Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
March 2013 Volume 5 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
March 2013 Volume 5 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis

  • Authors:
    • Ki-Tack Kim
    • Jinsung Kim
    • Yoo Jin Han
    • Jun Ho Kim
    • Jong Seok Lee
    • Joo-Ho Chung
  • View Affiliations / Copyright

    Affiliations: Department of Orthopedic Surgery, Spine Center, School of Medicine, Kyung Hee University Hospital at Gangdong, Seoul 134-727, Republic of Korea, Department of Physical Medicine and Rehabilitation, School of Medicine, Kyung Hee University, Seoul 130-701, Republic of Korea, Department of Pharmacology and Kohwang Medical Research Institute, School of Medicine, Kyung Hee University, Seoul 130-701, Republic of Korea, Department of Emergency Medicine, School of Medicine, Kyung Hee University, Seoul 130-701, Republic of Korea
  • Pages: 977-981
    |
    Published online on: January 21, 2013
       https://doi.org/10.3892/etm.2013.910
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Degenerative lumbar scoliosis (DLS) progresses with aging after 50-60 years. The genetic association of DLS remains largely unclear. In this study, the genetic association between glutamate receptor, ionotropic, N-methyl D-aspartate (NMDA, GRIN) receptor genes and DLS was investigated. A total of 9 coding single nucleotide polymorphisms (cSNPs) in NMDA receptor genes [GRIN2A (rs8049651, Leu425Leu; rs9806806, Tyr730Tyr); GRIN2B (rs7301328, Pro122Pro; rs35025065, Asp447Asp; rs1805522, Ile602Ile; rs1806201, Thr888Thr; rs1805247, His1399His); and GRIN2C (rs689730, Ala33Ala; rs3744215, Arg1209Ser)] were selected and genotyped using direct sequencing in 70 patients with DLS and 141 healthy controls. Multiple logistic models (codominant, dominant and recessive) were calculated for the odds ratio (OR), 95% confidence interval (CI) and corresponding P‑values. The SNPStats, SNPAnalyzer and HelixTree programs were used for the evaluation of the genetic data. Among the SNPs examined, no significant associations were observed between the NMDA receptor genes and DLS. When the patients were divided into two groups according to clinical characteristics based on Cobb's angle (<20˚ or ≥20˚) and lateral listhesis (<6 mm or ≥6 mm), associations were observed between rs689730 of GRIN2C and Cobb's angle (codominant, P=0.038; dominant, P=0.022) and between rs7301328 of GRIN2B and lateral listhesis (codominant, P=0.003; dominant, P=0.015; recessive, P=0.015). These results indicate that the GRIN2A, GRIN2B and GRIN2C genes do not affect the development of DLS. However, the GRIN2C gene may be associated with Cobb's angle, while the GRIN2B gene may be associated with lateral listhesis.

Introduction

Degenerative scoliosis develops after skeletal maturity without a previous history of scoliosis and typically presents in the lumbar or thoracolumbar spine (1,2). The etiology of degenerative lumbar scoliosis (DLS) remains unclear, although several factors, including hormones, genetics and degenerative diseases of the spine, may be involved (3). It has been suggested that the cause of DLS is associated with disc degeneration and osteoporosis (4).

During an individual’s lifetime, modeling, remodeling and repair of the bone occur as a result of the activity of osteoclasts and osteoblasts (5). The control of bone remodeling is performed by a few neurotransmitters, such as glutamate, via corresponding receptors in the bone cells (6). Glutamate is a major excitatory neurotransmitter in the central nervous system (CNS) (7) and acts through a variety of receptors including N-methyl-D-aspartate (NMDA) receptors. The NMDA receptors (NMDARs) are composed of NMDAR1, NMDAR2 and NMDAR3 and are expressed in the bone cells (8,9). In addition, glutamate is a known regulator of the maturation and differentiation of osteoclasts and osteoblasts (10,11).

We hypothesized that genetic polymorphisms in the NMDAR genes may be associated with DLS. However, there have been no published studies concerning the association between DLS and single nucleotide polymorphisms (SNPs) of NMDAR genes. Therefore, the 9 coding SNPs (cSNPs) of NMDAR2A (GRIN2A), NMDAR2B (GRIN2B) and NMDAR2C (GRIN2C) were analyzed in 70 patients with DLS and 141 control subjects.

Materials and methods

Subjects

The DLS group comprised 70 unrelated individuals (10 males and 60 females), aged 52–82 years (mean ± SD, 67.63±7.05 years). The DLS patients were selected from the Spine Center of Kyung Hee University East-West Neo Medical Center (Seoul, Korea) and the National Medical Center (Seoul, Korea), out of ∼9,000 patients per year over three years. Each patient was diagnosed by two specialized spine surgeons and all patients fulfilled the physical examination and radiographic criteria (Cobb’s angle, >10°). Informed consent was obtained from all individuals according to the Declaration of Helsinki guidelines. The study was approved by the Ethics Review Committee of the Medical Research Institute, Kyung Hee University Medical Center (Seoul, Korea). The control group comprised 141 individuals (25 males and 116 females), aged 53–85 years (mean ± SD, 66.74±8.23 years). Control group individuals were recruited following a general health check-up program to confirm that they had no clinical evidence of DLS according to radiographic criteria. The ages and genders of the control group individuals were matched to those of the DLS group (Table I).

Table I.

Characteristics of DLS and control subjects.

Table I.

Characteristics of DLS and control subjects.

FactorDLS (n=70)Controls (n=141)
Age (years, mean ± SD)67.63±7.0566.4±8.23
Gender (male/female)10/6025/116
Cobb’s angle (°, mean ± SD)17.07±2.95NA
Lateral listhesis (mm, mean ± SD)4.78±2.30NA

[i] DLS, degenerative lumbar scoliosis; NA, not applicable.

SNP genotyping

The cSNPs of GRIN2A, GRIN2B and GRIN2C were searched. Information relating to the cSNPs was obtained from the SNP database (www.ncbi.nlm.nih.gov/SNP; dbSNP Build 130) of the National Center for Biotechnology Information (NCBI). cSNPs with unknown heterozygosity and minor allele frequencies (<5%) were excluded. Finally, 9 cSNPs were selected [GRIN2A (rs8049651, Leu425Leu; rs9806806, Tyr730Tyr); GRIN2B (rs7301328, Pro122Pro; rs35025065, Asp447Asp; rs1805522, Ile602Ile; rs1806201, Thr888Thr; rs1805247, His1399His); and GRIN2C (rs689730, Ala33Ala; rs3744215, Arg1209Ser)] for analysis. Genomic DNA was extracted from blood samples collected in EDTA using a commercially available Qiagen DNA extraction kit (Qiagen, Tokyo, Japan). Genomic DNA was amplified using primers for each cSNP (Table II). The PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA). Sequence data were analyzed using SeqManII software (DNASTAR Inc., Madison, WI, USA).

Table II.

Sequences of primers for cSNPs of GRIN2A, GRIN2B and GRIN2C genes.

Table II.

Sequences of primers for cSNPs of GRIN2A, GRIN2B and GRIN2C genes.

GeneSNPDirectionSequence (5′→3′)Size (bp)
GRIN2Ars8049651, Leu425LeuForward GATTTGCCTCTCCAGAAATCAG321
Reverse CTATTTCAAAGGGTTGGGCACG
rs9806806Forward TGCATGCATTTACCTCCTAACA380
Tyr730TyrReverse AATGGGAGCAGATAGGAACTGA
GRIN2Brs7301328, Pro122ProForward CGAGAAAGATGATTTCCACCAT391
Reverse GATTAATTGCTGGCCTATCCAC
rs35025065, Asp447AspForward GGTCTGTTGCCTGCTTTATTTC322
Reverse CAGGTTCCATTGATTTTCTTCC
rs1805522, Ile602IleForward TGAGAGTCCCTGGAAAAGAGAG392
Reverse CCAGAAACCTGGTCCACATATT
rs1806201, Thr888ThrForward TTGTGGTCATTTCTAGCCTCTC371
Reverse CCGAACGTTCTCTCTACCTCAC
rs1805247, His1399HisForward CCTACGCCCACATGTTTGAGAT381
Reverse GGTTTTTGTTGTTAGGCACACA
GRIN2Crs689730, Ala33AlaForward AACCTCTGTCTCTCTCCCTGTG394
Reverse GGAGATGAAGTCAAGGATCTGG
rs3744215, Arg1209SerForward CTGTCTGTCCTCACCTTCCACC392
Reverse CACCATGATTTGAGGCTACTGA

[i] SNP, single nucleotide polymorphisms.

Statistical analysis

The Hardy-Weinberg equilibrium (HWE) was assessed using SNPStats (http://bioinfo.iconcologia.net/snpstats) (12). Multiple logistic regression models (codominant, dominant and recessive) were used to calculate the odds ratio (OR), 95% confidence interval (CI) and corresponding P-values, with age and gender as covariables. To analyze the associations of cSNPs and haplotypes, SNPStats, HapAnalyzer and HelixTree (Golden Helix, Inc., Bozeman, MT, USA) were used.

Results

Of the nine cSNPs of GRIN2A, GRIN2B and GRIN2C genes examined, eight were polymorphic and one (rs35025065) was monomorphic (Table III). The genotype distributions of the eight cSNPs were in HWE (P>0.05, data not shown).

Table III.

Genotype frequencies of cSNPs in GRIN2A, GRIN2B and GRIN2C genes.

Table III.

Genotype frequencies of cSNPs in GRIN2A, GRIN2B and GRIN2C genes.

DLS
Control
GeneSNPGenotypenFreq.nFreq.ModelsOR (95% CI)P-value
GRIN2Ars8049651, Leu425LeuC/C610.871230.87Codominant0.88 (0.40–1.94)0.76
C/T90.13160.11Dominant0.99 (0.42–2.35)0.99
T/T00.0020.01Recessive0.00 (0.00–NA)0.17
rs9806806, Tyr730TyrC/C630.901200.85Codominant0.60 (0.26–1.37)0.20
C/G70.10180.13Dominant0.64 (0.25–1.59)0.32
G/G00.0030.02Recessive0.00 (0.00–NA)0.11
GRIN2Brs7301328, Pro122ProC/C120.18310.22Codominant0.86 (0.57–1.29)0.46
G/C320.47610.43Dominant0.91 (0.49–1.69)0.77
G/G240.35490.35Recessive0.69 (0.32–1.46)0.32
rs1805522, Ile602IleA/A50.0770.05Codominant0.93 (0.57–1.51)0.76
G/A160.23410.29Dominant0.84 (0.45–1.56)0.58
G/G490.70930.66Recessive1.22 (0.36–4.16)0.75
rs1806201, Thr888ThrA/A140.21340.24Codominant0.89 (0.58–1.36)0.60
G/A370.54720.51Dominant0.95 (0.48–1.87)0.88
G/G170.25340.24Recessive0.77 (0.38–1.57)0.47
rs1805247, His1399HisA/A460.66910.65Codominant0.84 (0.50–1.40)0.50
A/G230.33420.30Dominant0.96 (0.53–1.77)0.91
G/G10.0180.06Recessive0.20 (0.02–1.68)0.08
GRIN2Crs689730, Ala33AlaC/C360.54810.58Codominant1.28 (0.77–2.13)0.34
C/T260.39560.40Dominant1.14 (0.63–2.06)0.66
T/T50.0730.02Recessive3.31 (0.76–14.48)0.10
rs3744215, Arg1209SerG/G260.39440.31Codominant0.97 (0.64–1.47)0.88
G/T270.40740.52Dominant0.75 (0.41–1.39)0.36
T/T140.21230.16Recessive1.38 (0.66–2.91)0.40

[i] SNP, single nucleotide polymorphism; cSNPs, coding SNPs; DLS, degenerative lumbar scoliosis; freq, frequency; OR, odds ratio; 95% CI, 95% confidence interval; NA, not applicable.

As shown in Table III, there was no significant difference in the genotypic frequency of polymorphism rs8049651 between the DLS (CC 87%, CG 13% and GG 0%) and control groups (CC 87%, CG 11% and GG 1%; P=0.76). Additionally, the other seven cSNPs were not associated with DLS. Via the Gabriel method (13), two cSNPs (rs1805247 and 1806201 of GRIN2B) were used to construct a one linkage disequilibrium (LD) block (data not shown). Three haplotypes in the block had frequencies >0.1. However, there was no significant difference in haplotype frequencies between the DLS and control groups (data not shown).

However, when DLS patients were divided into two groups according to clinical characters based on Cobb’s angle (<20° or ≥20°) and lateral listhesis (<6 mm or ≥6 mm), associations were observed between the GRIN2B and GRIN2C polymorphisms and clinical characteristics. As shown in Table IV, rs689730 of GRIN2C was associated with Cobb’s angle in the codominant (P=0.038; OR, 2.72; 95% CI, 0.98–7.55) and dominant models (P=0.022; OR, 3.79; 95% CI, 1.15–12.54). The present study showed that the CT or TT genotype frequency with Cobb’s angle ≥20° was ∼2-fold higher than with Cobb’s angle <20°. In the analysis of lateral listhesis, rs7301328 of GRIN2B showed significant differences in the codominant (P=0.0027; OR, 3.21; 95% CI, 1.41–7.29), dominant (P=0.015; OR, 3.91; 95% CI, 1.22–12.51) and recessive models (P=0.015; OR, 5.39; 95%CI, 1.26–23.08). The results indicated that the CC genotype frequency with lateral listhesis ≥6 mm was ∼4-fold higher than with lateral listhesis <6 mm (Table IV).

Table IV.

Genotype frequencies of rs689730 and rs7301328 in DLS patients with Cobb’s angle or lateral listhesis.

Table IV.

Genotype frequencies of rs689730 and rs7301328 in DLS patients with Cobb’s angle or lateral listhesis.

A, Cobb’s angle
<20°≥20°
SNPGenotypenFreq.nFreq.ModelOR (95% CI)P-value
GRIN2C,C/C150.75210.45Codominant2.72 (0.98–7.55)0.038
rs689730,C/T40.20220.47Dominant3.79 (1.15–12.54)0.022
Ala33AlaT/T10.0540.09Recessive1.82 (0.18–17.97)0.590
B, Lateral listhesis
<6 mm
≥6 mm
SNPGenotypenFreq.nFreq.ModelOR (95% CI)P-value
GRIN2B,C/C30.0890.32Codominant3.21 (1.41–7.29)0.003
rs7301328,G/C180.45140.50Dominant3.91 (1.22–12.51)0.015
Pro122ProG/G190.4850.18Recessive5.39 (1.26–23.08)0.015

[i] DLS, degenerative lumbar scoliosis; SNP, single nucleotide polymorphism; freq, frequency. OR, odds ratio; 95% CI, 95% confidence interval.

Discussion

A number of individuals present degenerative diseases of the spine, such as spondylolisthesis, lateral listhesis, spinal stenosis and degenerative scoliosis with increasing age (3,14). Scoliosis is a spinal deformity with lateral curvature or angulation and may be accompanied by rotation of the affected vertebrae in the vertical axis (15).

Complicated DLS induces severe back or leg pain with neurological deficits by compressing neural elements and causing nerve root ischemia (16). Despite uncertainty with regard to the etiology of DLS, degeneration of the spinal column occurs in the development of the disease (3). Considering that the etiology of DLS is unclear, the identification of candidate genes associated with the development of DLS may potentially be used to identify at-risk individuals. Therefore, the potential of NMDAR2 genes as candidate genes in the development of DLS was investigated through a case-control analysis in the current study.

Glutamate is the most prominent excitatory neurotransmitter in the CNS. It has been studied intensively in a number of neuropathological conditions, including stroke, epilepsy and neurodegenerative diseases (17,18). Glutamate exerts its effects through ionotropic ligand-gated ion channels and metabotropic G-protein-coupled glutamate receptors. The ionotropic receptors are further divided into NMDA, α-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA) and kainate receptors (19–21). Spencer et al(6) conducted a review of NMDA-type glutamate signalling.

In the current study, 9 cSNPs in the genes GRIN2A, GRIN2B and GRIN2C were analyzed to assess the association between these polymorphisms and DLS. The GRIN2A, GRIN2B and GRIN2C genes are located on chromosomes 16p13.2, 12p12 and 17q25, respectively. In the coding regions of each gene, 15, 22 and 14 cSNPs have been discovered, respectively. Of these 51 cSNPs, 9 exhibited heterozygosity >0.1 (www.ncbi.nlm.nih.gov/SNP, dbSNP Build 130) and were selected for analysis in thist study. Overall, none of the genotype frequencies or haplotype distributions of the NMDRs (GRIN2A, GRIN2B and GRIN2C) were observed to be associated with DLS.

Several studies have shown associations between SNPs of GRIN2A and/or GRIN2B and neurological or psychiatric diseases, such as Huntington’s disease (22), schizophrenia (23), bipolar disorder (24) and Alzheimer’s disease (25). In addition, Kim et al(26) reported that rs1806201 of GRIN2B was associated with alcoholism in a Korean population, but rs18054247 was not. However, Tadic et al(27) reported that rs1806201 was not associated with alcohol dependence, alcohol withdrawal-induced seizures and delirium tremens in a Caucasian population.

The possible associations between nine cSNPs of GRIN2A, GRIN2B and GRIN2C genes and DLS were investigated, but the results were negative. To compare each genotype frequency in various ethnic populations, the human SNP database (www.ncbi.nlm.nih.gov-SNP, dbSNP Build 130) was searched. The genotype distributions of all cSNPs in the control group were similar to those of the Asian populations, particularly the Japanese population (data not shown).

When the patients were divided into two groups according to clinical characteristics (Cobb’s angle and lateral listhesis), GRIN2B and GRIN2C were associated with the severity of DLS. As shown in Table IV, rs689730 of GRIN2C was associated with Cobb’s angle in the codominant (P=0.038) and dominant models (P=0.022). Furthermore, rs7301328 of GRIN2B was associated with lateral listhesis in the codominant (P=0.003), dominant (P=0.015) and recessive models (P=0.015).

The present results indicate that GRIN2A, GRIN2B and GRIN2C do not affect the development of DLS in the Korean population. However, significant associations were observed between GRIN2C and Cobb’s angle and between GRIN2B and lateral listhesis in DLS.

Acknowledgements

The authors would like to thank Eri Kwon for proofreading the manuscript in English.

References

1. 

Aebi M: The adult scoliosis. Eur Spine J. 14:925–948. 2005. View Article : Google Scholar

2. 

Ploumis A, Transfledt EE and Denis F: Degenerative lumbar scoliosis associated with spinal stenosis. Spine J. 7:428–436. 2007. View Article : Google Scholar

3. 

Oskouian RJ Jr and Shaffrey CI: Degenerative lumbar scoliosis. Neurosurg Clin N Am. 17:299–315. vii2006. View Article : Google Scholar : PubMed/NCBI

4. 

Daffner SD and Vaccaro AR: Adult degenerative lumbar scoliosis. Am J Orthop (Belle Mead NJ). 32:77–82. 2003.PubMed/NCBI

5. 

Skerry TM: The role of glutamate in the regulation of bone mass and architecture. J Musculoskelet Neuronal Interact. 8:166–173. 2008.PubMed/NCBI

6. 

Spencer GJ, McGrath CJ and Genever PG: Current perspectives on NMDA-type glutamate signalling in bone. Int J Biochem Cell Biol. 39:1089–1104. 2007. View Article : Google Scholar : PubMed/NCBI

7. 

Weinberg RJ: Glutamate: an excitatory neurotransmitter in the mammalian CNS. Brain Res Bull. 50:353–354. 1999. View Article : Google Scholar : PubMed/NCBI

8. 

Merle B, Itzstein C, Delmas PD and Chenu C: NMDA glutamate receptors are expressed by osteoclast precursors and involved in the regulation of osteoclastogenesis. J Cell Biochem. 90:424–436. 2003. View Article : Google Scholar : PubMed/NCBI

9. 

Hinoi E, Takarada T and Yoneda Y: Glutamate signaling system in bone. J Pharmacol Sci. 94:215–220. 2004. View Article : Google Scholar

10. 

Mason DJ: Glutamate signalling and its potential application to tissue engineering of bone. Eur Cell Mater. 7:12–26. 2004.PubMed/NCBI

11. 

Lin TH, Yang RS, Tang CH, Wu MY and Fu WM: Regulation of the maturation of osteoblasts and osteoclastogenesis by glutamate. Eur J Pharmacol. 589:37–44. 2008. View Article : Google Scholar : PubMed/NCBI

12. 

Solé X, Guinó E, Valls J, Iniesta R and Moreno V: SNPStats: a web tool for the analysis of association studies. Bioinformatics. 22:1928–1929. 2006.

13. 

Gabriel SB, Schaffner SF, Nguyen H, et al: The structure of haplotype blocks in the human genome. Science. 296:2225–2229. 2002. View Article : Google Scholar : PubMed/NCBI

14. 

Liao JC, Chen WJ, Chen LH and Niu CC: Outcome of the L5-S1 segment after posterior instrumented spinal surgery in degenerative lumbar diseases. Chang Gung Med J. 32:81–88. 2009.PubMed/NCBI

15. 

Schlenk RP, Kowalski RJ and Benzel EC: Biomechanics of spinal deformity. Neurosurg Focus. 14:e22003. View Article : Google Scholar

16. 

Arbit E and Pannullo S: Lumbar stenosis: a clinical review. Clin Orthop Relat Res. 137–143. 2001. View Article : Google Scholar

17. 

Fisher M: Characterizing the target of acute stroke therapy. Stroke. 28:866–872. 1997. View Article : Google Scholar : PubMed/NCBI

18. 

Moult PR: Neuronal glutamate and GABAA receptor function in health and disease. Biochem Soc Trans. 37:1317–1322. 2009. View Article : Google Scholar : PubMed/NCBI

19. 

Tanabe Y, Masu M, Ishii T, Shigemoto R and Nakanishi S: A family of metabotropic glutamate receptors. Neuron. 8:169–179. 1992. View Article : Google Scholar : PubMed/NCBI

20. 

Hollmann M and Heinemann S: Cloned glutamate receptors. Annu Rev Neurosci. 17:31–108. 1994. View Article : Google Scholar

21. 

Yoneda Y, Kuramoto N, Kitayama T and Hinoi E: Consolidation of transient ionotropic glutamate signals through nuclear transcription factors in the brain. Prog Neurobiol. 63:697–719. 2001. View Article : Google Scholar : PubMed/NCBI

22. 

Arning L, Saft C, Wieczorek S, et al: NR2A and NR2B receptor gene variations modify age at onset in Huntington disease in a sex-specific manner. Hum Genet. 122:175–182. 2007. View Article : Google Scholar : PubMed/NCBI

23. 

Tang J, Chen X, Xu X, et al: Significant linkage and association between a functional (GT)n polymorphism in promoter of the N-methyl-D-aspartate receptor subunit gene (GRIN2A) and schizophrenia. Neurosci Lett. 409:80–82. 2006. View Article : Google Scholar : PubMed/NCBI

24. 

Szczepankiewicz A, Skibinska M, Rybakowski J, et al: Lack of association of three GRIN2B polymorphisms with bipolar disorder. World J Biol Psychiatry. 10:469–473. 2009. View Article : Google Scholar : PubMed/NCBI

25. 

Seripa D, Matera MG, Franceschi M, et al: Association analysis of GRIN2B, encoding N-methyl-D-aspartate receptor 2B subunit, and Alzheimer’s disease. Dement Geriatr Cogn Disord. 25:287–292. 2008.PubMed/NCBI

26. 

Kim JH, Park M, Yang SY, et al: Association study of polymorphisms in N-methyl-D-aspartate receptor 2B subunits (GRIN2B) gene with Korean alcoholism. Neurosci Res. 56:220–223. 2006. View Article : Google Scholar : PubMed/NCBI

27. 

Tadic A, Dahmen N, Szegedi A, et al: Polymorphisms in the NMDA subunit 2B are not associated with alcohol dependence and alcohol withdrawal-induced seizures and delirium tremens. Eur Arch Psychiatry Clin Neurosci. 255:129–135. 2005. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Kim K, Kim J, Han YJ, Kim JH, Lee JS and Chung J: Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis. Exp Ther Med 5: 977-981, 2013.
APA
Kim, K., Kim, J., Han, Y.J., Kim, J.H., Lee, J.S., & Chung, J. (2013). Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis. Experimental and Therapeutic Medicine, 5, 977-981. https://doi.org/10.3892/etm.2013.910
MLA
Kim, K., Kim, J., Han, Y. J., Kim, J. H., Lee, J. S., Chung, J."Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis". Experimental and Therapeutic Medicine 5.3 (2013): 977-981.
Chicago
Kim, K., Kim, J., Han, Y. J., Kim, J. H., Lee, J. S., Chung, J."Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis". Experimental and Therapeutic Medicine 5, no. 3 (2013): 977-981. https://doi.org/10.3892/etm.2013.910
Copy and paste a formatted citation
x
Spandidos Publications style
Kim K, Kim J, Han YJ, Kim JH, Lee JS and Chung J: Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis. Exp Ther Med 5: 977-981, 2013.
APA
Kim, K., Kim, J., Han, Y.J., Kim, J.H., Lee, J.S., & Chung, J. (2013). Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis. Experimental and Therapeutic Medicine, 5, 977-981. https://doi.org/10.3892/etm.2013.910
MLA
Kim, K., Kim, J., Han, Y. J., Kim, J. H., Lee, J. S., Chung, J."Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis". Experimental and Therapeutic Medicine 5.3 (2013): 977-981.
Chicago
Kim, K., Kim, J., Han, Y. J., Kim, J. H., Lee, J. S., Chung, J."Assessment of NMDA receptor genes (GRIN2A, GRIN2B and GRIN2C) as candidate genes in the development of degenerative lumbar scoliosis". Experimental and Therapeutic Medicine 5, no. 3 (2013): 977-981. https://doi.org/10.3892/etm.2013.910
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team