Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
2014-April Volume 7 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
2014-April Volume 7 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG

  • Authors:
    • Weiqun Xu
    • Lingyan Zhang
    • Yi Zhang
    • Yongmin Tang
  • View Affiliations / Copyright

    Affiliations: Department of Hematology and Oncology, School of Medicine, Children's Hospital of Zhejiang University, Hangzhou, Zhejiang 310003, P.R. China, Key Laboratory, The First Hospital of Ningbo City, Ningbo, Zhejiang 315700, P.R. China
  • Pages: 849-854
    |
    Published online on: January 29, 2014
       https://doi.org/10.3892/etm.2014.1511
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

CD19 is a specific surface marker of B cells. A murine IgM‑subtype antibody, 2E8, was generated previously and assigned to the CD19 category by the 6th International Workshop and Conference on Human Leukocyte Differentiation Antigens in 1996. In the present study, the 2E8 Fv gene was inserted into a baculovirus shuttle vector and novel protein was expressed in an IgG1 form in the Sf9 insect cell line. VH2E8 and VL2E8 genes were cloned and inserted into the baculovirus shuttle vector pAc‑κ‑CH3 to form pAc‑κ‑CH3‑VH2E8‑VL2E8. Sf9 cells were then transfected with the reconstructed baculovirus shuttle vector. Novel protein expressed by the Sf9 cells was identified by immunofluorescence and western blot analysis, while activity levels were analyzed by flow cytometry (FCM). Sequencing demonstrated that the VH2E8 and VL2E8 fragments were inserted into pAc‑κ‑CH3 correctly. The immunofluorescence, western blot analysis and FCM results indicated that active recombinant antibody was expressed in the cytoplasm of Sf9 cells, but not in the culture supernatant. Thus, functional recombinant antibody was expressed successfully in the cytoplasm of Sf9 cells, but was not secreted into the culture supernatant. Therefore, the present study demonstrates that it is possible to modify mouse IgM to mouse‑human chimeric IgG1 while retaining reasonable biological activity.

Introduction

B-lineage acute lymphoblastic leukemia is the most common type of acute leukemia and remains a major life-threatening disease in children (1). Compared with conventional chemotherapy, targeted monoclonal antibody (mAb) therapy is more effective and has fewer side-effects due to greater selectivity and specificity (2–6). mAbs directed against CD molecules on the surface of leukemic cells have shown promising results for targeted therapy (7). CD19 is a specific surface marker of B cells and is consistently and steadily expressed in almost all the differentiation stages of B-lineage cells (8). Therefore, CD19 may be an ideal target for the development of antibody-based treatments for B-lineage malignancies (9–11).

Currently, the majority of high-affinity mAbs available are of mouse origin. The clinical application of mouse antibodies has been greatly restricted due to the occurrence of the human anti-mouse antibody response, which decreases the efficacy of therapy and may cause severe anaphylaxis (12,13). Thus, it is necessary to reduce the immunogenicity of mouse antibodies, but maintain maximal antigen-recognizing activity. A successful model of a chimeric antibody used in targeted therapy in combination with chemotherapy is rituximab (human-mouse chimeric anti-human-CD20 antibody). Treatment with rituximab has improved the efficacy of B-lineage non-Hodgkin lymphoma therapy by 40% (3). However, the majority of B-lineage leukemic cells are immature and lack expression of CD20 on the cell surface, restricting the application of rituximab in leukemia treatment. By contrast, CD19 is expressed at various differentiation stages of B lymphocytes, from stem cells to mature B cells, throughout B-lineage leukemia. Therefore, CD19 is an improved target molecule for B-lineage leukemia therapy (8).

The baculovirus expression system is widely applied as an important eukaryotic expression system due to a number of advantages, including the ease of inserting desired genes, high yield, the presence of post-translational modifications similar to those found in human cells, ease of use and suitable biological material safety. The baculovirus expression vector pAc-κ-CH3 was designed particularly for the expression of chimeric antibodies; it comprises IgG expression cassette elements, including authentic IgGκ and heavy chain signal sequences, as well as light chain κ and the heavy chain constant region, that are integrated into a single vector and controlled by p10 and polyhedrin promoters, respectively (14). IgG yields have been reported to be between 6 and 18 mg/l and the antigen-binding function has been observed to be well-preserved (15). Therefore, this system was selected for the expression of recombinant protein in the present study. However, modifying IgM to IgG is likely to be a difficult procedure since changing the pentameric IgM unit to a dimeric IgG unit may result in the loss of binding activity (16,17).

Zhejiang Children’s Hospital (ZCH)-4-2E8 or simply 2E8, is an antibody belonging to the murine IgM subtype that was generated in the Department of Hematology and Oncology, School of Medicine, Children’s Hospital of Zhejiang University (Hangzhou, China) (18). 2E8 was assigned to the CD19 category by the 6th International Workshop and Conference on Human Leukocyte Differentiation Antigens (HLDA6) in 1996. The aim of the present study was to insert 2E8 Fv genes into the pAc-κ-CH3 baculovirus shuttle vector and express the novel protein in the insect Sf9 cell line, using the baculoviral expression system. The characteristics and physiological activity of the chimeric antibody were also examined.

Materials and methods

Cell culture

Experimental procedures were approved by the Medical Ethics Committee of the Children’s Hospital of Zhejiang University.

The Sf9 insect cell line was provided by Professor Mifang Liang from the Chinese Center for Disease Control Prevention, Institute for Viral Disease Control and Prevention (Beijing, China) (15). Sf9 cells were cultured in serum-free medium (SFM; SF900 II; Invitrogen Life Technologies, Shanghai, China) and fetal bovine serum (Gibco-BRL, Gaithersburg, MD, USA), but were gradually adapted to SFM prior to the expression studies. NALM-6, a B-lineage leukemic cell line, was cultured in RPMI-1640 medium (Gibco-BRL) and fetal bovine serum.

The hybrid cell line 2E8, which secreted the parental 2E8 anti-human CD19 mAb, was cultured in RPMI-1640 medium and fetal bovine serum.

Plasmids and reagents

The Psectag2A/Scfv2E8 plasmid, which contained heavy and light chains of the 2E8 mAb, was established in the Department of Hematology and Oncology, School of Medicine, Children’s Hospital of Zhejiang University. Psectag2A, Escherichia coli (E. coli) DH5α strain cells, high-fidelity platinum Taq polymerase, Taq DNA polymerase, RQ1 5-bromo-4-chloro-indolyl-β-D-galactopyranoside, isopropylthio-β-galactoside, RNasin and RNase-free DNase were purchased from Invitrogen Life Technologies. The pAc-κ-CH3 baculovirus expression vector, which contained authentic IgGκ, heavy chain signal sequences and constant regions, was provided by Professor Mifang Liang from the Chinese Center for Disease Control Prevention, Institute for Viral Disease Control and Prevention (15). The structure of this plasmid is shown in Fig. 1 (15).

Figure 1

Structure of the pAc-κ-CH3 baculovirus expression vector.

pGEM®-T Easy Vector (TA cloning) and the restriction endonucleases, EcoRI, SacI, HindIII, XhoI, NheI, BamHI and BglI, were purchased from Promega Corporation (Beijing, China). The BaculoGold transfection kit, mouse anti-human (MAH) γ1-fluorescein isothiocyanate (FITC) and dialysis solution were purchased from Becton Dickinson (Franklin Lakes, NJ, USA). Horseradish peroxidase (HRP)-conjugated MAH-Fc-HRP antibodies were purchased from Sigma-Aldrich (Shanghai, China). Goat anti-mouse (GAM)-Fab-rhodamine, HRP-conjugated GAM-μ-HRP and GAM-Fab-HRP antibodies were purchased from Rockland Immunochemicals, Inc. (Gilbertsville, PA, USA). MAH-Fc-FITC, GAM-Fab-(κ)-FITC and SuperSignal West Durab Extended Duration Substrate were purchased from Pierce Biotechnology, Inc. (Rockford, IL, USA). T4 DNA ligase and Triton X-100 were purchased from Gibco-BRL and a DL2000 marker was purchased from Takara Bio, Inc. (Dalian, China). A QIAquick gel extraction kit was purchased from Qiagen (Valencia, CA, USA) and the SuperFect transfection reagent was purchased from Roche Diagnostics (Shanghai, China). Oligo(dT)12–18 primers and polyvinylidene fluoride (PVDF) membranes were purchased from Bio-Rad Laboratories, Inc. (Shanghai, China). A prestained protein molecular weight marker was purchased from Fermentas, (Shenzhen, China) and HRP-labeled GAM IgG (heavy and light chains) was purchased from Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd. (Beijing, China).

Construction of the pAc-κ-CH3-VH2E8-VL2E8 baculovirus shuttle vector

VH2E8 and VL2E8 genes were cloned from pSectag2A/ScFv2E8, which had been successfully established previously by polymerase chain reaction amplification using the primers listed in Table I. Specific endonuclease sites were located within the primer pairs and the amplified fragments were inserted using TA cloning techniques. This was followed by transformation into E. coli DH5α cells. Recombinants were selected and amplification and sequencing of the inserted sequences were performed. Target sequences were confirmed by comparison with the previously cloned VH2E8 and VL2E8 gene sequences to enable further study.

Table I

Primers used to clone VH2E8 and VL2E8 genes for insertion into pAc-κ-CH3.

Table I

Primers used to clone VH2E8 and VL2E8 genes for insertion into pAc-κ-CH3.

GeneUp/downSequence
VH2E8Forward CTCGAGGAGGTGAAGCTGGTGGAGT (XhoI)
VH2E8Reverse GCTAGCCTCTGAGGAGACGGTGACT (NheI)
VL2E8Forward GAGCTCGATATCCAGATGACACAGACTTC (SacI)
VL2E8Reverse AAGCTTTTTGATTTCCAGCTTGGTGCCT (HindIII)

VH2E8 and VL2E8 gene fragments were cleaved with corresponding endonucleases (VH2E8, XhoI and NheI; VL2E8, SacI and HindIII) and inserted sequentially into the secretive pAc-κ-CH3 baculovirus expression shuttle vector. Following transformation into E. coli DH5α cells, recombinants were selected, plasmid DNA was purified and the insertions were amplified and sequenced using the method described by Liang et al (14). The sequences were then compared with the previously identified VH2E8 and VL2E8 gene sequences to confirm that the insertions were correct. DNA manipulation and bacterial transformation procedures were conducted as previously described by Filpula et al (16).

Transfection of Sf9 cells with the reconstructed baculovirus shuttle vector and the formation of the pAc-κ-CH3-VH2E8-VL2E8 complete virion (CV)

Recombinant baculoviruses were prepared by homologous recombination using the BaculoGold transfection kit (Becton Dickinson, Franklin Lakes, NJ, USA), according to the manufacturer’s instructions. Sf9 cells were cotransfected with the pAc-κ-CH3-VH2E8-VL2E8 reconstructed shuttle vector and linearized DNA of the Autographa california nuclear polyhedrosis virus (AcNPV). pXyIE and AcNPV linearized DNA-transfected Sf9 cells and uninfected Sf9 cells were set as positive and negative controls, respectively, as recommended by the manufacturer’s instructions. Morphological changes in the cells were observed every day following transfection using an inverted microscope. Positive control cells expressing recombinant XyIE turned yellow in the presence of catechol at day 4 following transfection. The supernatants of the pAc-κ-CH3-VH2E8-VL2E8-transfected Sf9 cells were harvested as primary recombinant CVs, to produce pAc-κ-CH3-VH2E8-VL2E8 CV (P0) for further amplification. Transfected Sf9 cells were collected for detection on day 7.

Through three passages of amplification, large viral stocks were prepared by infecting Sf9 cells at a multiplicity of infection (number of virions/number of cells being infected) of <1. The supernatant was harvested at day 4 or 5 following infection. Three passages were amplified and the virus stock was saved for application in the expression studies.

For protein expression, Sf9 cells were cultured in SFM. The supernatant was collected for detection at day 6 following infection when ~30% of living cells remained.

Identification of the recombinant protein by flow cytometry (FCM)

To analyze the activity levels of the recombinant antibody in the supernatant and cell lysates, a 1×106 cells/tube suspension of fresh NALM-6 cells was prepared in six tubes. Next, 100 μl concentrated expression supernatant or infected Sf9 cell lysate was added to the cell suspension in two of the tubes and the same volume of concentrated regular medium (each in duplicates) was added to the other four tubes as negative controls. After 30 min, the cells were washed twice with phosphate-buffered saline (PBS). MAH-Fc-FITC and GAM-κ-FITC were added separately and the reactions were incubated for 30 min, which was followed by two washes with PBS. FCM analysis was utilized to observe whether the chimeric antibody in the supernatant or infected Sf9 cell lysate was able to bind to the CD19 antigen on the NALM-6 cell surface.

Identification of the recombinant protein by western blot analysis

Sf9 cells (2×107 cells) were placed in 1 ml lysis refolding solution [50 mmol/l Tris-HCl (pH 7.5), 50 mM NaCl, 5 mM oxidized glutathione, 0.5 mM reduced glutathione and 1 M urea] with 100 mM phenylmethylsulfonyl chloride, 1 μg/ml aprotinin and 1 μg/ml leupeptin to prevent protein degradation. Cells were sonicated to obtain the cell lysate and pAc-κ-CH3-VH2E8-VL2E8 CV P3-infected Sf9 cells were set as the experimental group and the uninfected Sf9 cells lysates were used as the negative control. Lysates were dialyzed in PBS (containing 0.02% sodium azide) for 48 h (used PBS was replaced with fresh PBS six times in this duration), following which PBS substitution ultrafiltration was performed twice. Protein concentration was determined using the DC protein assay kit (Bio-Rad Laboratories, Inc.). Total protein extracts (0.5 μg/well) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), according to the method described by Sambrook et al (16), using 12% separation polyacrylamide gels and 5% condensed gels. Gels were stained with Coomassie brilliant blue R250 (16). For western blot analysis, the chimeric antibody was transferred onto PVDF membranes and blocked with 5% skimmed milk. The transferred membrane was incubated with MAH-Fc-HRP (1:20,000) for 2 h at 37°C and washed three times. Detection was performed using an enhanced chemiluminescence substrate and exposure to X-ray film. The anti-human CD20 mouse-human chimeric antibody, rituximab (Roche/Genentech, San Francisco, CA, USA), was used as a positive control.

Results

Construction of the pAc-κ-CH3-VH2E8-VL2E8 recombinant baculovirus shuttle vector

The 380-bp VH2E8 and 330-bp VL2E8 gene fragments were amplified using the primers listed in Table I and inserted into the TA-cloning vector. Endonuclease digestion, sequencing and sequence analysis were then performed. The correct sequences were named TA-VH2E8 and TA-VL2E8.

TA-VH2E8 and pAc-κ-CH3 vectors were digested with XhoI and NheI and ligated with T4 DNA ligase. The recombinant was treated with BamHI endonuclease and sequenced to confirm the correct insertion and orientation of recombinant pAc-κ-CH3-VH2E8. The VL2E8 fragment was inserted into pAc-κ-CH3-VH2E8, which was confirmed by sequencing.

Transfection, virion amplification and expression of the recombinant antibody

Sf9 cells were transfected with the pAc-κ-CH3-VH2E8-VL2E8 baculovirus expression vector and transfected cells were identified to be bigger and of irregular shape (Fig. 2A) when compared with the negative control cells (Fig. 2B). The positive control cells turned yellow in the presence of catechol when harvested at day 4 following transfection (Fig. 3A), indicating that the transfection procedure was successful.

Figure 2

Morphology of (A) Sf9 cells infected with pAc-κ-CH3-VH2E8-VL2E8 and (B) uninfected Sf9 cells (negative control) at day 4 following infection. The infected cells have stopped proliferating and are various sizes and irregular shapes. Certain cells are larger with increased intracellular granules, and >5% of the cells are in suspension with a small amount of cell debris present. Uninfected cells are of uniform size, rounded shape and have good cell permeability. There is no cell debris and <2% of the cells are in suspension, indicating that the cells are healthy.

Figure 3

(A) Morphology of Sf9 cells transfected with the pXyIE positive control plasmid. Infected cells have various sizes and irregular shapes. Certain cells are larger with increased intracellular granules and >5% of the cells are in suspension with a small amount of cell debris. Cells were harvested and 5–10% of the cells were stained bright yellow in the presence of catechol (day 4 following infection), indicating successful transfection. (B) Western blot analysis. Lanes 1, cell lysates from infected Sf9 cells cultured in SFM with heavy and light chains (positive control); 2, uninfected Sf9 cell lysates have no bands corresponding to the heavy and light chains; and 3, rituximab has bands corresponding to the heavy and light chains. SFM, serum-free medium.

Following three passages of amplification, high-titer virus stocks were ready for use in the expression studies.

Determination of recombinant protein activity levels by FCM

Antibody activity was detected using FCM in the cell lysates from infected Sf9 cells, but not in the supernatant.

NALM-6 cells, incubated with the cell lysates from infected Sf9 cells, were 14.35% positive (vs. 2.97% in the negative control) when labeled with GAM-Fab-FITC. The percentage of positive cells (28.67 vs. 2.76% in the negative control) was even higher when labeled with MAH-Fc-FITC, which indicated the existence of functional antibody in the infected Sf9 cell lysates (Fig. 4).

Figure 4

Detection of antibody activity levels in the cell lysates of infected Sf9 cells using an indirect immunofluorescence test. Cell lysates of Sf9 cells infected with pAc-κ-CH3-VH2E8-VL2E8 were added to NALM-6 cells and then incubated with FITC-labeled MAH-Fc and GAM-Fab. The percentage of positive cells in the GAM-Fab-FITC group was 14.35% compared with 2.97% in the negative control where NALM-6 cells were treated with uninfected Sf9 cell lysates. The percentage of positive cells was 28.67% in the MAH-Fc-FITC group, indicating that active recombinant antibody was present in the infected cell lysates. MAH, mouse anti-human; GAM, goat anti-mouse; FITC, fluorescein isothiocyanate.

Identification of the recombinant protein by immunofluorescence and western blot analysis

Since Sf9 cells exhibited green autofluorescence, immunofluorescence in the transfected Sf9 cells was monitored by incubation with GAM-Fab-rhodamine instead of FITC. It was found that 80% of the cells were positive for red fluorescence in the cytoplasm (Fig. 5A), indicating the expression of novel protein in the cytoplasm of infected Sf9 cells. However, no fluorescence was observed in the uninfected Sf9 cells (Fig. 5B).

Figure 5

Detection of the reconstructed antibody using GAM-Fab-rhodamine immunofluorescence in (A) Sf9 cells infected with pAc-κ-CH3-VH2E8-VL2E8 and (B) uninfected Sf9 cells at day 7 following infection. In the infected group,80% of the cells were positive (red) for the GAM-Fab-rhodamine fluorescence signal. GAM, goat anti-mouse.

No specific protein bands corresponding to the heavy and light chains were observed in the supernatant from the infected cells. However, specific bands were observed in the lysates of the infected Sf9 cells, which was consistent with the FCM results. Specific bands corresponding to the heavy and light chains of rituximab were observed by western blot analysis in the infected Sf9 cell lysate, while the uninfected Sf9 cell lysates did not exhibit any positive activity (Fig. 3B).

Discussion

There are five main classes of Ig: IgG, IgA, IgD, IgE and IgM, divided according to the various genes encoding the constant regions of the heavy chain. IgG and IgA classes are in turn subdivided into six isotypes: IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2. When reconstructing expression vectors for antibodies, it is generally accepted that IgGs, including IgG1, IgG2 and IgG4 subtypes, may be genetically manipulated with relative ease whilst maintaining antibody function. In total, >20 recombinant IgG antibody-based therapeutic drugs are now licensed for the treatment of a variety of diseases, the majority of which belong to the IgG1 subclass. In addition, there are hundreds of new drugs currently under development (9). In the present study, a vector with the IgG1 form of the final product was selected to express a chimeric antibody. It was previously reported that difficulties may arise when transforming IgM into IgG (17). Thus, the outcome of the CD19 antibody in the current study was not clear. Genetic manipulation was performed on ZCH-4-2E8, an IgM-type antibody developed previously and identified to be a novel CD19 mAb by HLDA6 in 1996. Gene cloning of the variable regions of the heavy and light chains of this antibody was successfully performed and a eukaryotic expression system was constructed. Following the insertion of the genes encoding the chimeric antibody into the pAc-κ-CH3 baculovirus vector and transfection into the insect host Sf9 cell line, the antibody was shown to be expressed in the cytoplasm by immunostaining with a rhodamine-labeled GAM-Fab antibody. This was further confirmed by SDS-PAGE and western blot analysis. The results obtained indicate that genes encoding the IgM variable region may be reconstructed with an IgG backbone and retain part of the antibody function. In addition, the results demonstrate that specific IgM antibodies may also be amenable to genetic manipulation and are likely to retain part of the capacity to recognize antigens.

FCM was applied to detect the activity levels of the recombinant antibody. Activity was detected in the lysates, however, the levels were reduced compared with those of the parental antibody. In addition, activity was not detected in the supernatants. These results indicate that the antibody was produced inside the cells, but was unable to be secreted outside the cells. The results indicate that it was possible to modify IgM into an IgG form and partially retain its activity. However, questions remain with regard to promoting the secretion of the engineered antibody, while retaining or improving its biological functions. Correct antibody conformation is critical to biological function, including the recognition of the relevant antigen. It remains to be investigated whether transformation from IgM to IgG causes changes in the spatial conformations of the chimeric antibody that prevent secretion or whether the leader sequence of the IgG form is not suitable for the secretion of the IgM variable region. Therefore, further studies are required to engineer antibodies that are able to be secreted from cells, to improve the binding activity of the antibodies and to identify appropriate leader sequences that promote efficient secretion, while retaining optimal biological function via modulation of the gene sequences.

In the present study, the recombinant shuttle vector, pAc-κ-CH3-VH2E8-VL2E8, was successfully reconstructed and CVs with the capacity for natural infection of insect cells were obtained. Recombinant antibody was successfully expressed and functional antibody existed inside the infected Sf9 cells but was not secreted. Therefore, the results indicate that it is possible to reconstruct an IgG-form chimeric antibody from a parental IgM antibody. However, modifications of the procedure are required to obtain a secreted chimeric antibody with appropriate biological activity.

Acknowledgements

The study was supported by grants from the Zhejiang Provincial Natural Scientific Foundation (no. Z205166), the National Natural Science Foundation of China (no. 81100338), the Zhejiang Provincial Traditional Chinese Medicine Scientific and Technological Innovation Platform for Severe Diseases (no. 2009ZDJB01-05) and the Science Technology Department of Zhejian Province, Qianjiang Project (no. 2009R10037). The authors thank Ms. Baiqin Qian and Mr. Hongqiang Shen for their technical support and Xiaojun Xu and Sisi Li for their assistance during the study.

References

1 

Salzer WL, Devidas M, Carroll WL, Winick N, Pullen J, Hunger SP and Camitta BA: Long-term results of the pediatric oncology group studies for childhood acute lymphoblastic leukemia 1984–2001: a report from the children’s oncology group. Leukemia. 24:355–370. 2010.

2 

Portell CA and Advani AS: Antibody therapy for acute lymphoblastic leukemia. Curr Hematol Malig Rep. 7:153–159. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Shimoni A, Zwas ST, Oksman Y, Hardan I, Shem-Tov N, Rand A, Yerushalmi R, Avigdor A, Ben-Bassat I and Nagler A: Ibritumomab tiuxetan (Zevalin) combined with reduced-intensity conditioning and allogeneic stem-cell transplantation (SCT) in patients with chemorefractory non-Hodgkin’s lymphoma. Bone Marrow Transplant. 41:355–361. 2008.PubMed/NCBI

4 

Pagel JM, Appelbaum FR, Eary JF, Rajendran J, Fisher DR, Gooley T, Ruffner K, Nemecek E, Sickle E, Durack L, Carreras J, Horowitz MM, Press OW, Gopal AK, Martin PJ, Bernstein ID and Matthews DC: 131I-anti-CD45 antibody plus busulfan and cyclophosphamide before allogeneic hematopoietic cell transplantation for treatment of acute myeloid leukemia in first remission. Blood. 107:2184–2191. 2006. View Article : Google Scholar

5 

Herrera L, Stanciu-Herrera C, Morgan C, Ghetie V and Vitetta ES: Anti-CD19 immunotoxin enhances the activity of chemotherapy in severe combined immunodeficient mice with human pre-B acute lymphoblastic leukemia. Leuk Lymphoma. 47:2380–2387. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Feldman EJ, Brandwein J, Stone R, Kalaycio M, Moore J, O’Connor J, Wedel N, Roboz GJ, Miller C, Chopra R, Jurcic JC, Brown R, Ehmann WC, Schulman P, Frankel SR, De Angelo D and Scheinberg D: Phase III randomized multicenter study of a humanized anti-CD33 monoclonal antibody, lintuzumab, in combination with chemotherapy, versus chemotherapy alone in patients with refractory or first-relapsed acute myeloid leukemia. J Clin Oncol. 23:4110–4116. 2005. View Article : Google Scholar

7 

Dungarwalla M, Evans SO, Riley U, Catovsky D, Dearden CE and Matutes E: High dose methylprednisolone and rituximab is an effective therapy in advanced refractory chronic lymphocytic leukemia resistant to fludarabine therapy. Haematologica. 93:475–476. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Chen YH, Tang YM, Shen GQ, Song H, Yang SL, Shi SW, Qian BQ, Xu WQ and Ning BT: The comparison of expression patterns of CD19 and CD20 on 321 cases of acute leukemia. Zhejiang Medical Journal. 25:461–463. 2003.(In Chinese).

9 

Jefferis R: Aglycosylated antibodies and the methods of making and using them: WO2008030564. Expert Opin Ther Pat. 19:101–105. 2009. View Article : Google Scholar : PubMed/NCBI

10 

Tsai LK, Pop LM, Liu X and Vitetta ES: A comparison of the anti-tumor effects of a chimeric versus murine anti-CD19 immunotoxins on human B cell lymphoma and Pre-B acute lymphoblastic leukemia cell lines. Toxins (Basel). 3:409–419. 2011. View Article : Google Scholar : PubMed/NCBI

11 

Davies JK, Singh H, Huls H, Yuk D, Lee DA, Kebriaei P, Champlin RE, Nadler LM, Guinan EC and Cooper LJ: Combining CD19 redirection and alloanergization to generate tumor-specific human T cells for allogeneic cell therapy of B-cell malignancies. Cancer Res. 70:3915–3924. 2010. View Article : Google Scholar : PubMed/NCBI

12 

Michálek J, Collins RH and Vitetta ES: Clinical-scale selective depletion of alloreactive T cells using an anti-CD25 immunotoxin. Neoplasma. 50:296–299. 2003.PubMed/NCBI

13 

Goto S, Goto H, Tanoshima R, Kato H, Takahashi H, Sekiguchi O and Kai S: Serum sickness with an elevated level of human anti-chimeric antibody following treatment with rituximab in a child with chronic immune thrombocytopenic purpura. Int J Hematol. 89:305–309. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Liang M, Dubel S, Li D, Queitsch I, Li W and Bautz EK: Baculovirus expression cassette vectors for rapid production of complete human IgG from phage display selected antibody fragments. J Immunol Methods. 247:119–130. 2001. View Article : Google Scholar

15 

van der Geld YM, Oost-Kort W, Limburg PC, Specks U and Kallenberg CG: Recombinant proteinase 3 produced in different expression systems: recognition by anti-PR3 antibodies. J Immunol Methods. 244:117–131. 2000.PubMed/NCBI

16 

Filpula D: Antibody engineering and modification technologies. Biomol Eng. 24:201–215. 2007. View Article : Google Scholar : PubMed/NCBI

17 

Wang Y, Feng J, Huang Y, Gu X, Sun Y, Li Y and Shen B: The design, construction and function of a new chimeric anti-CD20 antibody. J Biotechnol. 129:726–731. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Tang Y and Guo S: Preparation, identification and preliminary application of B lineage specific monoclonal antibody ZCH-4-2E8. Journal of Zhejiang University Science ABC. 23:246–249. 1994.

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xu W, Zhang L, Zhang Y and Tang Y: Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG. Exp Ther Med 7: 849-854, 2014.
APA
Xu, W., Zhang, L., Zhang, Y., & Tang, Y. (2014). Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG. Experimental and Therapeutic Medicine, 7, 849-854. https://doi.org/10.3892/etm.2014.1511
MLA
Xu, W., Zhang, L., Zhang, Y., Tang, Y."Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG". Experimental and Therapeutic Medicine 7.4 (2014): 849-854.
Chicago
Xu, W., Zhang, L., Zhang, Y., Tang, Y."Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG". Experimental and Therapeutic Medicine 7, no. 4 (2014): 849-854. https://doi.org/10.3892/etm.2014.1511
Copy and paste a formatted citation
x
Spandidos Publications style
Xu W, Zhang L, Zhang Y and Tang Y: Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG. Exp Ther Med 7: 849-854, 2014.
APA
Xu, W., Zhang, L., Zhang, Y., & Tang, Y. (2014). Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG. Experimental and Therapeutic Medicine, 7, 849-854. https://doi.org/10.3892/etm.2014.1511
MLA
Xu, W., Zhang, L., Zhang, Y., Tang, Y."Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG". Experimental and Therapeutic Medicine 7.4 (2014): 849-854.
Chicago
Xu, W., Zhang, L., Zhang, Y., Tang, Y."Construction and expression of a human/mouse chimeric CD19 monoclonal antibody: Successful modification of a murine IgM to a chimeric IgG". Experimental and Therapeutic Medicine 7, no. 4 (2014): 849-854. https://doi.org/10.3892/etm.2014.1511
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team