Naringenin inhibits alcoholic injury by improving lipid metabolism and reducing apoptosis in zebrafish larvae

  • Authors:
    • Haiyan Lin
    • Zhenting Zhou
    • Weichao Zhong
    • Peng Huang
    • Ning Ma
    • Yuqing Zhang
    • Chuying Zhou
    • Yuling Lai
    • Shaohui Huang
    • Haiyan An
    • Xuegang Sun
    • Lei Gao
    • Zhiping Lv
  • View Affiliations

  • Published online on: September 19, 2017     https://doi.org/10.3892/or.2017.5965
  • Pages: 2877-2884
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )


Abstract

Alcoholic liver disease (ALD) includes a spectrum of hepatic abnormalities that range from isolated alcoholic steatosis to steatohepatitis and cirrhosis. Naringenin, a predominant flavanone in grapefruit, increases resistance to oxidative stress and inflammation and protects against multiple organ injury in various animal models. However, the specific mechanisms responsible for protection against alcoholic injury are poorly understood. In the present study, we aimed to investigate the effect of naringenin on alcoholic events and the molecular regulatory mechanisms of naringenin in the liver and whole body of zebrafish larvae following exposure to 350 mmol/l ethanol for 32 h. Zebrafish larvae {4 days post‑fertilization (dpf); wild-type (WT) and a transgenic line with liver-specific eGFP expression [Tg(lfabp10α-eGFP)]} were used to establish an alcoholic fatty liver model in order to evaluate the effects of naringenin treatment on anti-alcoholic injury. Naringenin significantly reduced alcoholic liver morphological phenotypes and the expression of alcohol and lipid metabolism-related genes, including cyp2y3, cyp3a65, hmgcra, hmgcrb, fasn, fabp10α, fads2 and echs1, in zebrafish larvae. Naringenin also attenuated hepatic apoptosis in larvae as detected by TUNEL staining, consistent with the expression of critical biomarkers of endoplasmic reticulum stress and of DNA damage genes (chop, gadd45αa and edem1). The present study showed that naringenin inhibited alcohol-induced liver steatosis and injury in zebrafish larvae by reducing apoptosis and DNA damage and by harmonizing alcohol and lipid metabolism.

Introduction

Hepatic steatosis is an early and common sign of alcohol consumption and possible progression to alcoholic liver disease (ALD), which is a major liver disease and an important health issue in America and worldwide (1). ALD includes a series of phenotypes ranging from simple steatosis to steatohepatitis, progressive fibrosis, cirrhosis and hepatocellular carcinoma (2). The worldwide growing prevalence of ALD suggests that more affordable treatments are needed.

Epidemiological studies have revealed an association between an increased consumption of dietary flavonoids and a reduced risk of dyslipidemia disease (3). The flavonoid naringenin [5,7-dihydroxy-2-(4-hydroxyphenyl)chroman-4-one] has been investigated as a possible candidate agent to protect against inflammatory injuries (4). Naringenin was found to improve glucose and insulin tolerance, reduce hepatic lipid accumulation, and attenuate dyslipidemia and atherosclerosis in mouse models (5,6). Naringenin induced hepatic fatty acid oxidation, which reduces the availability of lipids, particularly triglycerides, for the assembly and secretion of apolipoprotein B-containing lipoproteins, leading to reduced hepatic lipid accumulation and improved dyslipidemia (6). Naringenin works in a manner similar to that of metformin, a medicine used for type 2 diabetes, by reducing hepatic glucose production in hepatocytes (7). The effects of naringenin on dysregulated metabolism are related to reductions in adipose mass and ectopic lipid deposition in the liver (5). Naringenin modulates the levels of necrotic inflammation, reduces lipid and protein oxidation, recruits the antioxidative defense system and markedly promotes extracellular matrix degradation (8). Additionally, naringenin was found to prevent diet-induced weight gain and adiposity by increasing whole-body energy expenditure (5). Other polyphenolic compounds prevented diet-induced adipose tissue accumulation through a variety of mechanisms, including inhibition of preadipocyte differentiation, lipolysis stimulation and increased mitochondrial function (9). However, the role of naringenin in alcohol-induced hepatic steatosis and its molecular mechanisms remain to be fully elucidated.

Taking into account the above-mentioned findings, the present study was undertaken to investigate the effects of naringenin on alcohol-induced hepatic steatosis injury of zebrafish larvae in vivo. To delineate the mechanisms by which naringenin exerts its effects on alcohol metabolism, anti-dyslipidemia and hepatocyte damage in ALD, we evaluated several critical genes related to alcohol and lipid metabolism. Morphological examinations of the whole zebrafish body and liver were also performed to further substantiate the beneficial effects of naringenin on pathological alterations induced by alcohol exposure. For the first time, we evaluated the mechanisms by which naringenin regulates alcohol and lipid homeostasis in zebrafish larvae, and we conclude that naringenin can protect against alcohol-induced metabolic dysregulation. Collectively, these findings demonstrated that naringenin had marked lipid-lowering potential, could normalize alcohol and lipid metabolism and could prevent hepatic steatosis. The ability of naringenin to modulate metabolic pathways linked to ALD suggests that citrus flavonoids represent valuable tools in the search for regulators of alcohol metabolism, lipid homeostasis and liver damage.

Materials and methods

Animal husbandry and treatments

Adult wild-type zebrafish (WT, AB strain) and a liver-specific eGFP expression transgenic zebrafish line, Tg(lfabp10α-eGFP), were maintained on a 14:10 h light:dark cycle at 28°C. Embryos were collected following natural spawning and raised at 28°C. All zebrafish protocols were approved by the Institutional Animal Care and Use Committee of Southern Medical University.

Larvae were exposed to 350 mmol/l ethanol (2% EtOH) in fish water starting at 96–98 h post fertilization (hpf) for up to 32 h as previously described (10). Zebrafish larvae in the model group were randomly divided into 5 groups and placed in 6-well plates. We dissolved monomers of naringenin in dimethyl sulfoxide (DMSO) and diluted the stock solution with fish water to obtain different concentrations. All groups were given 8 ml of water, and we added appropriate naringenin concentrations to the drug-treated groups and 0.1% DMSO (by volume concentration) to the DMSO group. The 6-well plates were placed in an incubator for 48 h; we then observed and recorded the general situation of each group.

Oil Red O staining

Oil Red O staining was carried out as previously described (11). Zebrafish larvae were collected in 1.5 ml EP tubes and washed twice with phosphate-buffered saline (PBS) after the animal experiments. We then fixed whole larvae in 4% paraformaldehyde (PFA) overnight at 4°C. After the larvae were washed twice with PBS, they were sequentially infiltrated with 20, 40, 80 and 100% propylene glycol at room temperature for 15 min each and stained with 0.5% Oil Red O in 100% propylene glycol at 65°C in the dark for 1 h. We washed the stained larvae sequentially with 100, 80, 40 and 20% propylene glycol for ~20 min each to fade the background color. Finally, the stained larvae were washed with PBS and stored in 70% glycerol at 4°C. The larvae were observed and photographed on a bright-field dissecting microscope (Olympus SZX10; Olympus, Tokyo, Japan).

H&E staining of paraffin sections

Larvae were fixed in 4% PFA at 4°C overnight and embedded in paraffin according to standard procedures (12). Then, 4 µm sections were stained with hematoxylin and eosin (H&E), and the pathological changes in the liver were observed and photographed using a light microscope (Nikon Eclipse Ni-U; Nikon, Tokyo, Japan).

Nile Red staining

Whole zebrafish Nile Red staining was performed as previously described (13). In total, 0.5 mg of Nile Red was dissolved in 1 ml of acetone, and then diluted with 75% glycerinum and 25% water. We washed the fixed larvae 3 times with PBS. The larvae were then permeabilized with 0.1% Triton in citric acid solution at 65°C for 2 h, washed with PBS, and stained with 0.5 µg/ml Nile Red at room temperature in the dark for 50 min. After the larvae were washed with PBS, they were stained with DAPI at room temperature in the dark for 10 min and then washed 3 times with PBS. Finally, we photographed the stained larvae using a confocal microscope (Nikon C2 Plus).

TUNEL staining

TUNEL assay was performed on paraffin-embedded liver sections using an In Situ Cell Death Detection kit, POD (Roche Diagnostics, Basel, Switzerland). Permeabilized larvae were washed with PBS and stained with 1:50 TUNEL at 4°C in the dark overnight. The next day, the larvae were stained with DAPI and photographed as mentioned above.

Reverse transcription and quantitative PCR (qPCR)

Total RNA was extracted from 20 larvae that had been smashed with 1 ml syringe pumps, and the total RNA concentrations were measured using a Thermo NanoDrop spectrophotometer. RNA was reverse-transcribed into cDNA using a Takara reverse transcription kit (Takara, Tokyo, Japan). Quantitative PCR was performed using 0.1 µmol/l of gene-specific primers, SYBR-Green SuperMix (Roche) and a LightCycler® 96 (Roche). The qPCR conditions were as follows: one cycle of 95°C for 10 min; followed by 45 cycles of 95°C for 10 sec, 60°C for 10 sec and 72°C for 10 sec; and a final cycle of 95°C for 10 sec, 65°C for 60 sec and 97°C for 1 sec. Rpp0 (ribosomal protein P0) was used as the reference; the primer sequences are listed in Table I. The mRNA level was calculated by the cycle threshold (Ct) method (2−Ct (target)/2−Ct (rpp0)).

Table I.

Primers used to quantify mRNA levels.

Table I.

Primers used to quantify mRNA levels.

GeneFP sequence (5′-3′)RP sequence (5′-3′)
rpp0 ctgaacatctcgcccttctc tagccgatctgcagacacac
cyp2y3 tattcccatgctgcactctg aggagcgtttacctgcagaa
cyp3a65 aaaccctgatgagcatggac caagtctttggggatgagga
chop aggaaagtgcaggagctgac ctccacaagaagaatttcctcc
gadd45αa tggctttgtttgtgggactt tggaaaacagtccactgaga
hmgcra ctgaggctctggtggacgtg gatagcagctacgatgttggcg
hmgcrb cctgttagccgtcagtgga tctttgaccactcgtgccg
fasn gagaaagcttgccaaacagg gagggtcttgcaggagacag
fabp10α ttacgctcaggagaactacga ggatgtgggagaatcggtcag
edem1 gacagcagaaaccctcaagc catggccctcatcttgactt
echs1 agatgcagaatcgaaccttccaa gagatagcaaactcacatcctccg
fads2 tcatcgtcgctgttattctgg tgaagatgttgggtttagcgtg
Statistical analysis

Statistical analysis was carried out using SPSS 16.0 statistical software (SPSS, Inc., Chicago, IL, USA). The results are expressed as the mean ± standard error of the mean (SEM). Statistical analysis was performed using an unpaired t-test or one-way analysis of variance (ANOVA), followed by Tukey's multiple comparison test with dependent experimental designs. One-way ANOVA and t-tests were used for analysis. Differences were considered statistically significance at P<0.05.

Results

An alcoholic fatty liver zebrafish larva model was established

We chose to expose larvae to ethanol during a window after the liver is formed (96 hpf) and before all the yolk is utilized (5.5–6 dpf) to avoid the metabolic impact of fasting (14). We defined acute exposure as 32 h, which is distinct from the chronic exposure that occurs in alcoholics.

Previous studies indicate that ethanol causes distinct morphological phenotypes, hepatomegaly and behavioral abnormalities in nearly all larvae after 32 h of exposure to 350 mmol/l ethanol (12,15). In order to confirm the hepatic morphological phenotypes, we tracked individual 4 dpf Tg(lfabp10α-eGFP) larvae exposed to 350 mmol/l ethanol over 32 h and verified these findings in clear phase. Hepatomegaly and lordosis were observed in nearly all larvae after 32 h of ethanol exposure (Fig. 1A and C).

After the larvae were exposed to 350 mmol/l ethanol for 32 h, serious lipid accumulation was observed in the liver as detected by H&E staining of the paraffin-embedded sections (Fig. 1B) and Oil Red O staining of whole larvae (Fig. 1C). The quantification of positive Oil Red O staining in the liver was performed using ImageJ software (Fig. 1D), which further confirmed that 32 h of exposure to 350 mmol/l ethanol successfully induced hepatic steatosis in zebrafish larvae.

Naringenin reduces alcohol-induced liver steatosis in zebrafish larvae

Although massive lipid deposition was visible in the livers of larvae after ethanol exposure as detected by whole body Oil Red O staining, notably, the obvious hepatic steatosis induced by ethanol exposure was significant dose-dependently reduced by naringenin (Fig. 2A). Based on the Oil Red O staining results, hepatic steatosis was quantified in terms of gray value using ImageJ software. The gray value analysis further indicated that naringenin significantly downregulated hepatic steatosis with a dose-dependent change and that 5 mg/l and 10 mg/l dosages almost reversed the alcoholic lipid accumulation in larvae (Fig. 2B). In contrast, the selective fluorescent staining (Nile Red) for intracellular lipid droplets was used to detect the hepatic response to ethanol exposure with or without naringenin treatment in Tg(lfabp10α-eGFP) larvae. Consistent with the Oil Red O staining results, naringenin treatment (5 mg/l, 48 h) significantly reduced the alcohol-induced lipid droplet accumulation in the livers of exposed larvae (Fig. 2C). Furthermore, the hepatic pathologic change was confirmed by H&E staining of paraffin-embedded larvae sections (Fig. 2D).

Naringenin treatment improves alcohol metabolism in zebrafish larvae

Cytochrome P450 family 2 subfamily E member 1 (cyp2e1), the major enzyme that generates oxidative stress by mediating ethanol metabolism, is proposed to play a major role in ALD pathology in mammals. Cytochrome P450, family 2, subfamily Y, polypeptide 3 (cyp2y3) and cyp2e1 are homologous genes that are critical for ethanol metabolism in the zebrafish liver (14). Upregulation of cyp2y3 accelerates the speed of alcohol metabolism and accumulation of acetaldehyde, which increase the quantity of liver damage (14). Our data indicated that the mRNA level of cyp2y3 was significantly elevated in zebrafish larvae after alcohol exposure compared to the control group, while naringenin treatment reversed this effect on the cyp2y3 mRNA level (Fig. 3A). Similar to cytochrome P450, family 3, subfamily A, polypeptide 65 (cyp3a65) (Fig. 3B), the ortholog of cytochrome P450, family 3, subfamily A (cyp3a) is also mainly expressed in the liver and plays a key role in the metabolism of endogenous substrates and xenobiotics (16). The beneficial effects of naringenin treatment may be due to the improvement of alcohol metabolism and reduction of toxic substances.

Naringenin treatment improves lipid metabolism and protects zebrafish larvae against alcoholic injury

We next evaluated whether naringenin could attenuate lipid metabolism, improve lipid homeostasis and prevent alcohol-induced hepatic steatosis. The key genes (fads2, fasn, echs1, fabp10α, hmgcra and hmgcrb) involved in lipid metabolism were chosen; these genes are related to cholesterol biosynthesis, fatty acid synthase and desaturase, and mitochondrial enzyme (1721). Quantitative PCR results (Fig. 4A-F) indicated that alcoholic treatment induced significant upregulation of zebrafish larva mRNA (fads2, fasn, echs1, fabp10α, hmgcra and hmgcrb), which was reversed by naringenin treatment.

Naringenin attenuates endoplasmic reticulum stress and DNA damage in zebrafish larvae with alcoholic injury

Endoplasmic reticulum stress and DNA damage play critical roles in the pathogenesis of alcoholic liver injury (14,22). We examined the anti-apoptotic effects of naringenin on alcohol-induced liver steatosis by TUNEL staining and compared the results with mRNA levels of DNA-damage inducible transcript 3 (chop) (26) and growth arrest and DNA damage-inducible, α, a (gadd45αa) (24), which are critical biomarkers of endoplasmic reticulum stress and DNA damage. TUNEL staining indicated that naringenin significantly reduced hepatocyte apoptosis in zebrafish larvae with alcoholic injury (Fig. 5A). The detection of chop and gadd45αa mRNA levels also indicated that naringenin reversed the significantly increased mRNA levels of chop and gadd45αa after alcohol treatment (Fig. 5B). Thus, naringenin inhibited endoplasmic reticulum stress and DNA damage and reduced ethanol-induced cell apoptosis in zebrafish larvae.

Discussion

Hepatic steatosis is the first response to alcohol abuse (2) and may progress to more severe liver diseases. Chronic steatosis is a prerequisite for developing steatohepatitis and cirrhosis and makes hepatocytes susceptible to damage (25). Therefore, inhibiting hepatic lipid accumulation during alcohol exposure may stop further liver damage. Naringenin acts in a manner similar to metformin to reduce hepatic glucose production in hepatocytes (7). In addition, naringenin was found to improve various aspects of lipid homeostasis and to mitigate adipose tissue inflammation in vivo (6,7,2628). However, the effects of naringenin on alcoholic and metabolic abnormalities have not been studied. The present study is the first to use alcohol-exposed zebrafish to examine the effects of naringenin on ethanol metabolism and major aspects of ALD pathology, including steatosis, ER stress and apoptosis, in zebrafish larvae. In the present study, we confirmed and expanded on previous findings (12,15) that acute exposure of zebrafish larvae to 350 mmol/l ethanol was suitable for establishing an alcoholic fatty liver zebrafish model. Furthermore, we demonstrated that naringenin treatment could prevent acute alcohol-induced hepatic steatosis, dyslipidemia, and cell death. Naringenin markedly attenuated alcohol and lipid metabolism and hepatic lipid accumulation, collectively resulting in the attenuation of steatosis.

The alcoholic fatty liver zebrafish larvae model is easily and quickly generated. Obtaining liver tissue and blood from zebrafish larvae is difficult and prevents the detection of mRNA and protein expressed in the liver and the measurement of biochemical parameters related to liver function; however, zebrafish larvae have other advantages, including their short breeding cycle and transparent soma. We can obtain vast larvae in a short time, and it is easy to observe whole body staining of larvae.

In the present study, we first detected the anti-steatosis effect of naringenin against ethanol exposure in zebrafish larvae. Both Oil Red O staining and H&E pathological staining results showed that naringenin reduced alcoholic liver steatosis in zebrafish larvae and that the therapeutic effects had a dose-dependent tendency with the minimum and optimum naringenin concentration (5 mg/l). After we confirmed the anti-steatosis effect of naringenin, we examined the potential role of naringenin in alcohol-induced cell death and injury. TUNEL staining showed that apoptosis may contribute to alcoholic liver injury. chop and gadd45αa are growth arrest and DNA damage genes, respectively. chop regulates the transcription of lipid metabolism genes (29), and upregulation of the chop protein causes lipid metabolism disorders in the liver (23). chop is also known as a specific transcription factor of endoplasmic reticulum stress. In contrast, ER degradation-enhancing α-mannosidase-like protein 1 (edem1), a key gene involved in the unfolded protein response, was increased significantly in patients with steatosis (30). Increased mRNA expressions of chop, gadd45αa and edem1 after ethanol exposure indicated that endoplasmic reticulum stress and DNA damage were more serious. In contrast, less apoptosis and downregulation of chop, gadd45αa and edem1 mRNA levels were induced by naringenin treatment. Therefore, we confirmed that naringenin could suppress alcohol-induced steatosis and damage in zebrafish larvae.

HMG-CoA reductases, including HMG coenzyme A reductase a (hmgcra) and HMG coenzyme A reductase b (hmgcrb), are key enzymes in lipid metabolism and mainly regulate cholesterol biosynthesis genes (17,31). Fatty acid synthase (fasn) regulates the synthesis and desaturation of fatty acids (19). Fatty acid desaturase 2 (fads2) is a dyslipidemia-related gene that mainly metabolizes unsaturated fatty acids, is involved in glucose metabolism and influences the concentrations of total cholesterol, low-density lipoprotein cholesterol, high-density lipoprotein cholesterol and triglycerides (18). Fatty acid-binding protein 10a (fabp10α) is an intracellular fatty acid-binding protein that is involved in intracellular lipid metabolism and fatty acid transport (21). Enoyl-CoA hydratase, short chain 1 (echs1), a gene that encodes a mitochondrial enzyme, is related to the degradation of amino acids and essential fatty acids, and echs1 mutations cause severe metabolic disorders (20). The fads2, fasn, echs1, fabp10α, hmgcra and hmgcrb genes, which regulate lipid metabolism, were significantly upregulated by ethanol exposure, thus indicating that alcohol exposure caused disordered lipid metabolism in larvae. Naringenin treatment significantly improved lipid metabolism by reducing fads2, fasn, echs1, fabp10α, hmgcra and hmgcrb mRNA levels.

In contrast, cyp2y3 and cyp3a65, the orthologs of cytochrome P450 CYP2 (cyp2) and cyp3a, are required for ethanol metabolism mainly in zebrafish liver. In zebrafish, the closest cyp2e1 homolog is cyp2y3, which is 43% identical to the human protein (14). Blocking cyp2 homologs significantly reduces alcohol metabolism and oxidative stress. In addition, cyp3a65 plays a critical role in the metabolism of endogenous substrates and xenobiotics (16). The roles of cyp2y3 and cyp2e1 in biological disturbances are emphasized in the initiation and progression of fatty liver disease caused by alcohol consumption (14). Notably, our data indicated that naringenin interruption could significantly downregulate the elevated mRNA levels of cyp2y3 and cyp3a65 in zebrafish larvae, which were induced by ethanol exposure. The beneficial effects of naringenin treatment may be due to the improvement of alcohol metabolism and reduction of toxic substances. Combined with the above observations, we realized that alcoholic injury in zebrafish larvae mainly resulted from disordered lipid and alcohol metabolism and that naringenin could improve the inordinate metabolism to inhibit alcoholic steatosis and injury.

Finally, we summarize the critical roles of naringenin in inhibiting alcohol-induced liver steatosis as showed in a graphical illustration (Fig. 6). The present study demonstrated that naringenin inhibits alcohol-induced liver steatosis and injury in zebrafish larvae by reducing apoptosis and DNA damage and harmonizing alcohol and lipid metabolism. Further experimentation is needed to illuminate the pathway by which apoptosis is reduced and alcohol and lipid metabolism is balanced. Naringenin readily accumulates in plasma after ingesting orange juice, grapefruit juice and tomato paste or sauce (5), suggesting the bioavailability of naringenin in individuals who consume naringenin food sources regularly. Further pre-clinical and human intervention studies may help to determine whether naringenin can protect against alcohol liver diseases and lipid metabolic syndrome in humans.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (nos. 81603501 and 81302948), the China Postdoctoral Science Foundation (2016M592508), the Science and Technology Planning Project of Guangdong Province (2014A020221097), the Administration of Traditional Chinese Medicine of Guangdong Province (20162087), the Science and Technology Planning Project of Guangzhou City (201508020014), and the Scientific Research Initiative Program of Southern Medical University (LX2015N003).

Glossary

Abbreviations

Abbreviations:

ALD

alcoholic liver disease

PBS

phosphate-buffered saline

PFA

paraformaldehyde

H&E

hematoxylin and eosin

qPCR

real-time quantitative PCR

hpf

h post-fertilization

dpf

days post-fertilization

rpp0

ribosomal protein P0

cyp2e1

cytochrome P450 family 2 subfamily E member 1

cyp2y3

cytochrome P450, family 2, subfamily Y, polypeptide 3

cyp3a65

cytochrome P450, family 3, subfamily A, polypeptide 65

cyp3a

cytochrome P450, family 3, subfamily A

chop

DNA-damage-inducible transcript 3

gadd45αa

growth arrest and DNA damage-inducible, α, a

hmgcra

HMG coenzyme A reductase a

hmgcrb

HMG coenzyme A reductase b

fasn

fatty acid synthase

fads2

fatty acid desaturase 2

fabp10α

fatty acid binding protein 10a

edem1

ER degradation-enhancing α-mannosidase-like protein 1

echs1

enoyl-CoA hydratase, short chain 1

References

1 

Ni HM, Bhakta A, Wang S, Li Z, Manley S, Huang H, Copple B and Ding WX: Role of hypoxia inducing factor-1β in alcohol-induced autophagy, steatosis and liver injury in mice. PLoS One. 9:e1158492014. View Article : Google Scholar : PubMed/NCBI

2 

Orman ES, Odena G and Bataller R: Alcoholic liver disease: Pathogenesis, management, and novel targets for therapy. J Gastroenterol Hepatol. 28 Suppl 1:S77–S84. 2013. View Article : Google Scholar

3 

Akhlaghi M: Non-alcoholic fatty liver disease: Beneficial effects of flavonoids. Phytother Res. 30:1559–1571. 2016. View Article : Google Scholar : PubMed/NCBI

4 

Moon PD, Choi IH and Kim HM: Naringenin suppresses the production of thymic stromal lymphopoietin through the blockade of RIP2 and caspase-1 signal cascade in mast cells. Eur J Pharmacol. 671:128–132. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Ke JY, Kliewer KL, Hamad EM, Cole RM, Powell KA, Andridge RR, Straka SR, Yee LD and Belury MA: The flavonoid, naringenin, decreases adipose tissue mass and attenuates ovariectomy-associated metabolic disturbances in mice. Nutr Metab. 12:12015. View Article : Google Scholar

6 

Mulvihill EE, Allister EM, Sutherland BG, Telford DE, Sawyez CG, Edwards JY, Markle JM, Hegele RA and Huff MW: Naringenin prevents dyslipidemia, apolipoprotein B overproduction, and hyperinsulinemia in LDL receptor-null mice with diet-induced insulin resistance. Diabetes. 58:2198–2210. 2009. View Article : Google Scholar : PubMed/NCBI

7 

Purushotham A, Tian M and Belury MA: The citrus fruit flavonoid naringenin suppresses hepatic glucose production from Fao hepatoma cells. Mol Nutr Food Res. 53:300–307. 2009. View Article : Google Scholar : PubMed/NCBI

8 

Chtourou Y, Fetoui H, Jemai R, Ben Slima A, Makni M and Gdoura R: Naringenin reduces cholesterol-induced hepatic inflammation in rats by modulating matrix metalloproteinases-2, 9 via inhibition of nuclear factor κB pathway. Eur J Pharmacol. 746:96–105. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Zar Kalai F, Han J, Ksouri R, El Omri A, Abdelly C and Isoda H: Antiobesity effects of an edible halophyte Nitraria retusa Forssk in 3T3-L1 preadipocyte differentiation and in C57B6J/L mice fed a high fat diet-induced obesity. Evid Based Complement Alternat Med. 2013:3686582013. View Article : Google Scholar : PubMed/NCBI

10 

Howarth DL, Yin C, Yeh K and Sadler KC: Defining hepatic dysfunction parameters in two models of fatty liver disease in zebrafish larvae. Zebrafish. 10:199–210. 2013. View Article : Google Scholar : PubMed/NCBI

11 

Dai W, Wang K, Zheng X, Chen X, Zhang W, Zhang Y, Hou J and Liu L: High fat plus high cholesterol diet lead to hepatic steatosis in zebrafish larvae: A novel model for screening anti-hepatic steatosis drugs. Nutr Metab. 12:422015. View Article : Google Scholar

12 

Passeri MJ, Cinaroglu A, Gao C and Sadler KC: Hepatic steatosis in response to acute alcohol exposure in zebrafish requires sterol regulatory element binding protein activation. Hepatology. 49:443–452. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Greenspan P, Mayer EP and Fowler SD: Nile red: A selective fluorescent stain for intracellular lipid droplets. J Cell Biol. 100:965–973. 1985. View Article : Google Scholar : PubMed/NCBI

14 

Tsedensodnom O, Vacaru AM, Howarth DL, Yin C and Sadler KC: Ethanol metabolism and oxidative stress are required for unfolded protein response activation and steatosis in zebrafish with alcoholic liver disease. 1213–1226. 2013.

15 

Howarth DL, Passeri M and Sadler KC: Drinks like a fish: Using zebrafish to understand alcoholic liver disease. Alcohol Clin Exp Res. 35:826–829. 2011. View Article : Google Scholar : PubMed/NCBI

16 

Tseng H, Hseu T, Buhler D, Wang W and Hu C: Constitutive and xenobiotics-induced expression of a novel CYP3A gene from zebrafish larva. Toxicol Appl Pharmacol. 205:247–258. 2005. View Article : Google Scholar : PubMed/NCBI

17 

Suganya S, Nandagopal B and Anbarasu A: Natural inhibitors of HMG CoA reductase - an in silico approach through molecular docking and simulation studies. J Cell Biochem. 99:1–6. 2016.

18 

Tian Y, Zhang W, Zhao S, Sun Y, Bian Y, Chen T, Du Y, Zhang J, Wang Z, Huang T, et al: FADS1-FADS2 gene cluster confers risk to polycystic ovary syndrome. Sci Rep. 6:211952016. View Article : Google Scholar : PubMed/NCBI

19 

Zappaterra M, Deserti M, Mazza R, Braglia S, Zambonelli P and Davoli R: A gene and protein expression study on four porcine genes related to intramuscular fat deposition. Meat Sci. 121:27–32. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Olgiati S, Skorvanek M, Quadri M, Minneboo M, Graafland J, Breedveld GJ, Bonte R, Ozgur Z, Van den Hout MC, Schoonderwoerd K, et al: Paroxysmal exercise-induced dystonia within the phenotypic spectrum of ECHS1 deficiency. Mov Disord. 31:1041–1048. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Storch J and Thumser AE: The fatty acid transport function of fatty acid-binding proteins. Biochim Biophys Acta. 1486:28–44. 2000. View Article : Google Scholar : PubMed/NCBI

22 

Ren Z, Wang X, Xu M, Yang F, Frank JA, Ke ZJ and Luo J: Binge ethanol exposure causes endoplasmic reticulum stress, oxidative stress and tissue injury in the pancreas. Oncotarget. 7:54303–54316. 2016. View Article : Google Scholar : PubMed/NCBI

23 

Zheng X, Dai W, Chen X, Wang K, Zhang W, Liu L and Hou J: Caffeine reduces hepatic lipid accumulation through regulation of lipogenesis and ER stress in zebrafish larvae. J Biomed Sci. 22:1052015. View Article : Google Scholar : PubMed/NCBI

24 

Zhao XX, Zhang YB, Ni PL, Wu ZL, Yan YC and Li YP: Protein arginine methyltransferase 6 (Prmt6) is essential for early zebrafish development through the direct suppression of gadd45αa stress sensor gene. J Biol Chem. 291:402–412. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Howarth DL, Lindtner C, Vacaru AM, Sachidanandam R, Tsedensodnom O, Vasilkova T, Buettner C and Sadler KC: Activating transcription factor 6 is necessary and sufficient for alcoholic fatty liver disease in zebrafish. PLoS Genet. 10:e10043352014. View Article : Google Scholar : PubMed/NCBI

26 

Cho KW, Kim YO, Andrade JE, Burgess JR and Kim YC: Dietary naringenin increases hepatic peroxisome proliferators-activated receptor α protein expression and decreases plasma triglyceride and adiposity in rats. Eur J Nutr. 50:81–88. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Goldwasser J, Cohen PY, Yang E, Balaguer P, Yarmush ML and Nahmias Y: Transcriptional regulation of human and rat hepatic lipid metabolism by the grapefruit flavonoid naringenin: Role of PPARalpha, PPARgamma and LXRalpha. PLoS One. 5:e123992010. View Article : Google Scholar : PubMed/NCBI

28 

Alam MA, Subhan N, Rahman MM, Uddin SJ, Reza HM and Sarker SD: Effect of citrus flavonoids, naringin and naringenin, on metabolic syndrome and their mechanisms of action. Adv Nutr. 5:404–417. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Rahman K, Liu Y, Kumar P, Smith T, Thorn NE, Farris AB and Anania FA: C/EBP homologous protein modulates liraglutide-mediated attenuation of non-alcoholic steatohepatitis. Lab Invest. 96:895–908. 2016. View Article : Google Scholar : PubMed/NCBI

30 

Congiu M, Ryan MC and Desmond PV: No increase in the expression of key unfolded protein response genes in HCV genotype 3 patients with severe steatosis. Virus Res. 160:420–423. 2011. View Article : Google Scholar : PubMed/NCBI

31 

Cocci P, Mosconi G and Palermo FA: Partial cloning, tissue distribution and effects of epigallocatechin gallate on hepatic 3-hydroxy-3-methylglutaryl-CoA reductase mRNA transcripts in goldfish (Carassius auratus). Gene. 545:220–225. 2014. View Article : Google Scholar : PubMed/NCBI

Related Articles

Journal Cover

November-2017
Volume 38 Issue 5

Print ISSN: 1021-335X
Online ISSN:1791-2431

Sign up for eToc alerts

Recommend to Library

Copy and paste a formatted citation
x
Spandidos Publications style
Lin H, Zhou Z, Zhong W, Huang P, Ma N, Zhang Y, Zhou C, Lai Y, Huang S, An H, An H, et al: Naringenin inhibits alcoholic injury by improving lipid metabolism and reducing apoptosis in zebrafish larvae. Oncol Rep 38: 2877-2884, 2017.
APA
Lin, H., Zhou, Z., Zhong, W., Huang, P., Ma, N., Zhang, Y. ... Lv, Z. (2017). Naringenin inhibits alcoholic injury by improving lipid metabolism and reducing apoptosis in zebrafish larvae. Oncology Reports, 38, 2877-2884. https://doi.org/10.3892/or.2017.5965
MLA
Lin, H., Zhou, Z., Zhong, W., Huang, P., Ma, N., Zhang, Y., Zhou, C., Lai, Y., Huang, S., An, H., Sun, X., Gao, L., Lv, Z."Naringenin inhibits alcoholic injury by improving lipid metabolism and reducing apoptosis in zebrafish larvae". Oncology Reports 38.5 (2017): 2877-2884.
Chicago
Lin, H., Zhou, Z., Zhong, W., Huang, P., Ma, N., Zhang, Y., Zhou, C., Lai, Y., Huang, S., An, H., Sun, X., Gao, L., Lv, Z."Naringenin inhibits alcoholic injury by improving lipid metabolism and reducing apoptosis in zebrafish larvae". Oncology Reports 38, no. 5 (2017): 2877-2884. https://doi.org/10.3892/or.2017.5965