Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
May-June 2013 Volume 1 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-June 2013 Volume 1 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection

  • Authors:
    • Jing Yang
    • Zhen-Zhen Chen
    • Tie-Gang Lv
    • Pei-Pei Liu
    • Zong-Bo Chen
  • View Affiliations / Copyright

    Affiliations: Department of Pediatrics, The Affiliated Hospital of Qingdao Hiser Medical Center of Qingdao University, Qingdao, Shandong 266100, P.R. China, Department of Pediatrics, The Affiliated Hospital of the Medical School of Qingdao University, Qingdao, Shandong 266100, P.R. China
  • Pages: 410-412
    |
    Published online on: February 6, 2013
       https://doi.org/10.3892/br.2013.64
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Enterovirus 71 (EV71) often causes large outbreaks of diseases among children worldwide and its pathogenesis remains unclear. The aim of the present study was to investigate the association between interferon-inducible protein 10 (IP-10) polymorphism in children with EV71 infection. Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) were performed to analyze the gene polymorphisms of IP-10 (-1596C/T) in 58 EV71‑infected and 48 control patients. The results showed that in EV71‑infected patients the frequency of carrying CT + TT genotype and T allele is 10.3 and 6.0%, respectively, which is significantly lower than that of the controls (29.2 and 15.6%, respectively). Individuals with T allele had a lower risk of EV71 infection [odds ratio (OR) = 0.35, 95% confidence interval (CI), 0.13‑0.89]. The results of this study indicated that -1596T allele for the IP-10 gene may be a beneficial factor for EV71 infection.

Introduction

Enterovirus 71 (EV71) infections may cause hand, foot and mouth disease (HFMD) and even severe neurologic complications and/or pulmonary edema in young children. Although understanding of EV71 infection has recently improved, EV71 pathogenesis has yet to be fully elucidated (1). The outcome of a virus infection is the result of a complex interaction of the virus, environmental factors and host genetics. The outcome of infectious diseases is strongly controlled by the host immune response, while resistance to infection in humans is, to a certain extent, genetically determined (2). Critical host responses to virus infection include the absolute levels of cytokines as well as the control of cytokine secretion such as inducibility and stability of cytokine mRNA (3). Levels and types of cytokines and chemokines released in hosts are mainly determined by gene polymorphisms. Numerous studies have focused on the association between a virus and host response. The aim of the present study was to investigate the association between IP-10 gene polymorphism and EV71 infection in children and improve our knowledge regarding EV71 pathogenesis.

Materials and methods

Study population

The study protocol was approved by the Ethics Committee of the Medical School of Qingdao University (Qingdao, China), and informed consent for the experimental use of specimens was obtained from the participants. A total of 106 patients, aged, 2–10 years, were included in this study. The patients presented to the Department of Pediatrics of the Affiliated Hospital of the Medical School of Qingdao University between May, 2010 and May, 2011. Fifty eight of the 106 participants (male/female, 38/20) were diagnosed with EV71 using reverse transcriptase-polymerase chain reaction (RT-PCR), VPl sequencing and/or virus isolation were included in the EV71 group. The control groups comprised 48 patients (male/female, 30/18) admitted to the Department of Surgery with normal blood test and no infection, allergy or recent use of antibiotics.

Reagents and instruments

Blood Genome DNA Extraction kit, Taq Polymerase, PCR buffer (with Mg2+), dNTP mixture, restriction enzyme XbaI and PCR primers were obtained from Takara Biotechnology Co., Ltd. (Dalian, China); PE2400 PCR system was purchased from Applied Biosystems (Foster City, CA, USA). BioSpectrum 300 Imaging System was obtained from UVP and used to capture gel images (Upland, CA, USA).

DNA extraction, amplification and analysis

Genomic DNA extraction of peripheral blood leukocytes was performed: 3 ml of EDTA-whole blood sample was obtained from each participant, coded and analyzed in a blind manner for genomic DNA extraction using the Blood Genome DNA Extraction kit, according to the manufacturer’s instructions. The quality of the genomic DNA was examined by measuring the optical density (OD) at wavelengths of 260 and 280 nm. The ratio of OD260/OD280 was between 1.70–1.80. The final DNA concentration was 10 ng/μl.

IP-10 genotypes were determined using PCR-restriction fragment length polymorphism (PCR-RFLP) as previously described by Humbert et al(4). The primers for IP-10 (−1595C/T) were: F, 5′GCAGATACTGTCTCAGAACCTG GTA 3′ and R, 5′TGTCACCATCTCTCATTTTGATTGT3′ (5). The PCR reactions were performed in 25 μl containing 10 ng of genomic DNA, 10X PCR buffer (with Mg2+) 2.5 μl, 2.5 mM dNTPs 2.0 μl, 0.625 units TaqDNA polymerase and 0.5 μl of each primer (10 pmol/l). Following initial denaturation at 95°C for 5 min, the PCR reaction was performed for 35 cycles consisting of 94°C for 30 sec, 57°C for 1 min and 72°C for 1 min, followed by a final extension step of 72°C for 10 min. The PCR product was digested using the restriction enzyme XbaI and then resolved on a 2% agarose gel, and visualized by UV following ethidium bromide staining.

Statistical analysis

Statistical analysis was performed using the SPSS software (version 17.0; SPSS, Inc., Chicago, IL, USA). The χ2 test was used to evaluate differences in frequency distributions of genotype and allele of the IP-10 polymorphisms between the EV71 and control groups.

The verification of the Hardy-Weinberg equilibrium of genotypes was performed using the χ2 test. The odds ratios (ORs) for the risk of EV71 infection and their 95% confidence intervals (CIs) were calculated.

Results

Characteristics of the study subjects

The genotype frequencies of the two polymorphisms among the controls were in agreement with the Hardy-Weinberg equilibrium (P>0.05) (Table I), indicating that study subjects included in the present study were representative of the target population.

Table I

Hardy-Weinberg test of IP-10 genotype distribution.

Table I

Hardy-Weinberg test of IP-10 genotype distribution.

IP-10 genotype, n
GroupNCCCTTTχ2P-value
EV715852513.340.07
Control48341310.040.85

[i] IP-10, interferon-inducible protein 10; EV71, Enterovirus 71.

Genotype distributions of IP-10 polymorphisms

The PCR product of IP-10 (−1596C/T) was 499 bp. Following XbaI digestion, the product included one single band at 499 bp (CC type), two bands at 325 and 174 bp (TT type) and three bands at 499, 325 and 174 bp (CT type) (Fig. 1). The genotype and allele frequencies of the EV71 and control groups are shown in Table II. The percentage of CT + TT genotype and the frequency of T allele in the EV71 group (10.3 and 6%, respectively) was significantly lower compared to the control group (29.2 and 15.6%, respectively). Individuals with T allele had a lower risk of EV71 infection (OR=0.35, 95% CI, 0.13–0.89).

Figure 1

IP-10 (−1596 C/T) PCR product digestion results. M, Marker (DNA standards); lanes 1–4, EV71 groups. Lane 1, 2 and 3 are CC type; lane 4 is TT type. Lanes 5–8, control groups. Lane 5 is TT type; lanes 6, 7 and 8 are CT type.

Table II

Genotypes and allele frequencies of EV71 and control groups.

Table II

Genotypes and allele frequencies of EV71 and control groups.

Genotype, n (%)
Allele, n (%)
GroupNCCCT + TTOR95% CICTOR95% CI
EV715852 (89.7)6 (10.3)a0.280.10–0.79109 (94.0)7 (6.0)b0.350.13–0.89
Control4834 (70.8)14 (29.2)81 (84.4)15 (15.6)

a P=0.014,

b P=0.023. EV71, Enterovirus 71; OR, odds ratio; CI, confidence interval.

Discussion

Interferon-γ-inducible protein 10 (IP-10, also termed CXCL10) is one of the CXC chemokines (α subunit). Luster et al(6) first reported that IP-10, which has a relative molecular mass of 12,378, could be secreted by interferon (IFN)-γ-treated U937 cells. IP-10 has a significant amino-acid homology to platelet factor-4 (PF-4) (6). It is known to play an important role in autoimmune disease, transplantation, infection, allergic inflammatory disease and cardiovascular disease (7). Findings of previous studies have shown that the two major functions of IP-10 involve the recruiting of activated T cells into sites of tissue inflammation (8) and inhibition of angiogenesis (9). Th1 reactions depend on IP-10, which acts as a chemoattractor for monocytes/macrophages, T and NK cells, but not neutrophils. Numerous studies have shown that the chemokine CXCL10/IP-10 along with CXCL9/Mig and CXCL11/I-TAC demonstrate the ability to recruit various leukocyte subsets, the capacity to induce the proliferation of vascular pericytes as well as powerful antitumor effects. Thus, these chemokines have been suggested to be potential therapeutic targets in cancer, allograft rejection, diabetes, multiple sclerosis and autoimmune disorders of the thyroid (10). IP-10 has also been found to be associated with hepatic inflammation and to be a potential marker of treatment outcome (11). Previous studies have also shown that the CXCL10/IP-10 level is elevated in the sera and livers of progressed HBV carriers, and that the −1596T-201A haplotype is associated with higher CXCL10/IP-10 transcription in IFN-γ-stimulated peripheral blood mononuclear cells (5).

In the present study, the association between IP-10 gene polymorphism and EV71 infection in children was investigated. The results have shown that individuals with T allele have a lower risk of EV71 infection indicating that −1596T allele for IP-10 gene may be a beneficial factor for EV71 infection. Genetic susceptibility may vary due to ethnicity, complexity between virus and host as well as interaction between multiple genes and haploid mutation. Future studies may focus on screening more candidate polymorphic genes for EV71 susceptibility to help understand the genetic susceptibility and pathophysiology of EV71.

References

1 

Khong WX, Foo DG, Trasti SL, Tan EL and Alonso S: Sustained high levels of interleukin-6 contribute to the pathogenesis of enterovirus 71 in a neonate mouse model. J Virol. 85:3067–3076. 2011. View Article : Google Scholar : PubMed/NCBI

2 

van Deventer SJ: Cytokine and cytokine receptor polymorphisms in infectious disease. Intensive Care Med. 26(Suppl 1): S98–S102. 2000.PubMed/NCBI

3 

Booy R, Nadel S, Hibberd M, Levin M and Newport MJ: Genetic influence on cytokine production in meningococcal disease. Lancet. 349:11761997. View Article : Google Scholar : PubMed/NCBI

4 

Humbert R, Adler DA, Disteche CM, Hassett C, Omiecinski CJ and Furlong CE: The molecular basis of the human serum paraoxonase activity polymorphism. Nat Genet. 3:73–76. 1993. View Article : Google Scholar : PubMed/NCBI

5 

Deng G, Zhou G, Zhang R, et al: Regulatory polymorphisms in the promoter of CXCL10 gene and disease progression in male hepatitis B virus carriers. Gastroenterology. 134:716–726. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Luster AD, Unkeless JC and Ravetch JV: Gamma-interferon transcriptionally regulates an early-response gene containing homology to platelet proteins. Nature. 315:672–676. 1985. View Article : Google Scholar

7 

Gerard C and Rollins BJ: Chemokines and disease. Nat Immunol. 2:108–115. 2001. View Article : Google Scholar

8 

Dufour JH, Dziejman M, Liu MT, Leung JH, Lane TE and Luster AD: IFN-gamma-inducible protein 10 (IP-10; CXCL10)-deficient mice reveal a role for IP-10 in effector T cell generation and trafficking. J Immunol. 168:3195–3204. 2002. View Article : Google Scholar : PubMed/NCBI

9 

Angiolillo AL, Sgadari C, Taub DD, et al: Human interferon-inducible protein 10 is a potent inhibitor of angiogenesis in vivo. J Exp Med. 182:155–162. 1995. View Article : Google Scholar : PubMed/NCBI

10 

Lazzeri E and Romagnani P: CXCR3-binding chemokines: novel multifunctional therapeutic targets. Curr Drug Targets Immune Endocr Metabol Disord. 5:109–118. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Zeremski M, Petrovic LM and Talal AH: The role of chemokines as inflammatory mediators in chronic hepatitis C virus infection. J Viral Hepat. 14:675–687. 2007.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Yang J, Chen Z, Lv T, Liu P and Chen Z: Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection. Biomed Rep 1: 410-412, 2013.
APA
Yang, J., Chen, Z., Lv, T., Liu, P., & Chen, Z. (2013). Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection. Biomedical Reports, 1, 410-412. https://doi.org/10.3892/br.2013.64
MLA
Yang, J., Chen, Z., Lv, T., Liu, P., Chen, Z."Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection". Biomedical Reports 1.3 (2013): 410-412.
Chicago
Yang, J., Chen, Z., Lv, T., Liu, P., Chen, Z."Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection". Biomedical Reports 1, no. 3 (2013): 410-412. https://doi.org/10.3892/br.2013.64
Copy and paste a formatted citation
x
Spandidos Publications style
Yang J, Chen Z, Lv T, Liu P and Chen Z: Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection. Biomed Rep 1: 410-412, 2013.
APA
Yang, J., Chen, Z., Lv, T., Liu, P., & Chen, Z. (2013). Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection. Biomedical Reports, 1, 410-412. https://doi.org/10.3892/br.2013.64
MLA
Yang, J., Chen, Z., Lv, T., Liu, P., Chen, Z."Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection". Biomedical Reports 1.3 (2013): 410-412.
Chicago
Yang, J., Chen, Z., Lv, T., Liu, P., Chen, Z."Association of IP-10 gene polymorphism with susceptibility to Enterovirus 71 infection". Biomedical Reports 1, no. 3 (2013): 410-412. https://doi.org/10.3892/br.2013.64
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team