Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
April-2018 Volume 8 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2018 Volume 8 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Optimization of an in-house PCR method for the detection of HLA-B*27 alleles

  • Authors:
    • Noor Afshan
    • Mukarram Bashir
    • Hamid Nawaz Tipu
    • Mohammad Hussain
  • View Affiliations / Copyright

    Affiliations: Department of Immunology, Armed Forces Institute of Pathology, 46000 Rawalpindi, Pakistan
  • Pages: 385-390
    |
    Published online on: February 1, 2018
       https://doi.org/10.3892/br.2018.1055
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The association of spondyloarthropathies with different alleles of human leukocyte antigen (HLA) B*27 is well established. Different subtypes of HLA-B*27 may be linked with different ethnic groups, distinct clinical manifestations, specific age of onset and different prognoses. Polymerase chain reaction with sequence specific primers (PCR-SSP) is the most frequently adapted molecular method used for the recognition of HLA-B*27-specific DNA sequences. The aim of the present study was to standarise an in-house protocol of PCR-SSP for HLA-B*27 allele detection for use in the Armed Forces Institute of Pathology (AFIP), Pakistan, with consideration of its cost effectiveness. A total of 49 individual samples were included, comprising 10 transplant samples determined to be HLA-B*27-negative by PCR-SSP and 39 HLA-B*27-positive samples determined by flow cytometry, obtained from patients who were symptomatic and referred for HLA-B*27 testing. By altering each variable individually, an in-house PCR-SSP protocol was optimized to amplify common HLA-B*27 alleles (2701-2721, 2723-2730). To discriminate B*27 from all other HLA-B alleles, a low-resolution HLA-B typing set with a 96 PCR-SSP primer mixture was used in conjunction. Among the 39 HLA-B*27-positive specimens, 31 (79%) were detected as positive by PCR-SSP, with the remaining samples failing due to a sub-optimized protocol and/or low DNA concentration. Additionally, there was complete concordance between flow cytometry and in-house PCR, and the sensitivity and specificity of the PCR-SSP were determined to be 100%. In conclusion, in-house SSP-PCR is, standard method for the detection of HLA-B*27 alleles. The determination of associations between specific HLA-B*27 alleles and AS may aid to identify individuals at higher risk of developing the disease. Furthermore, the identification of individuals at risk may aid to adapt preventive strategies.

Introduction

Ankylosing spondylitis (AS) is a progressive and chronic inflammatory disease, which primarily involves the sacroiliac joints and spine, though peripheral joints, including the shoulders, hips, ribs, heels and small joints of the hands and feet, may also be affected (1,2). The most prevalent early symptoms are pain and stiffness in the affected joint, which is most severe at rest, while improving during activity (3). AS typically affects younger individuals, developing between the ages of 15 and 30. Occasionally, the disease affects multiple members of a family (4).

Class I human leukocyte antigen (HLA)-B*27 has been associated with AS in numerous studies (2). This antigen is present in over 95% of patients with AS in the Caucasian population (5–7). In the coding sequence for HLA-B*27 there is genetic polymorphism. In total, 105 polymorphism subtypes exist, namely HLA-B*2701 to HLA-B*27106, encoded by 132 alleles (8). These alleles are discriminated by changes primarily in exons 2 and 3, which encode the α1 and α2 chains of the B27 molecule, respectively (9). HLA-B*27 typing has been proposed as a useful test for AS and related spondyloarthropathies (SpA), and thus the availability of a reliable and accurate detection method is important (3). Although the result of HLA-B*27 typing is unable confirm or exclude the diagnosis of this disease (10), different subtypes may be associated with different ethnic groups, clinical manifestation, age of onset and prognosis (11).

The microlymphocytotoxicity test (MLCT) (12) and flow cytometry (13) are commonly used techniques for routine typing of HLA-B*27. These tests rely on the detection of cell surface antigens with antibodies. Major drawbacks of MLCT include the requirement for viable cells, cross-reactivity of antigens, the requirement for a single individual to provide consistent and accurate results, and unavailability of B*27 specific antisera covering all HLA-B*27 alleles (14). Flow cytometry is often used due to its efficiency as an alternative HLA-B*27 detection technique; however, cross-reactivity with other HLA-B molecules including B7 is a major limitation (15,16). Furthermore, it requires expensive reagents, complex equipment and specifically trained personnel. As a result, many laboratories have now adopted replacement molecular methods.

The two main molecular methods most frequently adapted for histocompatibility typing are polymerase chain reaction with sequence specific primers (PCR-SSP) or with sequence specific oligonucleotide probes (PCR-SSO) (14). In particular, the PCR-SSP technique relies on the recognition of HLA-B*27 specific DNA sequences, and thus is an ideal test for HLA-B*27. Previous results have concluded that the outcomes obtained by PCR-SSP are more accurate compared with the conventional serological approach (15).

PCR-SSP amplification of HLA-B*27 loci is established as a precise and accurate method. It is based on the basic PCR principle that under controlled conditions, primers with complementary sequences to target sequences result in amplified products, while non-complementary primers do not initiate amplification (17). Nevertheless, an internal control primer pair, which amplifies a conserved region, is included in each PCR reaction mix in addition to sequence-specific primers, to indicate the integrity of the PCR reaction (18).

The present study focused on optimization and evaluation of in-house sequence-specific PCR for HLA-B*27 alleles. It differentiated 29 commonly occurring and disease-associated HLA-B*27 alleles (B*2701-B*2721 and B*2723-B*2730) to the 4-digit level (19). The determination of associations between specific HLA-B*27 alleles with AS may aid to identify individuals who are likely to develop the disease, and if the population frequency of disease-associated alleles is low, then the diagnostic accuracy of the test will be increased. Furthermore, the identification of individuals at risk may aid to adapt preventive strategies.

Materials and methods

Samples

A total of 39 individual HLA-B*27-positive specimens, determined by flow cytometry (20), were obtained from patients (mean age, 31.8±8.6 years) who were symptomatic for SpA and referred to the Armed Forces Institute of Pathology (AFIP, Rawalpindi, Pakistan) for HLA-B*27 testing between April and December 2016. Individuals presenting with a history of trauma and/or mechanical back pain were excluded. Blood specimens from 10 HLA-B*27-negative transplant donors (mean age, 18.9±16.3 years) were included as negative controls following HLA typing using a low-resolution HLA-B typing set consisting of 96 primer mixtures (micro SSP 1L96 wells tray; One Lamda; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Table I lists the HLA-B specificities of the 10 negative controls tested. The institutional review board of AFIP approved the study and written informed consent from all patients was obtained.

Table I.

HLA-B specificities of the 10 HLA-B*27-negative samples tested.

Table I.

HLA-B specificities of the 10 HLA-B*27-negative samples tested.

HLA-B specificityTotal samples, n
B*131
B*141
B*152
B*354
B*403
B*442
B*514
B*552
B*581

[i] Samples were typed using a commercial kit (micro SSP 1L96 wells tray; One Lamda; Thermo Fisher Scientific, Inc., Waltham, MA, USA). HLA, human leukocyte antigen.

In-house PCR-SSP method

Chemicals and reagents used for HLA-B*27 amplifications. Polymerase chain reaction buffer [10X with (NH4)2SO4; Thermo Fisher Scientific, Waltham, MA, USA], a customized HLA-B*27 allele primer set of 35 (Alpha DNA, Montreal, QC, Canada) (19), dNTPs, MgCl2 (both from Thermo Fisher Scientific), HLA-DRB1 locus-specific primers (21) as internal control primer (Alpha DNA), Taq DNA polymerase (NovaTaq™ DNA Polymerase; EMD Millipore, Billerica, MA, USA), a Gentra Puregene Blood kit (Qiagen, Inc., Valencia, CA, USA), dimethyl sulfoxide (DMSO; Scharlab S.L., Barcelona, Spain) Tris base (Ultra-Pure Tris buffer; Invitrogen; Thermo Fisher Scientific), EDTA, boric acid (both from Merck KGaA, Damstadt Germany), agarose (OmniPur; EMD Millipore), bromophenol blue (Merck KGaA), gel loading dye [20% (w/v) sucrose, 0.25% (w/v) bromophenol blue], ethidium bromide (Invitrogen; Thermo Fisher Scientific) and Mili-Q water (EvoQua, Pittsburgh, PA, USA) were used in PCR-SSP.

DNA extraction for the amplification of SSP

Venous blood samples (3 ml) were collected in EDTA-potassium tubes from each patient. DNA was extracted using the Gentra Puregene Blood kit, according to the manufacturer's instructions. The isolated DNA was washed in ethanol and the final concentration was adjusted to 100 ng/µl. Different concentrations of DNA (0.1–100 ng/µl) were initially tested to obtain clear bands for HLA-B*27 and to minimize nonspecific amplification. DNA purity ratio was maintained between 1.7 and 2.0, determined at 260 and 280 nm using an Epoch microplate spectrophotometer (BioTek Instruments, Inc., Winooski, VT, USA). DNA was stored at −20°C until analysis.

PCR master mix preparation

The final optimized reaction mix was composed of the following: DNA Taq polymerase (5 U/µl), 0.03 U/17 µl SSP reaction; dNTPs (final concentration of each dNTP, 0.172 mM); PCR buffer, 17 mM; Tris-HCL, 64 mM, pH 8.8; MgCl2, 1.7 mM; DMSO, 2% (v/v); internal control primers (forward and reverse), 0.23 µM each; and Mili-Q water, 208 µl. This reaction mixture was equally divided into 29 reaction tubes and one negative control per sample (15 µl each).

Amplification control primers

The control primer pair included in master mix that amplified the third intron of the DRB1 gene (21) had the following sequences: HLA-DRB1 forward, 5′-TGCCAAGTGGAGCACCCAA-3′ and reverse, 5′-GCATCTTGCTCTGTGCAGAT-3′. These primers matched conserved sequences and thus functioned as an internal positive amplification control.

Allele specific primers

A total of 35 sequence-specific primers for HLA-B*27 alleles (19) were purchased (Alpha DNA) as lyophilized, salt-purified oligonucleotides. Following reconstitution in Mili Q water, 100 µM stock solution was made, followed by a working dilution of 3 mM. Sequences, annealing position and specificities are listed in Table II. The primers were added to the PCR reaction tubes (29 tubes/sample) at a final concentration of 0.23 µM. Thus, 29 SSP mixtures were made to assign 29 HLA-B*27 alleles at the 4-digit level (B*2701-B*2721 and B*2723-B*2730).

Table II.

Human leukocyte antigen B*27 allele primer sequences and specificities.

Table II.

Human leukocyte antigen B*27 allele primer sequences and specificities.

Forward primerReverse primer


No.PositionSequence, 5–3No.PositionSequence, 5–3Amplicon size, bpB*27 alleles amplified
01297–314 AGAGAACCTGCGCACCGC17411–428 TCGTAGGCGTCCTGGTGG38001
02149–167 GCTACGTGGACGACACGCT18311–330 GTTGTAGTAGCGGAGCGCGA18502, 30
03284–302 CACAGACTGACCGAGAGGA17411–428 TCGTAGGCGTCCTGGTGG39003, 05, 09, 10, 13, 14, 16, 17, 19, 28
04284–302 CACAGACTGACCGAGAGAG17411–428 TCGTAGGCGTCCTGGTGG39004, 08, 12, 15, 18, 23, 25, 26
05230–248 GCAGGAGGGGCCGGAGTT17411–428 TCGTAGGCGTCCTGGTGG44517
06254–272 ACCGGGAGACACAGATCTC17411–428 TCGTAGGCGTCCTGGTGG42018, 29
07261–282 ACACAGATCTACAAGACCAAC17411–428 TCGTAGGCGTCCTGGTGG41012, 16, 18, 23, 29
08294–311 CCGAGAGAGCCTGCGGAA17411–428 TCGTAGGCGTCCTGGTGG38008, 12, 18, 26
09254–272 ACCGGGAGACACAGATCTG19354–371 CCATACATCGTCTGCCAA36514
03284–302 CACAGACTGACCGAGAGGA20363–381 CACGTCGCAGCCGTACATG34007
10262–283 CACAGATCTGCAAGGCCAAGG21412–430 CGTCGTAGGCGTACTGGTC41006, 21
11262–282 CACAGATCTGCAAGGCCAAG21412–430 CGTCGTAGGCGTACTGGTC41006, 21
03284–302 CACAGACTGACCGAGAGGA22369–385 GCCCCACGTCGCAGCCG35007, 19
03284–302 CACAGACTGACCGAGAGGA23418–434 CTTGCCGTCGTAGGCGTG39509
03284–302 CACAGACTGACCGAGAGGA24418–434 CTTGCCGTCGTAGGCGTC39503, 05, 10, 13, 14, 16, 17, 19, 28, 29
03284–302 CACAGACTGACCGAGAGGA25527–544 CTCTCAGCTGCTCCGCCT50510
03284–302 CACAGACTGACCGAGAGGA26418–435 GTTTGCCGTCGTAGGCGTA39507, 27
10262–283 CACAGATCTGCAAGGCCAAGG20363–381 CACGTCGCAGCCGTACATG36007, 11, 24
124–14 CGAGATGCGGGTCACGGC2797–114 CCGGGACACGGAGGTGTG25501–12, 14–21, 23–30
134–14 CGAGATGCGGGTCACGGA2797–114 CCGGGACACGGAGGTGTG25513
1483–97 CCACTCCATGAGGTATTTCC28247–265 GTGTCTCCCGGTCCCAATG19003
1483–97 CCACTCCATGAGGTATTTCC29247–265 GTGTCTCCCGGTCCCAATA19001, 02, 04, 18–21, 24–30
02149–167 GCTACGTGGACGACACGCT25527–544 CTCTCAGCTGCTCCGCCT64004, 06, 10, 15, 18, 20, 21, 24, 25
02149–167 GCTACGTGGACGACACGCT30,31280–298 CTCGGTCAGTCTGTGCCTT15501–11, 13–15, 17,
280–299 TCTCGGTAAGTCTGTGCCTT 19–21, 24, 25, 27, 28, 30
02149–167 GCTACGTGGACGACACGCT32559–576 GAGCCACTCCACGCACGT67515, 28
16344–363 GGTCTCACACCCTCCAGAAT33559–576 GAGCCACTCCACGCACAG23525
15302–319 CCTGCGGACCCTGCTCC34363–383 CACGTCGCAGCCGTACATC32519, 21
03284–302 CACAGACTGACCGAGAGGA32559–576 GAGCCACTCCACGCACGT54028
09254–272 ACCGGGAGACACAGATCTG35363–383 CACGTCGCAGCCGTACATC37019, 21, 30
PCR protocol

Forward and reversed primers (1 µl each) were dispensed in 29 mini Eppendorf tubes according to the primer mix combinations (Table II). A total of 15 µl master mix was added to each and to the negative control tube. PCR was performed on an Eppendorf Mastercycler Gradient thermocycler (7 tests were also run on a MultiGene OptiMax Labnet International Thermal Cycler) at an initial denaturation temperature of 94°C for 5 min, followed by 30 cycles of amplification (30 sec at 95°C, 60 sec at 64°C and 72°C for 60 sec) and a final elongation step at 72°C for 7 min, with storage at 4°C. A total of 10 random samples were repeated.

Visualization of amplifications by agarose gel electrophoresis

Agarose gel 2% (w/v) in 0.1X Tris/borate/EDTA (TBE) buffer was prepared. The agarose was dissolved by boiling, then cooled to 60°C. Ethidium bromide (0.5 µg/ml gel solution) was then added. A 4–5-mm thick gel with 3-mm wide slots was cast and set for 10–20 min. Following the addition of 1 µl loading dye to each PCR tube, the products were loaded on the gel. The gel was run in 0.1X TBE buffer for 35 min at 4 V/cm. Finally, the gel was examined under ultra-violet illumination and the results were documented (Fig. 1).

Figure 1.

Agarose gel electrophoresis of positive HLA-B*27 alleles. The internal control band (679 bp) is positive in all lanes excluding lane 29. HLA-B*27 allele bands are present in lanes 4 (390 bp), 21 (190 bp), 22 (190 bp) and 24 (155 bp). Diffuse bands at the bottom of each lane are primer dimers. HLA, human leukocyte antigen; IC, internal control.

Analytical specificity of the in-house method

The specificity of the in-house method was ensured by the selection of the primers, as well as by concurrent use of the micro SSP 1L96 wells typing tray, used to differentiate B27 from all other HLA-B alleles.

Results

HLA-B*27 typing

A total of 189 suspected cases of SpA were referred to AFIP in 2016 for HLA-B*27 typing by flow cytometry, and 45 were identified as HLA-B*27-positive (23.8%). In the present study, a total of 49 specimens with complete medical records were assessed: 39 HLA-B*27-positive specimens determined by flow cytometry and 10 negative donor specimens that were HLA-B*27-negative, determined by PCR-SSP.

In house PCR-SSP

Of the 39 positive samples, 31 samples exhibited positive HLA-B*27 allele results with positive internal control, listed in Table III (including 22 confirmed SpA cases, of which 20 were AS, with diagnosis confirmed on positive HLA-B*27 typing), while the remaining 8 failed (low DNA concentration) or became invalid (no internal control positive) due to sub optimized conditions. The DRB1 internal control (product size 796 bp), detected in 31 samples, confirmed the correct PCR conditions and the presence of sufficient template DNA in these amplifications. The 10 transplant donors who were HLA-B*27-negative according to the low-resolution PCR-SSP kit were also detected as negative by in-house PCR-SSP. Thus, overall sensitivity and specificity were 100%, and there were no false positive or false negative results (Table IV). Similar results were obtained for 7 samples, which were run on two distinctive thermal cyclers (Eppendorf Master cycler gradient and MultiGene OptiMax Labnet International). In addition, 10 random samples were tested twice for HLA-B*27 using the in-house PCR-SSP test and demonstrated reproducible results.

Table III.

Positive detection of human leukocyte antigen B*27 by in-house polymerase chain reaction with sequence-specific primers.

Table III.

Positive detection of human leukocyte antigen B*27 by in-house polymerase chain reaction with sequence-specific primers.

SpA patient IDPossible B*27 alleles
104, 08, 12, 15, 16, 18, 19, 21, 23, 25, 26, 29
219, 21
303, 05, 10, 13, 14, 16, 17, 19, 28, 29
401, 02, 04, 18–21, 24–30
501, 02, 04, 18–21, 24–30
612, 16, 18, 19, 21, 23, 29, 30
719
802, 12, 16, 18, 19, 21, 23, 29, 30
930
1007, 19
1106, 07, 11, 21, 24
1207
1306, 21
1406, 21, 25
1503
1607
1721
1807, 10, 19
1910
2010
2107
2203, 05, 10, 13, 14, 16, 17, 19, 28, 29

Suspected SpA patient IDPossible B*27 alleles

2301, 03, 05, 06, 07, 10, 13, 14, 16, 17, 19, 21, 28, 29
2403, 05, 07, 10, 11, 13, 14, 16, 17, 19, 24, 28 29
2507, 19, 21
2614, 19, 21, 30
2719, 21, 30
2807, 19
2907, 11, 24
3007, 19, 21
3101–11, 13–15, 17, 19–21, 24, 25, 27, 28, 30

[i] SpA, spondyloarthropathy.

Table IV.

Comparison of flow cytometry and PCR-SSP.

Table IV.

Comparison of flow cytometry and PCR-SSP.

In-house PCR-SSPFlow cytometry PositiveLow-resolution PCR-SSP (kit) NegativeTotal
Positive31  031
Negative  01010
Total311041

[i] PCR-SSP, polymerase chain reaction with sequence specific primers.

Analytical sensitivity

Analytical sensitivity of the PCR-SSP technique was tested with different concentrations of DNA ranging from 0.1 to 100 ng/µl. Positive bands of the control and B*27-specific primers were most obviously detected at concentrations ranging from 50 to 92 ng/µl.

Discussion

The association between AS and HLA-B*27 alleles depends on ethnicity and geographical location. HLA-B*27 is more frequent in Punjabi and Urdu-speaking communities in Pakistan (22). Certain alleles exhibit an association with increased susceptibility to AS, including B*2702, B*2704, B*2705, B*2707 and B*2708 (23), while others may confer protection, including B*2706 and B*2709 (24). Thus, subtype identification may be helpful for early diagnosis and improved prognosis of AS.

A PCR detection method for HLA-class I and II genes has been used by us for tissue typing of transplant patients, and was used as a starting point in the present study. PCR-SSP for HLA-B*27 detection is a method based on the use of specific primers complementary to unique HLA-B*27 gene sequences. In the present study, an in-house PCR-SSP test was developed which amplified common HLA-B*27 alleles (2701–2721 and 2723–2730) (19).

The specificity of PCR is influenced by numerous factors, including the sequence of the primer (GC content), ratio of primer, buffer, Mg2+ ion concentration and Taq polymerase concentration (25,26). All conditions were optimized in the present study for all primer pairs in succession. This optimization resulted in a slightly different protocol from tissue typing; the primer concentration was lower and the optimal annealing temperature was higher. However, the results may contradict as when primer concentration is lower, more cycles and higher annealing temperature are required (26). The lower primer concentration was important to prevent primer dimerization. Initially in preliminary assays, 0.47 µmol/µl primer was used in each reaction, which was identified to create primer-dimers (data not shown). Reducing primer concentration to 0.23 µmol/μl minimized the presence of these dimers. Another important variable in PCR is the MgCl2 concentration; an optimal concentration of 1.7 mM was achieved in the present study by titration. Furthermore, the annealing temperature required optimization, which was increased to 64°C, resulting in a higher specificity of synthesis of HLA-B*27 products. The DRB1 product also exhibited improved intensity with higher annealing temperature. Therefore, an optimized annealing temperature was important to avoid false positive bands, which may otherwise lead to misdiagnosis of patients. DMSO may have also improved the PCR reaction, by decreasing inter- and intra-strand reannealing (27–29). Additionally, precautionary measures were taken to prevent contamination of samples using dedicated equipment and reagents.

The analytical sensitivity of the PCR-SSP technique was tested with different concentrations of DNA ranging from 0.1 to 100 ng/µl. Positive bands of the control and B*27-specific primers were most obviously detected at concentrations ranging from 50 to 92 ng/µl. High analytical sensitivity of in-house PCR-SSP has advantages over other methods, as it requires lower quantity blood samples compared with MLCT, and older samples may be used compared with flow cytometry, which requires fresh samples for accurate results.

The present study represents an advancement in biomedical science in Pakistan, as to the best of our knowledge, it is a pioneer attempt in this region, although this work has been conducted in other countries. Immunological research is comparatively novel in Pakistan and there are few available molecular immunology laboratories. The association of different HLAs with autoimmune diseases is now an active area of research in the region.

The cost of the present in-house, optimized PCR SSP technique was relatively low; the technique was ~2 times less costly than that of imported commercial PCR-SSP test kits provided by certain laboratories. Thus, in developing countries including Pakistan, in-house protocols provide a more economical alternative. Nevertheless, applications of the present study may lead to improved understanding and treatment of general SpA diseases. Furthermore, it may form the basis for the future studies on the association of HLA-B*27 alleles with AS and related arthropathies.

In conclusion, in-house PCR-SSP should be considered a standard method for the detection of HLA-B*27 alleles. It is a relatively accurate method that bypasses the typical problems associated with MLCT and flow cytometry, and may improve the diagnosis of AS at the molecular level. Furthermore, although the technique is labour intensive, it is markedly less costly than imported commercial PCR-SSP test kits.

References

1 

Ahsan T, Erum U, Jabeen R and Khowaja D: Ankylosing Spondylitis: A rheumatology clinic experience. Pak J Med Sci. 32:365–368. 2016.PubMed/NCBI

2 

Hospital TO: The pathogenesis of ankylosing spondylitis. Neurosurg Focus. 24:1–10. 2008. View Article : Google Scholar

3 

Raychaudhuri SP and Deodhar A: The classification and diagnostic criteria of ankylosing spondylitis. J Autoimmun 48–49. 1–133. 2014.

4 

Reveille JD: Major histocompatibility genes and ankylosing spondylitis. Best Pract Res Clin Rheumatol. 20:601–609. 2006. View Article : Google Scholar : PubMed/NCBI

5 

Brown MA: Breakthroughs in genetic studies of ankylosing spondylitis. Rheumatology (Oxford). 47:132–137. 2008. View Article : Google Scholar : PubMed/NCBI

6 

Sheehan NJ and Frcp M: The ramifications of HLA-B27. J R Soc Med. 97:10–14. 2004. View Article : Google Scholar : PubMed/NCBI

7 

Reveille JD, Ball EJ and Khan MA: HLA-B27 and genetic predisposing factors in spondyloarthropathies. Curr Opin Rheumatol. 13:265–272. 2001. View Article : Google Scholar : PubMed/NCBI

8 

Khan MA: Polymorphism of HLA-B27: 105 subtypes currently known. Curr Rheumatol Rep. 15:1–6. 2013. View Article : Google Scholar

9 

Tipu HN: Journal of Genetic Disorders and Genetic Reports Mini Review: HLA B27 and its immunogenetics in ankylosing spondylitis. J Genet Disor Genet Rep. 2:12013.

10 

Khan MA and Khan MK: Diagnostic value of HLA-B27 testing ankylosing spondylitis and Reiter's syndrome. Ann Intern Med. 96:70–76. 1982. View Article : Google Scholar : PubMed/NCBI

11 

Mou Y, Zhang P, Li Q, Lin Z, Liao Z, Wei Q and Gu J: Clinical features in Juvenile-Onset ankylosing spondylitis patients carrying different B27 subtypes. Biomed Res Int. 2015:5948782015. View Article : Google Scholar : PubMed/NCBI

12 

Dunky A, Neumüller J, Hübner C, Fischer GF, Bayer PM, Wagner E, Schwartz DW and Mayr WR: HLA-B27 determination using serological methods. A comparison of enzyme immunoassay and a microlymphocytotoxic test with flow cytometry and a molecular biological assay. Rheumatol Int. 16:95–100. 1996. View Article : Google Scholar : PubMed/NCBI

13 

Skalska U, Kozakiewicz A, Maśliński W and Jurkowska M: HLA-B27 detection - comparison of genetic sequence-based method and flow cytometry assay. Reumatologia. 53:74–78. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Middelton D: HLA typing from serology to sequencing Era. Iran J Allergy Asthma Immunol. 4:53–66. 2005.PubMed/NCBI

15 

Seipp MT, Erali M, Wies RL and Wittwer C: HLA-B27 typing: Evaluation of an allele-specific PCR melting assay and two flow cytometric antigen assays. Cytometry B Clin Cytom. 63:10–15. 2005. View Article : Google Scholar : PubMed/NCBI

16 

Cianga P, Zlei M, Rezus E and Cianga C: The flow cytometric labeling pattern in HLA-B27 detection may suggest cross reactivities. Rev Romana Med Lab. 19:185–191. 2011.

17 

Chatterjee A, Sinha SK and Mukherjee G: A comprehensive review on HLA and its detections by polymerase chain reaction technique. Int J Pharm Res Sch. 3:340–346. 2014.

18 

Shyamala V and Ferro-Luzzi Ames G: Single specific primer-polymerase chain reaction (SSP-PCR) and genome walking. Methods Mol Biol. 15:339–348. 1993.PubMed/NCBI

19 

Downing J, Coates E, Street J, Hammond L, Rees TJ, Pepperall J and Darke C: A high-resolution polymerase chain reaction-sequence-specific primer HLA-B*27 typing set and its application in routine HLA-B27 testing. Genet Test. 10:98–103. 2006. View Article : Google Scholar : PubMed/NCBI

20 

Hücre A, Hla B, Testinin T and Yorumu K: Accurate and simple interpretation of HLA B27 screening by flow cytometry. Turk J Immunol. 4:1–6. 2016. View Article : Google Scholar

21 

Olerup O and Zetterquist H: HLA-DR typing by PCR amplification with sequence-specific primers (PCR-SSP) in 2 hours: An alternative to serological DR typing in clinical practice including donor-recipient matching in cadaveric transplantation. Tissue Antigens. 39:225–235. 1992. View Article : Google Scholar : PubMed/NCBI

22 

Zafar N, Khan S, Qadir A, Raza Y, Naqvi A and Rizvi A: Hla frequencies in Pakistani population. JPMA. 46:12–13. 1996.

23 

Mou Y, Wu Z, Gu J, Liao Z, Lin Z, Wei Q, Huang J and Li Q: HLA-B27 polymorphism in patients with juvenile and adult-onset ankylosing spondylitis in Southern China. Tissue Antigens. 75:56–60. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Cheng X, Mei Y, Ji X, Xue Q and Chen D: Molecular mechanism of the susceptibility difference between HLA-B*27:02/04/05 and HLA-B*27:06/09 to ankylosing spondylitis: substitution analysis, MD simulation, QSAR modelling, and in vitro assay. SAR QSAR Environ Res. 27:409–425. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Sharma N, Singh P, Nautiyal SC, Shuaib M, Rawat P and Kaur G: Rapid detection of HLA-B27 sequence specific alleles by in-house optimized molecular assay for the detection of ankylosing spondylitis. J Biomed Pharm Res. 2:175–180. 2013.

26 

Yang R, Zhang JH and Yuan GY: Establishment of an optimized PCR method using sequence-specific primers for screening multiple gene polymorphisms simultaneously. Mol Med Rep. 7:201–204. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Hardjasa A, Ling M, Ma K and Yu H: Investigating the effects of DMSO on PCR fidelity using a restriction digest-based method. J Exp Microbiol Immunol. 14:161–164. 2010.

28 

Hung T, Mak K and Fong K: A specificity enhancer for polymerase chain reaction. Nucleic Acids Res. 18:49531990. View Article : Google Scholar : PubMed/NCBI

29 

Ralser M, Querfurth R, Warnatz HJ, Lehrach H, Yaspo ML and Krobitsch S: An efficient and economic enhancer mix for PCR. Biochem Biophys Res Commun. 347:747–751. 2006. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Afshan N, Bashir M, Tipu HN and Hussain M: Optimization of an in-house PCR method for the detection of HLA-B*27 alleles. Biomed Rep 8: 385-390, 2018.
APA
Afshan, N., Bashir, M., Tipu, H.N., & Hussain, M. (2018). Optimization of an in-house PCR method for the detection of HLA-B*27 alleles. Biomedical Reports, 8, 385-390. https://doi.org/10.3892/br.2018.1055
MLA
Afshan, N., Bashir, M., Tipu, H. N., Hussain, M."Optimization of an in-house PCR method for the detection of HLA-B*27 alleles". Biomedical Reports 8.4 (2018): 385-390.
Chicago
Afshan, N., Bashir, M., Tipu, H. N., Hussain, M."Optimization of an in-house PCR method for the detection of HLA-B*27 alleles". Biomedical Reports 8, no. 4 (2018): 385-390. https://doi.org/10.3892/br.2018.1055
Copy and paste a formatted citation
x
Spandidos Publications style
Afshan N, Bashir M, Tipu HN and Hussain M: Optimization of an in-house PCR method for the detection of HLA-B*27 alleles. Biomed Rep 8: 385-390, 2018.
APA
Afshan, N., Bashir, M., Tipu, H.N., & Hussain, M. (2018). Optimization of an in-house PCR method for the detection of HLA-B*27 alleles. Biomedical Reports, 8, 385-390. https://doi.org/10.3892/br.2018.1055
MLA
Afshan, N., Bashir, M., Tipu, H. N., Hussain, M."Optimization of an in-house PCR method for the detection of HLA-B*27 alleles". Biomedical Reports 8.4 (2018): 385-390.
Chicago
Afshan, N., Bashir, M., Tipu, H. N., Hussain, M."Optimization of an in-house PCR method for the detection of HLA-B*27 alleles". Biomedical Reports 8, no. 4 (2018): 385-390. https://doi.org/10.3892/br.2018.1055
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team