polymerase chain reaction primer sequences.

GenePrimer sequence (5′-3′)
Bcl-2Forward: CATGTGTGTGGAGAGCGTCAA
Reverse: GCCGGTTCAGGTACTCAGTCA
BaxForward: GATCCAGGATCGAGCAGA
Reverse: AAGTAGAAGAGGGCAACCAC
BakForward: AGATAGATAGCAGTAGTGCCTCA
Reverse: ATTGCCAGTAGAAGCTCTCATGGTT
Caspase-2Forward: CAAGTTCCTGAGCCTGGACTACATT
Reverse: GACAGATTGCTTTCCTCCAACATT
Caspase-3Forward: CAGAACTGGACTGTGGCATTGAG
Reverse: GGATGAACCAGGAGCCATCCT
Caspase-9Forward: GCGAACTAACAGGCAAGCAGC
Reverse: CGACATCACCAAATCCTCCAGAAC
Cytochrome CForward: GGTCAACAAATCATAAAGATATTGG
Reverse: TAAACTTCAGGGTGACCAATAAATCA
p53Forward: GCGGACTAACAGGCAAGCAAC
Reverse: CTCGTTTATACTCCTCCAGAAC
GAPDHForward: CGGAGTCAACGGATTTGGTCGTAT
Reverse: AGCCTTCTCCATGGTTGGTGAAGAC

[i] BCL-2, B cell lymphoma-2; Bak, Bcl-2 homologous antagonist/killer; Bax, apoptosis regulator Bax.

Western blotting

Six proteins involved in apoptosis (caspase-2, caspase-3, caspase-9, Bcl-2, Bak and Bax) were analyzed by western blotting. HCT-116 cells were exposed to GSPs (25, 50 or 100 µg/ml) at a concentration of 5×105 cells/well for 48 h in 6-well plates, harvested and lysed in RIPA buffer (Pierce; Thermo Fisher Scientific, Inc.). Following a 30-min incubation on ice, the cell lysate was centrifuged at 10,000 × g at 4°C for 5 min and the supernatants were stored at −80°C until use. The protein concentrations were determined using the Bradford assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Proteins (30 µg) were separated by 12% SDS-PAGE, transferred to polyvinyl difluoride membranes (EMD Millipore, Billerica, MA, USA) and blocked using 5% non-fat dry milk in Tris-buffered saline (TBS) for 2 h at room temperature. The membranes were then incubated with 1:1,000 dilutions of the aforementioned primary antibodies in TBS overnight at 4°C, washed three times with TBS-Tween-20 and incubated with 1:5,000 dilutions of the appropriate secondary antibodies conjugated with HRP in TBS for 1 h at room temperature. Membranes were washed three times in TBS-Tween-20 at room temperature. Protein bands were visualized on X-ray film using an enhanced chemiluminescence (GE Healthcare, Chicago, IL, USA) detection system. Western blotting bands were quantified using the Odyssey infrared imaging system version 1.2 (LI-COR Biosciences, Lincoln, NE, USA).

Statistical analysis

Data are presented as the mean ± standard deviations and all analyses were performed using Origin8 version 8.1.10.86 SRO (Origin8 Technologies Ltd., London, UK). Statistical significance was evaluated using two-way analysis of variance and Tukey's post hoc test. P<0.05 was considered to indicate a statistically significant difference.

Results

Effect of GSPs on HCT-116 cell viability and apoptosis

MTT assays of HCT-116 and HF-91 cells treated with GSPs (25, 50 or 100 µg/ml), 5-Fu (25 µg/ml) or solvent control indicated that GSPs reduced HCT-116 cell viability in a concentration-dependent manner, whereas the inhibition of GSPs in HF-91 cells was significantly lower compared with that in 5-Fu-treated cells (P<0.01; Fig. 1A). HCT-116 cells exposed to GSPs demonstrated cell shrinkage and membrane blebbing (Fig. 1B). Annexin V/PI double staining of the treated and untreated cells revealed GSP concentration-dependent formation of apoptotic bodies in HCT-116 cells (Fig. 2).

GSP-mediated effects on p53, caspases and the Bcl-2 family

In the present study, the expression levels of p53 and cytochrome c increased in GSP-treated cells. Significant overexpression was observed in HCT-116 cells exposed to 100 µg/ml GSPs compared with 5-Fu, but not in those treated with lower concentrations of GSPs or with PBS (negative control; Fig. 3).

Considering the significance of caspases to apoptosis, the present study determines the mRNA and protein expression levels of initiator caspases (caspase-2 and −9) and an effector caspase (caspase-3). Upregulation of the mRNAs encoding caspase-2, caspase-3 and caspase-9 were observed in HCT-116 cells exposed to GSPs for 48 h (Fig. 4A). Furthermore, the expression levels of cleaved caspase-2, caspase-3 and caspase-9 protein were also significantly increased in cells exposed to 100 µg/ml GSPs compared with 5-Fu for 48 h (Fig. 4B and C).

To further investigate the mechanism underlying GSP-induced apoptosis, the present study evaluated the mRNA and protein expression levels of Bcl-2, Bax and Bak by qPCR, and western blotting. The Bcl-2 expression level in 100 µg/ml GSPs group was significantly reduced compared with 5-Fu, whereas the expression levels of Bax and Bak were upregulated in HCT-116 cells exposed to GSPs for 48 h (Fig. 5A-C).

GSPs induce apoptosis via the mitochondrial pathway

Caspase-9 is involved in the mitochondrial apoptosis pathway and an increased expression level of cleaved caspase-9 therefore implied mitochondrial involvement in GSPs-induced apoptosis. JC-1 staining revealed that the percentage of cells with a loss of mitochondrial membrane potential increased from 18.7% in the negative control cells to 80.1% in the HCT-116 cells exposed to 100 µg/ml GSPs (Fig. 6A). The percentage of apoptotic cells observed in Fig. 6A is summarized in Fig. 6B. This loss of mitochondrial membrane potential, coupled with the observed increase in cleaved caspase-9, suggested that GSPs induced HCT-116 cell death via the mitochondrial apoptosis pathway.

Discussion

GSPs are observed in dietary botanical supplements and these compounds have been revealed to have anticarcinogenic properties (1218,36). However, the molecular mechanisms underlying their effects in CRC are not clearly understood.

The cell proliferation inhibitory results in the present study regarding GSP treatment on the CRC cell line (HCT-116) are in agreement with the concentration-dependent effects reported for cyanidin on human colon cancer cell lines HCT-15 and HT-29 (37,38). However, GSPs revealed more active inhibition compared with cyanidin on colon cancer cells. This was accompanied by early and late apoptosis, and necrosis, observed using fluorescence microscopy and flow cytometry (37,38). A series of experimental evidence suggested that GSPs are associated with the p53-induced mitochondrial apoptosis pathway, and involved with the Bcl-2 and caspase families (39). The Bcl-2 family consists of pro- and anti-apoptotic members that are associated with opposing effects on mitochondria. Bax and Bak regulate the release of cytochrome c, and the enhancement of cytochrome c activates caspase-2, −3 and −9 (31,32). Caspase family proteins serve a key role in the regulation of p53-mediated apoptosis (33). Bax is a p53 target and a pro-apoptotic member of the Bcl-2 family of proteins (40,41). Repression of anti-apoptotic members, including Bcl-2 and Bcl-xL, which are transcriptionally suppressed by p53 (42), preserves the integrity of the mitochondria. The present study demonstrated that GSPs upregulated the pro-apoptotic proteins (Bax and Bak) and caspase family proteins (caspase-2, −3 and −9), and downregulated the anti-apoptotic protein Bcl-2 in HCT-116 cells. It was observed that the increased expression level of Bcl-2 induced the decrease of mitochondrial potential and eventually lead to apoptosis (43). The results of the present study revealed that GSPs mediated the reduction of the mitochondrial membrane potential in a concentration-dependent manner. Based on these results, Fig. 7 presents a schematic of the proposed molecular mechanisms underlying these effects of GSPs. Exposure to GSPs activated cleavage of caspase-2, caspase-3 and caspase-9 in HCT-116 cells, induced p53-mediated mitochondrial apoptosis signaling pathway with a concentration-dependent decrease in the expression level of the survival protein Bcl-2, and increased the expression level of the pro-apoptotic proteins, Bax and Bak.

In conclusion, GSPs modulated the expression level and activation of numerous genes and proteins involved in the mitochondrial apoptotic pathway. These results proposed that GSPs prompted colon cancer cell apoptosis via the mitochondrial pathway and provided evidence demonstrating that GSPs may postulate potential chemotherapeutic agents for colorectal cancer.

Acknowledgements

The present study was supported by the Heilongjiang Province Science Foundation, China (grant no. H201380).

References

1 

Jemal A, Center MM, Ward E and Thun MJ: Cancer occurrence. Methods Mol Biol. 471:3–29. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D: Global cancer statistics. CA Cancer J Clin. 61:69–90. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Jemal A, Siegel R, Xu J and Ward E: Cancer statistics, 2010. CA Cancer J Clin. 60:277–300. 2010. View Article : Google Scholar : PubMed/NCBI

4 

Markowitz SD and Bertagnolli MM: Molecular origins of cancer: Molecular basis of colorectal cancer. N Engl J Med. 361:2449–2460. 2009. View Article : Google Scholar : PubMed/NCBI

5 

Wang X, Lu N, Yang Q, Gong D, Lin C, Zhang S, Xi M, Gao Y, Wei L, Guo Q and You Q: Studies on chemical modification and biology of a natural product, gambogic acid (III): Determination of the essential pharmacophore for biological activity. Eur J Med Chem. 46:1280–1290. 2011. View Article : Google Scholar : PubMed/NCBI

6 

Zhang N, Yin Y, Xu SJ and Chen WS: 5-Fluorouracil: Mechanisms of resistance and reversal strategies. Molecules. 13:1551–1569. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Jiang WQ, Fu FF, Li YX, Wang WB, Wang HH, Jiang HP and Teng LS: Molecular biomarkers of colorectal cancer: Prognostic and predictive tools for clinical practice. J Zhejiang Univ Sci B. 13:663–675. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Mantena SK, Baliga MS and Katiyar SK: Grape seed proanthocyanidins induce apoptosis and inhibit metastasis of highly metastatic breast carcinoma cells. Carcinogenesis. 27:1682–1691. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Silva RC, Cheynier V and Chemina A: Procyanidin dimers and trimers from grape seeds. Phytochemistry. 30:1259–1264. 1991. View Article : Google Scholar

10 

Prieur C, Rigaud J, Cheynier V and Moutounet M: Oligomeric and polymeric procyanidins from grape seeds. Phytochemistry. 36:781–789. 1994. View Article : Google Scholar

11 

Vayalil PK, Mittal A and Katiyar SK: Proanthocyanidins from grape seeds inhibit expression of matrix metalloproteinases in human prostate carcinoma cells, which is associated with the inhibition of activation of MAPK and NF kappa B. Carcinogenesis. 25:987–995. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Singh RP, Tyagi AK, Dhanalakshmi S, Agarwal R and Agarwal C: Grape seed extract inhibits advanced human prostate tumor growth and angiogenesis and upregulates insulin-like growth factor binding protein-3. Int J Cancer. 108:733–740. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Agarwal C, Singh RP, Dhanalakshmi S and Agarwal R: Anti-angiogenic efficacy of grape seed extract in endothelial cells. Oncol Rep. 11:681–685. 2004.PubMed/NCBI

14 

Mittal A, Elmets CA and Katiyar SK: Dietary feeding of proanthocyanidins from grape seeds prevents photocarcinogenesis in SKH-1 hairless mice: Relationship to decreased fat and lipid peroxidation. Carcinogenesis. 24:1379–1388. 2003. View Article : Google Scholar : PubMed/NCBI

15 

Shi J, Yu J, Pohorly J and Kakuda Y: Polyphenolics in grape seeds-biochemistry and functionality. J Med Food. 6:291–299. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Bagchi D, Bagchi M, Stohs S, Ray SD, Sen CK and Preuss HG: Cellular protection with proanthocyanidins derived from grape seeds. Ann N Y Acad Sci. 957:260–270. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Tyagi A, Agarwal R and Agarwal C: Grape seed extract inhibits EGF-induced and constitutively active mitogenic signaling but activates JNK in human prostate carcinoma DU145 cells: Possible role in anti-proliferation and apoptosis. Oncogene. 22:1302–1316. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Sharma G, Tyagi AK, Singh RP, Chan DC and Agarwal R: Synergistic anti-cancer effects of grape seed extract and conventional cytotoxic agent doxorubicin against human breast carcinoma cells. Breast Cancer Res Treat. 85:1–12. 2004. View Article : Google Scholar : PubMed/NCBI

19 

Wang LS and Stoner GD: Anthocyanins and their role in cancer prevention. Cancer Lett. 269:281–290. 2008. View Article : Google Scholar : PubMed/NCBI

20 

Finlay CA, Hinds PW and Levine AJ: The p53 proto-oncogene can act as a suppressor of transformation. Cell. 57:1083–1093. 1989. View Article : Google Scholar : PubMed/NCBI

21 

Karpinich NO, Tafani M, Rothman RJ, Russo MA and Farber JL: The course of etoposide induced apoptosis from damage to DNA and p53 activation to mitochondrial release of cytochrome c. J Biol Chem. 277:16547–16552. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Kastan MB, Onyekwere O, Sidransky D, Vogelstein B and Craig RW: Participation of p53 protein in the cellular response to DNA damage. Cancer Res. 51:6304–6311. 1991.PubMed/NCBI

23 

Sherr CJ: Principles of tumor suppression. Cell. 116:235–246. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Mercer WE, Shields MT, Amin M, Sauve GJ, Appella E, Romano JW and Ullrich SJ: Negative growth regulation in a glioblastoma tumor cell line that conditionally expresses human wild-type p53. Proc Natl Acad Sci USA. 87:6166–6170. 1990. View Article : Google Scholar : PubMed/NCBI

25 

Baker SJ, Markowitz S, Fearon ER, Willson JK and Vogelstein B: Suppression of human colorectal carcinoma cell growth by wild-type p53. Science. 249:912–915. 1990. View Article : Google Scholar : PubMed/NCBI

26 

Bagchi M, Kuszynski CA, Balmoori J, Joshi SS, Stohs SJ and Bagchi D: Protective effects of antioxidants against smokeless tobacco-induced oxidative stress and modulation of Bcl-2 and p53 genes in human oral keratinocytes. Free Radic Res. 35:181–194. 2001. View Article : Google Scholar : PubMed/NCBI

27 

Joshi SS, Kuszynski CA and Bagchi D: The cellular and molecular basis of health benefits of grape seed proanthocyanidin extract. Curr Pharm Biotechnol. 2:187–200. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Jia G, Wang Q, Wang R, Deng D, Xue L, Shao N, Zhang Y, Xia X, Zhi F and Yang Y: Tubeimoside-1 induces glioma apoptosis through regulation of Bax/Bcl-2 and the ROS/Cytochrome C/Caspase-3 pathway. Onco Targets Ther. 8:303–311. 2015.PubMed/NCBI

29 

Oltvai ZN, Milliman CL and Korsmeyer SJ: Bcl-2 heterodimerizes in vivo with a conserved homolog, Bax, that accelerates programmed cell death. Cell. 74:609–619. 1993. View Article : Google Scholar : PubMed/NCBI

30 

Marzo I, Brenner C, Zamzami N, Jürgensmeier JM, Susin SA, Vieira HL, Prévost MC, Xie Z, Matsuyama S, Reed JC and Kroemer G: Bax and adenine nucleotide translocator cooperate in the mitochondrial control of apoptosis. Science. 281:2027–2031. 1998. View Article : Google Scholar : PubMed/NCBI

31 

Wang X: The expanding role of mitochondria in apoptosis. Genes Dev. 15:2922–2933. 2001.PubMed/NCBI

32 

Mohan J, Gandhi AA, Bhavya BC, Rashmi R, Karunagaran D, Indu R and Santhoshkumar TR: Caspase-2 triggers Bax-Bak-dependent and -independent cell death in colon cancer cells treated with resveratrol. J Biol Chem. 281:17559–17611. 2006. View Article : Google Scholar : PubMed/NCBI

33 

Tian Z, Shen J, Moseman AP, Yang Q, Yang J, Xiao P, Wu E and Kohane IS: Dulxanthone A induces cell cycle arrest and apoptosis via up-regulation of p53 through mitochondrial pathway in HepG2 cells. Int J Cancer. 122:31–38. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Budihardjo I, Oliver H, Lutter M, Luo X and Wang X: Biochemical pathways of caspase activation during apoptosis. Annu Rev Cell Dev Biol. 15:269–290. 1999. View Article : Google Scholar : PubMed/NCBI

35 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

36 

Zhao J, Wang J, Chen Y and Agarwal R: Anti-tumor-promoting activity of a polyphenolic fraction isolated from grape seeds in the mouse skin two-stage initiation-promotion protocol and identification of procyanidin B5-3′-gallate as the most effective antioxidant constituent. Carcinogenesis. 20:1737–1745. 1999. View Article : Google Scholar : PubMed/NCBI

37 

Kamei H, Hashimoto Y, Koide T, Kojima T and Hasegawa M: Anti-tumor effect of methanol extracts from red and white wines. Cancer Biother Radiopharm. 13:447–452. 1998. View Article : Google Scholar : PubMed/NCBI

38 

Kang SY, Seeram NP, Nair MG and Bourquin LD: Tart cherry anthocyanins inhibit tumor development in ApcMin mice and reduce proliferation of human colon cancer cells. Cancer Letts. 194:13–19. 2003. View Article : Google Scholar

39 

Roy AM, Baliga MS, Elmets CA and Katiyar SK: Grape seed proanthocyanidins induce apoptosis through p53, Bax, and caspase 3 pathways. Neoplasia. 7:24–36. 2005. View Article : Google Scholar : PubMed/NCBI

40 

McCurrach ME, Connor TM, Knudson CM, Korsmeyer SJ and Lowe SW: Bax-deficiency promotes drug resistance and oncogenic transformation by attenuating p53-dependent apoptosis. Proc Natl Acad. 94:2345–2349. 1997. View Article : Google Scholar

41 

Yin C, Knudson CM, Korsmeyer SJ and Van Dyke T: Bax suppresses tumorigenesis and stimulates apoptosis in vivo. Nature. 385:637–640. 1997. View Article : Google Scholar : PubMed/NCBI

42 

Ryan KM, Phillips AC and Vousden KH: Regulation and function of the p53 tumor suppressor protein. Curr Opin Cell Biol. 13:332–337. 2001. View Article : Google Scholar : PubMed/NCBI

43 

Shih PH, Yeh CT and Yen GC: Effects of anthocyanidin on the inhibition of proliferation and induction of apoptosis in human gastric adenocarcinoma cells. Food Chem Toxicol. 43:1557–1566. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

November-2017
Volume 14 Issue 5

Print ISSN: 1792-1074
Online ISSN:1792-1082

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Zhang C, Chen W, Zhang X, Zheng Y, Yu F, Liu Y and Wang Y: Grape seed proanthocyanidins induce mitochondrial pathway‑mediated apoptosis in human colorectal carcinoma cells. Oncol Lett 14: 5853-5860, 2017.
APA
Zhang, C., Chen, W., Zhang, X., Zheng, Y., Yu, F., Liu, Y., & Wang, Y. (2017). Grape seed proanthocyanidins induce mitochondrial pathway‑mediated apoptosis in human colorectal carcinoma cells. Oncology Letters, 14, 5853-5860. https://doi.org/10.3892/ol.2017.6992
MLA
Zhang, C., Chen, W., Zhang, X., Zheng, Y., Yu, F., Liu, Y., Wang, Y."Grape seed proanthocyanidins induce mitochondrial pathway‑mediated apoptosis in human colorectal carcinoma cells". Oncology Letters 14.5 (2017): 5853-5860.
Chicago
Zhang, C., Chen, W., Zhang, X., Zheng, Y., Yu, F., Liu, Y., Wang, Y."Grape seed proanthocyanidins induce mitochondrial pathway‑mediated apoptosis in human colorectal carcinoma cells". Oncology Letters 14, no. 5 (2017): 5853-5860. https://doi.org/10.3892/ol.2017.6992