Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Biomedical Reports
Join Editorial Board Propose a Special Issue
Print ISSN: 2049-9434 Online ISSN: 2049-9442
Journal Cover
January-2021 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2021 Volume 14 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms

  • Authors:
    • Nizar M. Mhaidat
    • Karem H. Alzoubi
    • Mohammed A. Kubas
    • Mohammed   N. Banihani
    • Naser Hamdan
    • Tareq M. Al‑Jaberi
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Pharmacy, Faculty of Pharmacy, Jordan University of Science and Technology, Irbid 22110, Jordan, Department of General Surgery and Urology, Faculty of Medicine, Jordan University of Science and Technology, Irbid 22110, Jordan
  • Article Number: 13
    |
    Published online on: November 12, 2020
       https://doi.org/10.3892/br.2020.1389
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Colorectal cancer (CRC) is the third most frequently diagnosed cancer worldwide. Leptin and adiponectin are hormones produced by adipose tissues, which exhibit opposing effects on tumor growth. Leptin promotes tumor development and metastasis, whereas adiponectin attenuates this. The aim of the present study was to assess the possible association between leptin and adiponectin [both high molecular weight (HMW) and non‑HMW factions] levels with CRC, CRC response to chemotherapy, and to study the relationship between LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270), and ADIPO (rs822369) polymorphisms and CRC. A total of 32 blood samples collected from CRC patients were analyzed to identify the serum levels of leptin and adiponectin, and the presence of CRC related polymorphisms. A total of 25 healthy subjects were recruited in the control group. Serum levels of leptin and adiponectin were detected using ELISA whereas DNA from patients and controls was amplified and analyzed using PCR‑restriction fragment length polymorphism assay. The results showed that the levels of leptin and non‑HMW adiponectin were significantly higher in CRC patients compared with the controls (P<0.05). In addition, HMW adiponectin was significantly higher in patients receiving chemotherapy. The association between LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms and CRC was not significant (P>0.05). In conclusion, higher leptin and non‑HMW adiponectin levels may be associated with increased CRC. Chemotherapy may positively influence the levels of HMW adiponectin. No association between LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms with CRC was found.

Introduction

Colorectal cancer (CRC) refers to a cancer that develops in the colon or in the rectum (1). CRC is characterized by an uncontrollable growth of cells in the terminal regions of the digestive system. CRC is the third most frequently diagnosed malignancy and the fourth leading cause of cancer-related death worldwide (2). In Jordan, the statistics show that CRC is the second most frequently diagnosed cancer and the second leading cause of cancer-related death in both males and females (3).

Obesity has been shown to contribute to an increased risk of cardiovascular disease and type 2 diabetes mellitus (DM) (4-6). Additionally, obesity was identified as a risk factor in the development of cancer and cancer-related death (7-9). According the American Cancer Society, excess body weight is hypothesized to be responsible for ~8% of all types of cancer in the United States, as well as ~7% of all cancer deaths (10). Overweight teenagers with colon cancer have a 2x risk of mortality in adulthood (11).

Adipose tissue dysfunction is one hypothesis that may link obesity and CRC due to secretion of several hormones called adipokines, the most important of which are leptin and adiponectin (12). Leptin, the product of the ob gene, is a 16 kDa peptide cytokine, which is produced exclusively by adipose tissues. Leptin primarily regulates food intake and energy expenditure (13), and its concentration is positively correlated with the body mass index (BMI), and is thus higher in obese individuals (14). Several experimental studies have shown that leptin has a mitogenic, antiapoptotic and tumorigenic effect on different cancer cell lines, including colorectal, lung, breast, thyroid, pancreatic and uterine cancer cells (15-17). In addition, in CRC tissues, it was found that leptin and its receptor were significantly upregulated compared with normal tissues and its upregulation was associated with a more advanced tumor phenotype (18,19).

Adiponectin is a protein with a molecular weight of 30 kDa which is derived primarily from adipocytes (20). Its anti-atherogenic and anti-inflammatory properties, as well as its ability to sensitize cells to insulin are considered the most important functions of adiponectin (21). Adiponectin circulates in the blood in different forms including as a trimer, hexamer and high-molecular weight (HMW) complexes. These forms were found to have different biological activities (22). For example, HMW adiponectin affects insulin sensitivity, whereas the anti-inflammatory activity of the non-HMW is its prominent effects (23).

An inverse relationship between obesity, insulin resistance, type 2 DM and the serum levels of adiponectin has been identified (24). Obesity and DM are associated with a higher incidence of CRC (25). Studies have found that lower levels of total adiponectin are associated with an increased risk of colorectal cancer (26,27). Conversely, other studies have found higher levels of total adiponectin in patients with CRC compared with the control (28,29). Thus, additional studies are required to highlight the association between adiponectin levels and CRC.

The aims the present study were to determine the relationship between leptin and adiponectin levels on the risk of CRC and response to chemotherapy. Furthermore, the association between LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms and CRC occurrence were investigated.

Materials and methods

Ethical approval

The present study was approved by the Institutional Review Board of Jordan University of Science and Technology (approval no. 80/2012). Written informed consent was obtained from all study participants.

Study population and blood collection

Blood samples were collected at King Abdullah University Hospital, including 32 CRC patients who were histopathologically diagnosed with colorectal adenocarcinoma; 13 of these were female and 19 were male. The median age was 52 years old (age range, 21-75 years). Additionally, 25 healthy volunteers were recruited of which, 5 were female and 20 were male. The median age was 30 years old (age range, 18-59 years). Samples of control individuals were chosen from fully healthy subjects with a similar BMI. Exclusion criteria were: i) A previous gastrointestinal tract surgery; ii) inflammatory bowel disease (ulcerative colitis or Crohn's disease); iii) patients with a cancer in a different organ; iv) acute or chronic infections; v) familial adenomatous polyposis; vi) autoimmune disease; vii) rheumatoid arthritis; viii) malnutrition; ix) other primary cachectic states (such as congestive pulmonary disease or cirrhosis); or x) lack of consent to participate in the study. Data regarding the histopathological diagnosis, staging of CRC patients, whether patients started on chemotherapy and the number of cycles given, were retrieved from the medical records. The CRC patients were classified according to the Tumor-Node-Metastasis staging system and Dukes's classification (30,31).

Blood samples, which were collected from all patients and controls in the morning, were split equally in to two different tubes (plain and EDTA tubes). The serum blood obtained from the plain tubes was allowed to coagulate at room temperature for 30 min, and then centrifuged at 1,968 x g for 10 min at 4˚C. The supernatant was separated from the samples and transferred into PCR tubes (100 µl), and stored at -20˚C until required. The EDTA blood samples were stored at -8˚C until required.

Biochemical analysis

Serum concentrations of leptin, and adiponectin (total and HMW) were measured using ALPCO Immunoassay kits using ELISA. Leptin levels were determined according to the manufacturer's protocol (Leptin ELISA kit; cat. no. 11-LEPHU-E01; sensitivity, 0.5 ng/ml; ALPCO). Plasma concentrations of adiponectin (total and HMW) were analyzed according to manufacturer's protocol [Adiponectin (Multimeric) ELISA kit; cat. no. 47-ADPHU-E01; sensitivity, 0.019 ng/ml, ALPCO].

DNA extraction and genotyping

The DNA was extracted from the EDTA blood samples of CRC patients and control participants according to the manufacturer's protocol (Wizard Genomic DNA Purification kit; Promega corporation). The LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms were analyzed by PCR-restriction fragment length polymorphism assay. The sequences of the primers were designed according to their sequence gene and purchased from Integrated DNA Technologies, Inc. (Table I).

Table I

Primer sequences.

Table I

Primer sequences.

GenotypePrimer, 5'-3'
LEP R (rs6588147)
     Forward GCATATGCCTGTGTGCAGTT
     Reverse GCAGTTCTGGATCAGTGCAA
ADIPO (rs266729)
     Forward CATCAGAATGTGTGGCTTGC
     Reverse AGAAGCAGCCTGGAGAACTG
LEP (rs2167270)
     Forward GATCGGGCCGCTATAAGAG
     Reverse GCATCCCTCCTGACTCAGTT
ADIPO (rs822369)
     Forward CTGAAGTTTGGGGACAAACAG
     Reverse CTTTTCTGCTGGGAAACAGG

Amplification of the 194 and 163 bp PCR products for LEPR (rs6588147) and ADIPO (rs266729), respectively, was performed using the following thermocycling conditions: Initial denaturation at 95˚C for 5 min; followed by 35 cycles of 95˚C, 54˚C and 72˚C for 90 sec each; and a final extension at 72˚C for 7 min. Amplification of the 176 and 214 bp PCR products for LEP (rs2167270) and ADIPO (rs822369), respectively, was performed as follows: Initial denaturation at 95˚C for 5 min; followed by 35 cycles of 95˚C, 53˚C and 72˚C for 90 sec each; and a final extension at 72˚C for 7 min. Amplification was performed on a Kyratec SuperCycler SC200 and the corresponding included software (software version 3.0.1, Hardware Version 3; Kyratec).

Statistical analysis

Data are presented as the mean ± standard deviation. SPSS version 25 (IBM, Corp.) was used for statistical analysis. A χ2 test was used to assess differences amongst categorical groups, whereas a Student's t-test (two-tailed) was used to compare differences between continuous variables. A one-way ANOVA followed by a Bonferroni post-hoc test was used to compare differences between >2 groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Demographics and biomarkers

There was no significant difference in the demographics between the patients and control groups. Plasma concentrations of leptin were significantly higher in the CRC group compared with the control group (P<0.05). Compared with the controls, non-HMW adiponectin levels were significantly higher in CRC patients. However, serum concentrations of both total and HMW adiponectin were not significantly different between the two groups (Table II).

Table II

Demographic and biomarkers in controls vs. CRC patients.

Table II

Demographic and biomarkers in controls vs. CRC patients.

CharacteristicValueControlsCRC patientsP-value
Sex, n (%)   0.096
     Male39 (68.4)20 (35.1)19 (33.3) 
     Female18 (31.6)5 (8.8)13 (22.8) 
Age, years52.85±11.5152.80±11.4654.10±13.580.001b
Body mass index, kg/m225.90±4.2824.31±3.2627.26±4.620.01a
Leptin, ng/ml10.17±8.647.13±7.5912.35±8.790.026a
Total adiponectin, ng/ml 3,459.84±1,911.42 3,051.21±1,162.42 3,753.54±2,278.680.181
HMW adiponectin, ng/ml 924.81±1,326.86 1,175.84±1,206.90 744.39±1,397.400.238
Non-HMW adiponectin, ng/ml0.244±.264 1,875.36±.1,079.18 3,009.15±1,856.580.011a

[i] aP<0.05,

[ii] bP<0.01. Data are presented as the mean ± standard deviation unless otherwise is indicated. HMW, high molecular weight.

Table III shows that the sex, age and BMI variations amongst CRC patients were not significantly associated with leptin, total adiponectin, HMW adiponectin or non-HMW adiponectin levels. Nevertheless, in patients aged <40 years, HMW adiponectin was significantly higher compared with patients >40 years.

Table III

Association between biomarkers and characteristics of patients.

Table III

Association between biomarkers and characteristics of patients.

Characteristic (n)LeptinTotal adiponectinHMW adiponectinNon-HMW adiponectin
Sex
     Male (19)10.91±8.95 3,714.77±2,615.12 674.55±1,553.16 3,040.22±2,206.16
     Female (13)14.46±8.46 3,810.20±1,774.69 846.46±1,186.19 2,963.74±1,264.91
Age, yearsb
     <40(4)15.48±8.69 5,244.59±1,310.39 1,859.1±1,671.46a 3,385.49±537.07
     40-60(14)12.36±7.27 2,706.97±1,429.06310.08±2,90.80 2,396.88±1,327.58
     >60(11)13.69±10.78 4,126.87±2,803.74382.49±565.81 3,744.37±2,592.83
Body mass index, kg/m2b
     <24.99(8)9.47±9.01 4,348.27±3,561.70 1,038.84±1,359.09 3,309.42±3,163.05
     25-29.99(13)12.34±7.82 3,274.84±1,466.06362.27±390.93 2,912.56±1,360.60
     >30(8)19.16±8.51 3,277.26±1,529.37390.93±515.41 2,993.47±1,175.47

[i] aP<0.05.

[ii] bData missing for 3 patients. Data are presented as the mean ± standard deviation. HMW, high molecular weight.

Comorbidities of CRC patients

The majority of the patients enrolled in the present study were free of any chronic disease (56.3%), whereas 4 patients (12.5%) had DM either alone (1 patient, 3.1%) or with another comorbidity, such as hypertension (HTN), chronic kidney disease (CKD) or hyperlipidemia (3 patients, 9.4%). HTN was observed in (7 patients, 21.9%), of whom 5 patients (15.6%) had HTN alone, whereas 2 patients (6.3%) had HTN and ischemic heart disease. The data of the 3 patients with comorbidities was not recorded.

Association between biomarkers and diagnosis, duration, disease stage and chemotherapy cycles

The CRC patients who were on chemotherapy had significantly higher levels of HMW adiponectin compared with those who did not take chemotherapy (Table IV). For the duration of diagnosis, disease stage, chemotherapy cycles and biomarkers were not significant different between the control and CRC patients.

Table IV

Association between biomarkers and duration of diagnosis, stages, chemotherapy and the number of cycles of chemotherapy in patients.

Table IV

Association between biomarkers and duration of diagnosis, stages, chemotherapy and the number of cycles of chemotherapy in patients.

ParameterLeptinTotal adiponectinHMW adiponectinNon-HMW adiponectin
Duration of diagnosis, years (n)
     0-1(7)13.05±9.25 2,455.18±888.06269.66±155.98 2,185.52±890.47
     1-2(14)12.61±8.51 3,456.60±1,779.24 608.90±1,128.98 2,847.69±1,365.38
     2-5(7)12.86±8.58 5,050.55±3,296.51776.62±683.90 4,273.93±3,093.65
     >5(1)27.63,338.96136.363,202.59
Disease stage (n)
     Stage I (3)12.76±6.57 2,706.25±1,206.2759.88±21.63 2,669.32±1,236.92
     Stage II (5)17.94±9.17 3,252.59±1,795.73407.11±637.04 2,845.48±1,674.51
     Stage III (9)10.04±7.47 3,090.12±1,697.61 724.42±1,309.33 2,365.70±902.13
Chemotherapy (n)
     Yes (13)b16.07±8.72 4,024.19±1,613.17 921.17±1,174.39a 3,103.01±1,111.27
     No (16)11.03±8.22 3,247.31±2,579.27250.60±241.65 2,996.71±2,419.77
Treatment cycles (n)
     1-3(3)26.40±3.79 2,287.80±192.22174.61±128.662,113.20±97.41
     4-6(5)7.34±5.20 6,857.99±2,983.28 1,389.12±1,630.81 5,468.86±3,253.69
     ≥7(5)17.86±6.36 3,642.25±1,367.20916.47±684.18 2,910.86±8,36.91

[i] aP<0.05. HMW, high molecular weight.

[ii] bThe majority of patients received FOLFOX4 chemotherapy regimen except one patient who received FOLFOX4 plus bevacizumab. Data are presented as the mean ± standard deviation. FOLFOX4, Oxaliplatin, Leucovorin, 5-Fluorouracil.

Incidence of polymorphisms

There was no significant difference between CRC patients and control subjects in the frequency of LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms (P>0.05; Table V).

Table V

Incidence of polymorphisms in control vs. patients.

Table V

Incidence of polymorphisms in control vs. patients.

GenotypeTotal samples, n (%)Controls, n (%)CRC patients, n (%)P-value
LEPR (rs6588147)   0.317
     AA29 (53.7)14 (25.9)15 (27.8) 
     AG20 (37.0)6 (11.1)14 (25.9) 
     GG5 (9.3)3 (5.6)2 (3.7) 
ADIPO (rs266729)   0.541
     CC30 (55.6)11 (20.4)19 (35.2) 
     CG19 (35.2)10 (18.5)9 (16.7) 
     GG5 (9.3)2 (3.7)3 (5.6) 
LEP (rs2167270)   0.795
     GG21 (38.9)8 (14.8)13 (24.1) 
     GA23 (42.6)11 (20.4)12 (22.2) 
     AA10 (18.5)4 (7.4)6 (11.1) 
ADIPO (rs822396)   0.152
     AA10 (18.5)7 (13.0)3 (5.6) 
     AG11 (20.4)4 (7.4)7 (13.0) 
     GG33 (61.1)12 (22.2)21 (38.9) 

[i] CRC, colorectal cancer.

Discussion

The present study showed that leptin and non-HMW adiponectin levels were significantly higher in CRC patients compared with the controls. In addition, HMW adiponectin levels were significantly higher in patients who received chemotherapy compared with those who did not, whereas leptin levels were not significantly different between patients who received chemotherapy and those who did not. In addition, there was no association between LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms and CRC.

The association between leptin levels and CRC remains controversial. In a prospective study, leptin concentration was found to be similar in CRC patients compared with the controls (32), whereas other studies reported a significant decrease in leptin serum levels in CRC patients (33,34). In agreement with the present study, studies have shown that leptin is significantly associated with CRC occurrence (35,36), and this may due to the established tumorigenic, mitogenic and antiapoptotic effects of leptin (15,16). However, sex differences between control (5 females, 20 males) and CRC patients (13 females, 19 males) may influence leptin levels. Previous studies have shown females have 2-3 times higher levels of leptin than males regardless of BMI; higher fat mass may explain the higher levels of leptin in circulation in females compared with males (37-39). Therefore, in the present study, it is possible that sex variations may have contributed to the higher levels of leptin shown amongst CRC patients.

The results of the present study showed higher levels of non-HMW adiponectin in CRC patients compared with the control group, which may be closely associated with CRC occurrence. In contrast, a meta-analysis indicated that a low circulating non-HMW fraction may be considered as a risk factor for CRC (40). Increased levels of non-HMW adiponectin in CRC patients shown in the present study may be associated with the involvement of non-HMW adiponectin in the regulation of inflammatory processes, which is considered a key factor in cancer progression and metastasis in various types of cancer including CRC (23,41). However, the exact mechanism that may explain the higher levels of non-HMW adiponectin in CRC patients is unknown, and further studies are required to this end.

In the present study, CRC patients receiving chemotherapy had significantly higher HMW adiponectin levels compared with those who did not receive chemotherapy. Thus, it is likely that chemotherapy may have resulted in such an elevation. However, no significant difference in leptin levels was detected in patients who received chemotherapy compared with those who did not. A previous study has reported that adiponectin levels are increased after receiving chemotherapy in patients with CRC who exhibited a partial response (42) and in patients with lung cancer (43). These results may indicate that adiponectin levels are sensitive to chemotherapy (44). Therefore, further studies are required to evaluate the potential value of adiponectin levels as predictive or prognostic markers for the chemotherapy response (45); specifically, HMW adiponectin.

The results of the present study showed there was no association between LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) polymorphisms and CRC. In agreement, Carvajal-Carmona et al (46) did not find an association between the ADIPO (rs266729) polymorphisms and CRC. However, previous studies have reported an association between these variants and CRC, particularly LEP (rs2167270) and ADIPO (rs266729) (47-49). The difference in the ethnic groups and the smaller number of samples may explain the differences in results.

The present study was performed on CRC patients from a large health center; however, it has some limitations. First, a small number of patients were enrolled. Secondly, due to the limited number of participants and less willingness of female participants to be involved in the study, we could not match for sex between control and patient group. Thirdly, due to sample size limitations, the results of this study are based only on univariate analyses. Finally, the effect of leptin on migration and invasion of CRC was not investigated. Thus, a future study that is more comprehensive and addressing whether leptin promotes migration and invasion in CRC patients is required.

In conclusion, the present study showed that higher plasma levels of leptin and non-HMW adiponectin may be associated with an increased risk of CRC, whereas HMW adiponectin levels may increase with chemotherapeutic regimens. The polymorphisms of LEPR (rs6588147), ADIPO (rs266729), LEP (rs2167270) and ADIPO (rs822369) were not associated with CRC.

Acknowledgements

Not applicable.

Funding

This study was supported by funding from the Deanship of Research at Jordan University of Science and Technology (grant no. 80/2012).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

NMM designed the study, assisted in collection of patient samples, contributed to the analysis and interpretation of the data, and assisted in manuscript writing. KHA was involved in the study conception and design, sample analysis and interpretation, and assisted in writing the manuscript. MAK participated in study design, collection of patient data, performed the molecular analysis of the samples, and assisted in manuscript writing. MNB was involved in the study design, subject recruitment and data interpretation. NH participated in study design, assisted in molecular analysis of the samples, and in manuscript writing. TMA was involved in study design, participated in collection of patient samples, interpretation of results and manuscript writing. All authors have read and approved the final manuscript.

Ethics approval and consent to participate

The present study was approved by the Institutional Review Board of Jordan University of Science and Technology (approval no. 80/2012). Written informed consent was obtained from all study participants.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

American Cancer Society: About colorectal cancer-overview and types. American Cancer Society, Inc., Atlanta GA, 2018. urihttps://www.cancer.org/cancer/colon-rectal-cancer/about.htmlsimplehttps://www.cancer.org/cancer/colon-rectal-cancer/about.html.

2 

Arnold M, Sierra MS, Laversanne M, Soerjomataram I, Jemal A and Bray F: Global patterns and trends in colorectal cancer incidence and mortality. Gut. 66:683–691. 2017.PubMed/NCBI View Article : Google Scholar

3 

Sharkas GF, Arqoub KH, Khader YS, Tarawneh MR, Nimri OF, Al-Zaghal MJ and Subih HS: Colorectal cancer in Jordan: Survival rate and its related factors. J Oncol. 2017(3180762)2017.PubMed/NCBI View Article : Google Scholar

4 

Calle EE, Thun MJ, Petrelli JM, Rodriguez C and Heath CW Jr: Body-mass index and mortality in a prospective cohort of U.S. adults. N Engl J Med. 341:1097–1105. 1999.PubMed/NCBI View Article : Google Scholar

5 

Hubert HB, Feinleib M, McNamara PM and Castelli WP: Obesity as an independent risk factor for cardiovascular disease: A 26-year follow-up of participants in the Framingham heart study. Circulation. 67:968–77. 1983.PubMed/NCBI View Article : Google Scholar

6 

Mokdad AH, Ford ES, Bowman BA, Nelson DE, Engelgau MM, Vinicor F and Marks JS: Diabetes trends in the U.S.: 1990-1998. Diabetes Care. 23:1278–1283. 2000.PubMed/NCBI View Article : Google Scholar

7 

World Cancer Research Fund, American Institute for Cancer Research (AICR): Food, nutrition, physical activity, and the prevention of cancer: A global perspective. AICR, Washington, DC, 2007.

8 

Ungefroren H, Gieseler F, Fliedner S and Lehnert H: Obesity and cancer. Horm Mol Biol Clin Investig. 21:5–15. 2015.PubMed/NCBI View Article : Google Scholar

9 

Colditz GA, Wolin KY and Gehlert S: Applying what we know to accelerate cancer prevention. Sci Transl Med. 4(127rv4)2012.PubMed/NCBI View Article : Google Scholar

10 

American Cancer Society: Body weight and cancer risk. American Cancer Society, Inc., Atlanta GA, 2015. urihttps://www.cancer.org/cancer/cancer-causes/diet-physical-activity/body-weight-and-cancer-risk/effects.htmlsimplehttps://www.cancer.org/cancer/cancer-causes/diet-physical-activity/body-weight-and-cancer-risk/effects.html.

11 

Bjørge T, Engeland A, Tverdal A and Smith GD: Body mass index in adolescence in relation to cause-specific mortality: A follow-up of 230,000 Norwegian adolescents. Am J Epidemiol. 168:30–37. 2008.PubMed/NCBI View Article : Google Scholar

12 

van Kruijsdijk RC, van der Wall E and Visseren FL: Obesity and cancer: The role of dysfunctional adipose tissue. Cancer Epidemiol Biomarkers Prev. 18:2569–2578. 2009.PubMed/NCBI View Article : Google Scholar

13 

Zhang Y, Proenca R, Maffei M, Barone M, Leopold L and Friedman JM: Positional cloning of the mouse obese gene and its human homologue. Nature. 372:425–432. 1994.PubMed/NCBI View Article : Google Scholar

14 

Münzberg H and Myers MG Jr: Molecular and anatomical determinants of central leptin resistance. Nat Neurosci. 8:566–570. 2005.PubMed/NCBI View Article : Google Scholar

15 

Hardwick JCH, Van Den Brink GR, Offerhaus GJ, Van Deventer SJH and Peppelenbosch MP: Leptin is a growth factor for colonic epithelial cells. Gastroenterology, 2001.

16 

Aparicio T, Kotelevets L, Tsocas A, Laigneau JP, Sobhani I, Chastre E and Lehy T: Leptin stimulates the proliferation of human colon cancer cells in vitro but does not promote the growth of colon cancer xenografts in nude mice or intestinal tumorigenesis in Apc(Min/+) mice. Gut. 54:1136–1145. 2005.PubMed/NCBI View Article : Google Scholar

17 

Samad N and Rao T: Role of leptin in cancer: A systematic review. Biomed J Sci Tech Res. 18:13226–13235. 2019.

18 

Paik SS, Jang SM, Jang KS, Lee KH, Choi D and Jang SJ: Leptin expression correlates with favorable clinicopathologic phenotype and better prognosis in colorectal adenocarcinoma. Ann Surg Oncol. 16:297–303. 2009.PubMed/NCBI View Article : Google Scholar

19 

Koda M, Sulkowska M, Kanczuga-Koda L, Surmacz E and Sulkowski S: Overexpression of the obesity hormone leptin in human colorectal cancer. J Clin Pathol. 60:902–906. 2007.PubMed/NCBI View Article : Google Scholar

20 

Viengchareun S, Zennaro MC, Pascual-Le Tallec L and Lombes M: Brown adipocytes are novel sites of expression and regulation of adiponectin and resistin. FEBS Lett. 532:345–350. 2002.PubMed/NCBI View Article : Google Scholar

21 

Beltowski J: Adiponectin and resistin-new hormones of white adipose tissue. Med Sci Monit. 9:RA55–RA61. 2003.PubMed/NCBI

22 

Liu M and Liu F: Regulation of adiponectin multimerization, signaling and function. Best Pract Res Clin Endocrinol Metab. 28:25–31. 2014.PubMed/NCBI View Article : Google Scholar

23 

Aleksandrova K, Jenab M, Bueno-de-Mesquita HB, Fedirko V, Kaaks R, Lukanova A, van Duijnhoven FJ, Jansen E, Rinaldi S, Romieu I, et al: Biomarker patterns of inflammatory and metabolic pathways are associated with risk of colorectal cancer: Results from the European prospective investigation into cancer and nutrition (EPIC). Eur J Epidemiol. 29:261–275. 2014.PubMed/NCBI View Article : Google Scholar

24 

Chandran M, Phillips SA, Ciaraldi T and Henry RR: Adiponectin: More than just another fat cell hormone? Diabetes Care. 26:2442–2450. 2003.PubMed/NCBI View Article : Google Scholar

25 

Giovannucci E and Michaud D: The role of obesity and related metabolic disturbances in cancers of the colon, prostate, and pancreas. Gastroenterology. 132:2208–2225. 2007.PubMed/NCBI View Article : Google Scholar

26 

Catalán V, Gómez-Ambrosi J, Rodríguez A, Ramírez B, Silva C, Rotellar F, Hernández-Lizoain JL, Baixauli J, Valentí V, Pardo F, et al: Up-regulation of the novel proinflammatory adipokines lipocalin-2, chitinase-3 like-1 and osteopontin as well as angiogenic-related factors in visceral adipose tissue of patients with colon cancer. J Nutr Biochem. 22:634–641. 2011.PubMed/NCBI View Article : Google Scholar

27 

Kemik O, Kemik AS, Begenik H, Erdur FM, Emre H, Sumer A, Purisa S, Tuzun S and Kotan C: The relationship among acute-phase responce proteins, cytokines, and hormones in various gastrointestinal cancer types patients with cachectic. Hum Exp Toxicol. 31:117–125. 2012.PubMed/NCBI View Article : Google Scholar

28 

Al Khaldi RM, Al Mulla F, Al Awadhi S, Kapila K and Mojiminiyi OA: Associations of single nucleotide polymorphisms in the adiponectin gene with adiponectin levels and cardio-metabolic risk factors in patients with cancer. Dis Markers. 30:197–212. 2011.PubMed/NCBI View Article : Google Scholar

29 

Zekri AR, Bakr YM, Ezzat MM, Zakaria MS and Elbaz TM: Circulating levels of adipocytokines as potential biomarkers for early detection of colorectal carcinoma in Egyptian patients. Asian Pacific J Cancer Prev. 16:6923–6928. 2015.PubMed/NCBI View Article : Google Scholar

30 

American Joint Committee on Cancer: Chapter 20-Colon and rectum. In: AJCC cancer staging manual. 8th edition. Springer, New York, NY, 2017.

31 

Dukes CE: The classification of cancer of the rectum. Dis Colon Rectum. 23:605–611. 1980.

32 

Tessitore L, Vizio B, Jenkins O, De Stefano I, Ritossa C, Argiles JM, Benedetto C and Mussa A: Leptin expression in colorectal and breast cancer patients. Int J Mol Med. 5:421–426. 2000.PubMed/NCBI View Article : Google Scholar

33 

Kumor A, Daniel P, Pietruczuk M and Małecka-Panas E: Serum leptin, adiponectin, and resistin concentration in colorectal adenoma and carcinoma (CC) patients. Int J Colorectal Dis. 24:275–281. 2009.PubMed/NCBI View Article : Google Scholar

34 

Sălăgeanu A, Tucureanu C, Lerescu L, Caras I, Pitica R, Gangurà G, Costea R and Neagu S: Serum levels of adipokines resistin and leptin in patients with colon cancer. J Med Life. 3:416–420. 2010.PubMed/NCBI

35 

Ho GYF, Wang T, Gunter MJ, Strickler HD, Cushman M, Kaplan RC, Wassertheil-Smoller S, Xue X, Rajpathak SN, Chlebowski RT, et al: Adipokines linking obesity with colorectal cancer risk in postmenopausal women. Cancer Res. 72:3029–3037. 2012.PubMed/NCBI View Article : Google Scholar

36 

Kim HR: Obesity-related colorectal cancer: The role of leptin. Ann Coloproctol. 31:209–210. 2015.PubMed/NCBI View Article : Google Scholar

37 

Hellström L, Wahrenberg H, Hruska K, Reynisdottir S and Arner P: Mechanisms behind gender differences in circulating leptin levels. J Intern Med. 247:457–462. 2000.PubMed/NCBI View Article : Google Scholar

38 

Saad MF, Damani S, Gingerich RL, Riad-Gabriel MG, Khan A, Boyadjian R, Jinagouda SD, el-Tawil K, Rude RK and Kamdar V: Sexual dimorphism in plasma leptin concentration. J Clin Endocrinol Metab. 82:579–584. 1997.PubMed/NCBI View Article : Google Scholar

39 

Licinio J, Negrão AB, Mantzoros C, Kaklamani V, Wong ML, Bongiorno PB, Negro PP, Mulla A, Veldhuis JD, Cearnal L, et al: Sex differences in circulating human leptin pulse amplitude: Clinical implications. J Clin Endocrinol Metab. 83:4140–4147. 1998.PubMed/NCBI View Article : Google Scholar

40 

Lu W, Huang Z, Li N and Liu H: Low circulating total adiponectin, especially its non-high-molecular weight fraction, represents a promising risk factor for colorectal cancer: A meta-analysis. Onco Targets Ther. 11:2519–2531. 2018.PubMed/NCBI View Article : Google Scholar

41 

Rossi S, Basso M, Strippoli A, Schinzari G, D'Argento E, Larocca M, Cassano A and Barone C: Are markers of systemic inflammation good prognostic indicators in colorectal cancer? Clin Colorectal Cancer. 16:264–274. 2017.PubMed/NCBI View Article : Google Scholar

42 

Słomian G, Świętochowska E, Nowak G, Pawlas K, Żelazko A and Nowak P: Chemotherapy and plasma adipokines level in patients with colorectal cancer. Postepy Hig Med Dosw (Online). 71:281–290. 2017.PubMed/NCBI View Article : Google Scholar

43 

Seker MM, Sancakdar E, Nadir A, Altun G, Bahceci A, Kacan T, Babacan NA and Kaptanoglu M: Serum leptin and adiponectin levels and relationship with prognosis in lung cancer. J Clin Oncol. 32 (15 Suppl)(e19114)2014.

44 

Moschovi M, Trimis G, Vounatsou M, Katsibardi K, Margeli A, Damianos A, Chrousos G and Papassotiriou I: Serial plasma concentrations of adiponectin, leptin, and resistin during therapy in children with acute lymphoblastic leukemia. J Pediatr Hematol Oncol. 32:e8–e13. 2010.PubMed/NCBI View Article : Google Scholar

45 

Ayoub N, Alkhatatbeh M, Jibreel M and Ababneh M: Analysis of circulating adipokines in patients newly diagnosed with solid cancer: Associations with measures of adiposity and tumor characteristics. Oncol Lett. 13:1974–1982. 2017.PubMed/NCBI View Article : Google Scholar

46 

Carvajal-Carmona LG, Spain S, CORGI Consortium, Kerr D, Houlston R, Cazier JB and Tomlinson I: Common variation at the adiponectin locus is not associated with colorectal cancer risk in the UK. Hum Mol Genet. 18:1889–1892. 2009.PubMed/NCBI View Article : Google Scholar

47 

Partida-Pérez M, de la Luz Ayala-Madrigal M, Peregrina-Sandoval J, Macías-Gómez N, Moreno-Ortiz J, Leal-Ugarte E, Cárdenas-Meza M, Centeno-Flores M, Maciel-Gutiérrez V, Cabrales E, et al: Association of LEP and ADIPOQ common variants with colorectal cancer in Mexican patients. Cancer Biomark. 7:117–121. 2010.PubMed/NCBI View Article : Google Scholar

48 

Slattery ML, Wolff RK, Herrick J, Caan BJ and Potter JD: Leptin and leptin receptor genotypes and colon cancer: Gene-gene and gene-lifestyle interactions. Int J Cancer. 122:1611–1617. 2008.PubMed/NCBI View Article : Google Scholar

49 

Yang X, Li J, Cai W, Yang Q, Lu Z, Yu J, Yu H, Zhang N, Sun D, Qu Y, et al: Adiponectin gene polymorphisms are associated with increased risk of colorectal cancer. Med Sci Monit. 21:2595–606. 2015.PubMed/NCBI View Article : Google Scholar

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Mhaidat NM, Alzoubi KH, Kubas MA, Banihani MN, Hamdan N and Al‑Jaberi TM: High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms. Biomed Rep 14: 13, 2021.
APA
Mhaidat, N.M., Alzoubi, K.H., Kubas, M.A., Banihani, M.N., Hamdan, N., & Al‑Jaberi, T.M. (2021). High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms. Biomedical Reports, 14, 13. https://doi.org/10.3892/br.2020.1389
MLA
Mhaidat, N. M., Alzoubi, K. H., Kubas, M. A., Banihani, M. N., Hamdan, N., Al‑Jaberi, T. M."High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms". Biomedical Reports 14.1 (2021): 13.
Chicago
Mhaidat, N. M., Alzoubi, K. H., Kubas, M. A., Banihani, M. N., Hamdan, N., Al‑Jaberi, T. M."High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms". Biomedical Reports 14, no. 1 (2021): 13. https://doi.org/10.3892/br.2020.1389
Copy and paste a formatted citation
x
Spandidos Publications style
Mhaidat NM, Alzoubi KH, Kubas MA, Banihani MN, Hamdan N and Al‑Jaberi TM: High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms. Biomed Rep 14: 13, 2021.
APA
Mhaidat, N.M., Alzoubi, K.H., Kubas, M.A., Banihani, M.N., Hamdan, N., & Al‑Jaberi, T.M. (2021). High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms. Biomedical Reports, 14, 13. https://doi.org/10.3892/br.2020.1389
MLA
Mhaidat, N. M., Alzoubi, K. H., Kubas, M. A., Banihani, M. N., Hamdan, N., Al‑Jaberi, T. M."High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms". Biomedical Reports 14.1 (2021): 13.
Chicago
Mhaidat, N. M., Alzoubi, K. H., Kubas, M. A., Banihani, M. N., Hamdan, N., Al‑Jaberi, T. M."High levels of leptin and non‑high molecular weight‑adiponectin in patients with colorectal cancer: Association with chemotherapy and common genetic polymorphisms". Biomedical Reports 14, no. 1 (2021): 13. https://doi.org/10.3892/br.2020.1389
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team