Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
July-August 2014 Volume 2 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-August 2014 Volume 2 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells

  • Authors:
    • Chaoyang Liu
    • Peng Li
    • Dewei Gao
    • Pingkun Zhou
    • Yun Shao
    • Qi Zhang
    • Wenbing Li
  • View Affiliations / Copyright

    Affiliations: Surgical Intensive Care Unit, Clinical Division of South Building, PLA General Hospital, Beijing 100853, P.R. China, Department of Radiation Toxicology, Beijing Institute of Radiation Medicine, Beijing 100850, P.R. China, Department of Pathology, Affiliated Hospital of Academy of Military Medical Sciences, Beijing 100071, P.R. China
  • Pages: 525-528
    |
    Published online on: April 11, 2014
       https://doi.org/10.3892/br.2014.268
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Carcinoma of the lung is the leading cause of cancer‑related mortality worldwide. In order to understand the pathogenesis of radiation‑induced lung cancer, we adopted a model of transformed human bronchial epithelial cells (BEP2D) induced by α‑particles. Methylation‑specific polymerase chain reaction was performed to detect aberrant promoter methylation of multiple tumor suppressor genes, including p14ARF, p16INK4a, O6‑methylguanine‑DNA methyltransferase, glutathione S‑transferase P1 and death‑associated protein kinase genes in the BEP2D cell line and its malignant transformant, the BERP35T1 cell line. Our results demonstrated the distinctive methylation pattern for these tumor suppressor genes in radiation‑induced malignant cells, as compared to their wild‑type counterparts. Our study revealed epigenetic signatures for the characterization of radiation‑mediated carcinogenesis and it may facilitate early diagnosis of patients at high risk for lung cancer.

Introduction

Lung cancer is the most common cause of cancer-related mortality worldwide. A number of theories and multiple causes for lung cancer development have been proposed and it was suggested that multiple genetic modifications and signaling pathway alterations may be involved in lung oncogenesis (1). Rapid advances in this field have lead to targeted therapy, including the FDA-approved epidermal growth factor receptor and vascular endothelial growth factor inhibitors erlotinib (2) and bevacizumab (3), which have significantly improved the outcome in patients with non-small-cell lung cancer. The identification of additional molecular markers specific to lung cancer may improve early detection, which is critical for improving survival.

A major role for epigenetic mechanisms has been suggested in cancer development (4). Specifically, methylation patterns are significantly altered in cancer cells. Hypermethylation of certain CpG islands is observed in the majority of tumor cells and is associated with gene silencing. This is more prominent for certain tumor suppressor genes whose loss-of-function promotes carcinogenesis (5). The DNA methylation status may also provide a highly sensitive and specific marker for early cancer diagnosis.

To investigate the pathogenesis of radiation-induced lung cancer and further provide evidence for clinical application, we established a model of transformed human bronchial epithelial cells (BEP2D) induced by α-particles (6) and the methylation status in the promoter regions of multiple tumor suppressor genes was analyzed by methylation-specific polymerase chain reaction (PCR).

Materials and methods

Cell culture

The BEP2D cell line is a human papillomavirus 18-immortalized human bronchial epithelial cell line and was kindly provided by Dr Curtis C. Harris (National Cancer Institute, MD, USA) (7). The BERP35T1 malignant transformant cell line was derived from the BEP2D cell line through α-particle irradiation (6). The cells were cultured in serum-free LHC-8 medium (Biofluids Inc., Rockville, MD, USA) at 37°C under a 95% air/5% CO2 atmosphere.

SssI methyltransferase treatment

Genomic DNA was extracted from normal lung tissue and treated with SssI methyltransferase (New England Biolabs, Ipswich, MA, USA). SssI-treated DNA was then used as a substrate for methylation-specific PCR.

Methylation-specific PCR analysis

We extracted and purified genomic DNA from BEP2D cells and their malignant transformants, BERP35T1 cells. Following modification by treatment with sodium bisulfite, methylation-specific PCR (8) was performed with 2 μl of bisulfite-treated DNA with methylation- and unmethylation-specific primers for each tumor suppressor gene. The amplified products were separated electrophoretically on 3% agarose gels and visualized using ethidium bromide staining. The primer sets and size of the amplified products are listed in Table I.

Table I

Primers used for methylation-specific polymerase chain reaction.

Table I

Primers used for methylation-specific polymerase chain reaction.

GeneSense primer (5′-3′)Antisense primer (5′-3′)Annealing temp (°C)Size (bp)
p16INK4aM: TTATTAGAGGGTGGGGCGGATCGCM: GACCCCGAACCGCGACCGTAA65150
U: TTATTAGAGGGTGGGGTGGATTGTU: CAACCCCAAACCACAACCATAA65151
MGMTM: TTTCGACGTTCGTAGGTTTTCGCM: GCACTCTTCCGAAAACGAAACG6681
U: TTTGTGTTTTGATGTTTGTAGGTTTTTGTU: AACTCCACACTCTTCCAAAAACAAAACA6693
DAPKM: GGATAGTCGGATCGAGTTAACGTCM: CCCTCCCAAACGCCGA6498
U: GGAGGATAGTTGGATTGAGTTAATGTTU: CAAATCCCTCCCAAACACCAA64106
p14ARFM: GTGTTAAAGGGCGGCGTAGCM: AAAACCCTCACTCGCGACGA64122
U: TTTTTGGTGTTAAAGGGTGGTGTAGTU: CACAAAAACCCTCACTCACAACAA64132
GSTP1M: TTCGGGGTGTAGCGGTCGTCM: GCCCCAATACTAAATCACGACG5591
U: GATGTTTGGGGTGTAGTGGTTGTTU: CCACCCCAATACTAAATCACAACA5597

[i] M, methylation-specific primer; U, unmethylation-specific primer; MGMT, O6-methylguanine-DNA methyltransferase; DAPK, death-associated protein kinase; GSTP1, glutathione S-transferase P1.

Results

Verification of methylation detection system

The analyses of the methylation status of the genes were performed by methylation-specific PCR. For the purpose of verification of our methylation detection system, we extracted DNA from normal lung tissue and then treated it with SssI methylase. SssI methylase-treated and unmodified DNAs were used as substrates for the PCR reaction using p14ARF gene methylation-specific PCR primers. As shown in Fig. 1, a positive PCR product appeared in the SssI methylase-treated DNA sample, but not in the untreated control group, reflecting the specificity of our detection system. The results were further confirmed by direct DNA sequencing.

Figure 1

Methylation-specific polymerase chain reaction (PCR). Genomic DNA was extracted from normal lung tissue and DNA samples with or without Sss1 methyltransferase treatment were then used as substrates in methylation-specific PCR. U, lane for unmethylated PCR product; M, lane for methylated PCR product.

Methylation-specific PCR of tumor suppressor genes

In view of the critical role played by tumor suppressors in cell cycle control and tumor genesis, we investigated the methylation status of multiple tumor suppressor genes in BEP2D cells and their malignant transformant BERP35T1 cells induced by α-particles. The CpG island in the 5′ promoter region of the p14ARF gene was unmethylated in BEP2D cells, but was modified through methylation in the malignant transformant BERP35T1 cells. Of note, the p16INK4a gene, which shares two exons with the p14ARF gene, was not methylated in the promoter CpG islands.

The O6-methylguanine-DNA methyltransferase (MGMT) gene is a specific DNA repair enzyme, which removes the alkyl group from the O6-position of guanine, preventing its mutagenic and carcinogenic effects (9,10). The MGMT gene was found to be methylated in BEP2D cells, as well as in malignant transformant BERP35T1 cells (Fig. 2).

Figure 2

Methylation-specific polymerase chain reaction (PCR) showing the methylated and unmethylated PCR products for multiple tumor suppressor genes, including p14ARF, p16INK4a, O6-methylguanine-DNA methyltransferase (MGMT), death-associated protein kinase (DAPK) and glutathione S-transferase P1 (GSTP1) genes in the transformed human bronchial epithelial cell line (BEP2D) and its malignant transformant (BERP35T1). U, lane for unmethylated PCR product; M, lane for methylated PCR product.

Death-associated protein kinase (DAPK) is a multi-domain serine/threonine protein kinase that possesses apoptotic and tumor-suppressive functions (11). The DAPK gene was partially methylated in BEP2D cells and completely methylated in BERP35T1 cells (Fig. 2).

Methylation of the glutathione S-transferase P1 (GSTP1) gene promoter region is the most common epigenetic change in prostate cancer (12). The GSTP1 gene was unmethylated in BEP2D cells and partially methylated in BERP35T1 cells, suggesting that it may also involved in lung oncogenesis (Fig. 2).

Discussion

DNA methylation in the promoter region is an important mechanism of tumor suppressor gene inactivation in human cancers. An alteration in the methylation status, particularly hypermethylation, typically occurs at CpG islands in the promoter region and is associated with tumor suppressor gene inactivation, ultimately leading to carcinogenesis (13,14).

We used the α-particle-induced malignant transformant BERP35T1 cell line as a cell culture model for lung carcinogenesis; this cell line was derived from the BEP2D cell line, a human papillomavirus 18-immortalized human bronchial epithelial cell line (7). Ionizing radiation was selected to establish BERP35T1, as it may induce a high incidence of large chromosomal deletions or translocations as a result of strand breakage (15). When compared to BEP2D cells, malignant transformant BERP35T1 cells exhibited altered growth kinetics, resistance to serum-induced terminal differentiation and anchorage-independent growth.

To elucidate the molecular mechanism underlying radiation-mediated carcinogenesis, we used methylation-specific PCR to detect aberrant promoter methylation of multiple tumor suppressor genes, including p14ARF and p16INK4a (cell cycle regulators), MGMT and GSTP1 (DNA repair) and DAPK (cell apoptosis) genes in BEP2D cells and malignant transformant BERP35T1 cells. As shown in Fig. 2, these genes exhibited different methylation patterns. For example, p16INK4A and p14ARF are two tumor suppressors encoded by the cyclin-dependent kinase inhibitor 2A gene locus. Through alternative splicing, p16INK4A and p14ARF have distinct promoter regions and first exons, but share the second and third exons. The p16INK4A and p14ARF proteins have important functions in cell cycle regulation and generally act as negative regulators of cell cycle progression. p16INK4A mainly acts via the retinoblastoma pathway as an inhibitor of the cyclin-dependent kinases 4 and 6 (16) and p14ARF is crucial for the p53 pathway through inhibiting mouse double minute 2 homolog (17,18). Our findings demonstrated that the methylation status of p16INK4A and p14ARF was regulated in a distinctive pattern, suggesting that p16INK4A and p14ARF are separately involved in tumor development.

Our results also demonstrated a distinctive methylation pattern among other tumor suppressors in α-particle-induced malignant transformant BERP35T1 cells, when compared to their wild-type counterparts. For example, the MGMT gene was methylated in both cell lines; the DAPK gene was only partially methylated in wild-type cells and completely modified through methylation in the malignant transformed cell line; as regards the GSTP1 gene, it was unmethylated in wild-type cells and partially methylated in BERP35T1 cells.

Our final goal is to apply DNA methylation markers in early lung cancer diagnosis. Achieving this goal largely depends on the sensitivity and specificity of these epigenetic markers. Our present study demonstrated the practicality of this approach, since the methylation patterns are quite distinctive for the malignant transformed cell line compared to its wild-type counterpart. Our ongoing efforts are aimed at screening high-risk groups for lung cancer using these epigenetic signature and suggest a future direction for manipulating epigenetic alterations towards lung cancer therapy.

Acknowledgements

This study was supported by a grant from the National High Technology Research and Development Program of China (863 Program) (no. 2001AA221271), a grant from the Major State Basic Research Development Program of China (973 Program) (no. G1998051207), a grant from the Military Scientific Research Foundation for Returned Scholars (no. 98H037) and a grant from the Military Science Foundation for The Excellent Youth Scholars during the 9th Five-Year Plan Period (no. 01J006).

References

1 

Herbst RS, Heymach JV and Lippman SM: Lung cancer. N Engl J Med. 359:1367–1380. 2008. View Article : Google Scholar : PubMed/NCBI

2 

Shepherd FA, Rodrigues Pereira J, Ciuleanu T, et al: Erlotinib in previously treated non-small-cell lung cancer. N Engl J Med. 353:123–132. 2005. View Article : Google Scholar : PubMed/NCBI

3 

Sandler A, Gray R, Perry MC, et al: Paclitaxel-carboplatin alone or with bevacizumab for non-small-cell lung cancer. N Engl J Med. 355:2542–2550. 2006. View Article : Google Scholar : PubMed/NCBI

4 

Boehm JS and Hahn WC: Towards systematic functional characterization of cancer genomes. Nat Rev Genet. 12:487–498. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Esteller M: CpG island hypermethylation and tumor suppressor genes: a booming present, a brighter future. Oncogene. 21:5427–5440. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Lou T, Xiang X and Wu D: Transformation of human bronchial epithelial cells BEP2D induced by 238Pu α-particles. Chin J Lung Canc. 3:428–431. 2000.(In Chinese).

7 

Willey JC, Broussoud A, Sleemi A, et al: Immortalization of normal human bronchial epithelial cells by human papillomaviruses 16 or 18. Cancer Res. 51:5370–5377. 1991.PubMed/NCBI

8 

Herman JG, Graff JR, Myohanen S, Nelkin BD and Baylin SB: Methylation-specific PCR: a novel PCR assay for methylation status of CpG islands. Proc Natl Acad Sci USA. 93:9821–9826. 1996. View Article : Google Scholar : PubMed/NCBI

9 

Esteller M, Hamilton SR, Burger PC, Baylin SB and Herman JG: Inactivation of the DNA repair gene O6-methylguanine-DNA methyltransferase by promoter hypermethylation is a common event in primary human neoplasia. Cancer Res. 59:793–797. 1999.

10 

Wolf P, Hu YC, Doffek K, Sidransky D and Ahrendt SA: O6-Methylguanine-DNA methyltransferase promoter hypermethylation shifts the p53 mutational spectrum in non-small cell lung cancer. Cancer Res. 61:8113–8117. 2001.

11 

Bialik S and Kimchi A: The death-associated protein kinases: structure, function, and beyond. Annu Rev Biochem. 75:189–210. 2006. View Article : Google Scholar : PubMed/NCBI

12 

Esteller M, Corn PG, Urena JM, Gabrielson E, Baylin SB and Herman JG: Inactivation of glutathione S-transferase P1 gene by promoter hypermethylation in human neoplasia. Cancer Res. 58:4515–4518. 1998.PubMed/NCBI

13 

Widschwendter M and Jones PA: The potential prognostic, predictive, and therapeutic values of DNA methylation in cancer. Clin Cancer Res. 8:17–21. 2002.PubMed/NCBI

14 

Hatziapostolou M and Iliopoulos D: Epigenetic aberrations during oncogenesis. Cell Mol Life Sci. 68:1681–1702. 2011. View Article : Google Scholar : PubMed/NCBI

15 

Hall EJ and Hei TK: Genomic instability and bystander effects induced by high-LET radiation. Oncogene. 22:7034–7042. 2003. View Article : Google Scholar : PubMed/NCBI

16 

Kashiwabara K, Oyama T, Sano T, Fukuda T and Nakajima T: Correlation between methylation status of the p16/CDKN2 gene and the expression of p16 and Rb proteins in primary non-small cell lung cancers. Int J Cancer. 79:215–220. 1998. View Article : Google Scholar : PubMed/NCBI

17 

Zhang Y, Xiong Y and Yarbrough WG: ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell. 92:725–734. 1998. View Article : Google Scholar : PubMed/NCBI

18 

Sherr CJ: Tumor surveillance via the ARF-p53 pathway. Genes Dev. 12:2984–2991. 1998. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu C, Li P, Gao D, Zhou P, Shao Y, Zhang Q and Li W: Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells. Biomed Rep 2: 525-528, 2014.
APA
Liu, C., Li, P., Gao, D., Zhou, P., Shao, Y., Zhang, Q., & Li, W. (2014). Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells. Biomedical Reports, 2, 525-528. https://doi.org/10.3892/br.2014.268
MLA
Liu, C., Li, P., Gao, D., Zhou, P., Shao, Y., Zhang, Q., Li, W."Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells". Biomedical Reports 2.4 (2014): 525-528.
Chicago
Liu, C., Li, P., Gao, D., Zhou, P., Shao, Y., Zhang, Q., Li, W."Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells". Biomedical Reports 2, no. 4 (2014): 525-528. https://doi.org/10.3892/br.2014.268
Copy and paste a formatted citation
x
Spandidos Publications style
Liu C, Li P, Gao D, Zhou P, Shao Y, Zhang Q and Li W: Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells. Biomed Rep 2: 525-528, 2014.
APA
Liu, C., Li, P., Gao, D., Zhou, P., Shao, Y., Zhang, Q., & Li, W. (2014). Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells. Biomedical Reports, 2, 525-528. https://doi.org/10.3892/br.2014.268
MLA
Liu, C., Li, P., Gao, D., Zhou, P., Shao, Y., Zhang, Q., Li, W."Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells". Biomedical Reports 2.4 (2014): 525-528.
Chicago
Liu, C., Li, P., Gao, D., Zhou, P., Shao, Y., Zhang, Q., Li, W."Abnormal promoter methylation of multiple tumor suppressor genes in human bronchial epithelial malignant cells". Biomedical Reports 2, no. 4 (2014): 525-528. https://doi.org/10.3892/br.2014.268
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team