Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2015 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2015 Volume 10 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Novel keratin 5 mutation in a family with epidermolysis bullosa simplex

  • Authors:
    • Jiajia Gao
    • Xuebin Wang
    • Fang Zheng
    • Sufang Dong
    • Xueping Qiu
  • View Affiliations / Copyright

    Affiliations: Center for Gene Diagnosis, Zhongnan Hospital of Wuhan University, Wuhan, Hubei 430071, P.R. China
  • Pages: 2432-2436
    |
    Published online on: October 16, 2015
       https://doi.org/10.3892/etm.2015.2811
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to identify the causative gene defects associated with epidermolysis bullosa simplex (EBS) in a pedigree. The diagnosis of EBS was confirmed in two patients from that pedigree based on the clinical manifestations, histopathological examination of the skin and family history. Blood samples were collected from 6 family members and 100 heathy controls, and genomic DNA and RNA were extracted. Mutation analysis of the keratin 5 gene (KRT5) was conducted using polymerase chain reaction (PCR) direct sequencing and PCR‑restriction fragment length polymorphism. In the pedigree, the results of PCR direct sequencing revealed a heterozygous missense mutation in codon 202 of exon 2 of KRT5 (c.605T>A), which led to an amino acid change (p.L202Q) in the patients with EBS but was absent from the unaffected family members and 100 population controls. In conclusion, a novel missense mutation in the KRT5 gene was identified that had a pathogenic role in EBS in the population studied, which enriches the germline mutation spectrum of the KRT5 gene.

Introduction

Epidermolysis bullosa (EB) is a term that describes a group of inherited skin diseases that are characterized by blistering of the skin caused by mechanical trauma (1). EB has been classified into three major subtypes on the basis of the level of the dermoepidermal separation within the basement membrane zone (1). Epidermolysis bullosa simplex (EBS) comprises the most common subtype of EB, which results from tissue separation within the epidermal basal keratinocytes. The worldwide prevalence of EBS has been estimated to be between 1 in 30,000 and 1 in 50,000 (1).

EBS can be subdivided into three major subtypes: i) The mildest subtype, localized EBS (EBS-loc, OMIM 131800), characterized by blistering confined to the hands and feet; ii) the moderately severe variant, generalized EBS (EBS-gen; OMIM 131900), characterized by more generalized blistering, and iii) the most severe variant, the Dowling-Meara type (EBS-DM; OMIM 131760) characterized by severe herpetiform blistering (2).

EBS is mostly caused by a single mutation in either of the keratin genes, keratin 5 (KRT5) or KRT14, inherited in an autosomal dominant fashion (3,4). The majority of mutations are nucleotide substitutions that lead to missense mutations. The KRT5 and KRT14 genes encode the intermediate filament cytoskeleton proteins in basal keratinocytes, which maintain the mechanical integrity of the epidermis (5). Each of these two keratin proteins comprises a central α-helical rod domain of 310 amino acids, which consists of four segments (1A, 1B, 2A and 2B) and is interrupted by three nonhelical linkers (L1, L12 and L2) (5).

Mutation screening of KRT5 and KRT14 in an EBS proband and their family members could potentially help to improve the understanding of the pathogenesis of EBS and the mutation spectrum of Chinese patients with EBS. In the present study, Chinese patients with EBS were examined for KRT5 germline mutations.

Patients and methods

Patients and pedigree

In total, 6 members of the EBS pedigree (Fig. 1) were enrolled in the study in October 15th, 2013. The members II:6 (female, 46-years-old) and III:3 (male, 23-years-old) were diagnosed with EBS and treated in the Zhongnan Hospital of Wuhan University (Wuhan, China). The diagnosis was based on the clinical features, family history and histopathological examination of the skin of the patients. The clinical records, family history and results from the histopathological examination of the patients were collected.

Figure 1.

Family pedigree. The family history revealed four affected members across four generations. The dark symbols represent the affected members of the family, while the unfilled symbols indicate the unaffected members. Circles represent female and squares male family members. Asterisks indicate the patients who participated in the present study. The arrow indicates the proband, while strikes (/) through the symbols represent deceased members.

The proband presented with blistering after mechanical trauma, which occurred mainly on the feet or hands following exercise and the symptoms deteriorated in the summer. The bullae healed without scarring. All four affected members in the pedigree had the same clinical manifestations as the proband. Analyses also included 100 unaffected control subjects.

The study was approved by the Zhongnan Hospital Research Ethics Committee and was conducted in accordance with the Declaration of Helsinki. Informed consent was obtained from all individuals prior to their participation in the study.

Mutational screening

Approximately 4–5 ml peripheral venous blood was drawn from the family members and 100 population controls. Genomic DNA was extracted using the standard sodium dodecyl sulfate-proteinase K method (6), quantified using a spectrophotometer (Nanodrop 2000; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at 260 nm and stored at −20°C until use. The total RNA sample of the proband was extracted using the ComWin RNA extraction kit (Beijing ComWin Biotech Co., Ltd., Beijing, China) according to the manufacturer's instructions. Reverse transcription (RT) was performed with 1 µg total RNA using a Revert First Strand cDNA Synthesis kit (Thermo Scientific, Inc., Waltham, MA, USA). Specific primers for KRT5 were designed using Primer 3, version 0.4.0 (http://frodo.wi.mit.edu/primer3/) (sequences listed in Table I) and synthesized by Qingke Biotechnology Co., Ltd. (Wuhan, China). DNA or cDNA fragments were amplified using PCR tubes containing 10 pmol of each primer, 1.5 mmol/l Mg2+, 2.0 mmol/l dNTP, 1.0 units Taq DNA polymerase (Fermentas; Thermo Fisher Scientific, Inc.) and 100 ng DNA. The amplification was performed as follows: Initial denaturation at 95°C for 10 min followed by 35 cycles of denaturation at 95°C for 30 sec, annealing at 56, 57 or 59°C (as specified in Table I) for 30 sec, extension at 72°C for 1 min and final extension at 72°C for 10 min. Amplifications were performed in a Hema 9600 PCR thermocycler (Hema Medica Instrument Co., Ltd., Zhuhai, China). PCR-amplified fragments were purified and sequenced by Qingke Biotechnology Co., Ltd. using an Applied Biosystems Genetic Analyzer 3730×l (Thermo Fisher Scientific, Inc.).

Table I.

Primers and conditions for keratin 5 amplification by reverse transcription-polymerase chain reaction.

Table I.

Primers and conditions for keratin 5 amplification by reverse transcription-polymerase chain reaction.

Primers (5′→3′)

ExonForwardReverseProduct size (bp)Annealing temperature (°C)
2, 3, 4, 5, 6 (for cDNA) CGGTAGTGGATTTGGTTTCG TGGTGTTGCGGAGGTCAT84556
7, 8 (for cDNA) CGATGACCTCCGCAACA CTCCTGGGAACCAAAGAAT79857
2 (for DNA) AGAGGGACGGAAAGAGG CAAAGGAAGGCATGGTAG40159

Mutation analysis was conducted using the PCR-restriction fragment length polymorphism (PCR-RFLP) method in 6 family members and 100 population controls. The PCR products (8 µl) were digested with EcoNI restriction enzyme (New England Biolabs Inc., Ipswich, MA, USA) at 37°C overnight. The resulting fragments were separated by electrophoresis on a 2% agarose gel (Biowest, Madrid, Spain) for 20 min with 100 V in 0.5X Tris/borate/EDTA buffer (Sheng Gong Biotechnology Co., Ltd., Shanghai, China). Subsequently, the fragments were stained by goldview (Sai Baisheng Biotechnology Co., Ltd., Shanghai, China) were visualized under a UV transilluminator (Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Protein-protein Basic Local Alignment Search Tool (BLAST) of KRT5

The protein BLAST program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to align the proteins of different species. The protein sequences of keratin were inserted in the pblast frame, and the proteins of different species (such as human, dog, mouse and rat) were determined.

Prediction of the biophysical properties of the mutant protein

Biophysical predictions of the altered protein were made using bioinformatics tools. In particular, Antheprot 2000 version 5.0 (Institut de Biologie et Chimie des Protéines, Lyon, France) was used for the prediction of secondary structures and hydrophobicity.

Results

Autosomal dominant pedigree of EBS

Six Chinese patients with EBS were enrolled into the present study, of which two patients (III:3 and II:6) were classified into the EBS-loc subtype based on previously established diagnostic criteria (4,7). The patients had a history suggestive of autosomal dominance. The diagnosis of EBS-loc was confirmed by histopathological examination of the patients' skin, which revealed basal cell cytolysis.

Novel mutation of L202Q in KRT5

In this particular pedigree, the results of direct PCR sequencing in the two affected individuals (III:3 and II:6), in comparison with the wild-type allele (Fig. 2A), revealed a heterozygous T→A mutation at nucleotide 605 in KRT5 (Fig. 2B). At the protein level, this mutation leads to an amino acid change from leucine to glutamine in codon 202 of exon 2. The results of the PCR-RFLP analysis indicated that this mutation was not present in the unaffected family members or the 100 population controls (Fig. 2C).

Figure 2.

Mutation analysis of keratin 5. Sequence chromatograms of (A) a wild-type allele showing the code for leucine (CTG) at codon 202 and (B) a mutant allele showing a heterozygous T→A transition that changes leucine at codon 202 to glutamine. (C) Gel patterns showing the products digested with EcoNI restriction enzyme (affected individuals heterozygous with AT genotype, 401, 256, and 145bp; unaffected individuals with TT genotype, 256 and 145 bp). M, marker; C1, C2 and C3 represent unrelated healthy individuals.

Structure predictions

Computer-assisted prediction of the human KRT5 protein was performed in order to obtain a better understanding of the effects of the mutation on its biochemical properties and structure. The results showed that the L202Q mutation caused a variation of the secondary structure with the omission of a β sheet (Fig. 3). In addition, the hydrophobicity of the corresponding region (Fig. 4) was decreased.

Figure 3.

Predicted secondary structures of (A) the wild-type and (B) mutant keratin 5. The target sequences are labeled with black circles. From top to bottom: Helix, sheet, turn, coil.

Figure 4.

Hydrophobicity plots of (A) wild-type and (B) mutated keratin 5. The x-axis represents the position of amino acids. The y-axis represents the hydrophobicity value in a default window size of 7. The mutant clearly exhibited lower hydrophilicity in the corresponding region, as compared with the wild-type (indicated by black arrows).

Discussion

In this pedigree, the diagnosis of EBS-loc with an autosomal dominant transmission mode was made on the basis of the clinical manifestations, family history and histopathological examination of the patients' skin.

Subsequently mutation analysis of the commonest candidate gene KRT5 was conducted using direct PCR sequencing and PCR-RFLP, and a missense mutation (c.605T>A, p.L202Q) was identified in KRT5. Since this mutation cosegregated with the disease in the family and was absent from the population controls, the possibility of a rare polymorphism was excluded, and it was considered as a novel mutation. The mutation replaces leucine with glutamine at the 202th amino acid on position 34 of the 1A helical domain of KRT5, which is highly conserved among other type II keratins (data not shown) and different species including human, dog, rat, mouse, chicken and zebrafish (Table II).

Table II.

Sequences producing specific alignment of amino acids in keratin 5.

Table II.

Sequences producing specific alignment of amino acids in keratin 5.

Species605 T>A (L202Q)
Dog VRFLEQQNKVLDTKWTLLQEQGTKTVRQN
Mouse VRFLEQQNKVLDTKWALLQEQGTKTIKQN
Rat VRFLEQQNKVLDTKWALLQEQGTKTVRQN
Rabbit VRFLEQQNKVLDTKWTLLQEQGTKTVRQS
Chicken VRFLEQQNKVLETKWSLLQEQGMKTVRNN
Pig VRFLEQQNKVLDTKWTLLQEQGIKTVRQN
Cattle VRFLEQQNKVLDTKWTLLQEQGTKTVRQN
Zebrafish VRFLEQQNKVLETKWSLLQEQT-TTRSNI
Human (wild-type) VRFLEQQNKVLDTKWTLLQEQGTKTVRQN
Human (III:3) VRFLEQQNKVLDTKWTQLQEQGTKTVRQN

[i] A protein-protein Basic Local Alignment Search Tool (National Center for Biotechnology Information) search of human keratin 5 amino acid sequence was performed. Proteins having various levels of sequence identity were selected and aligned. Multiple alignments revealed that the mutation site (bold letter) is highly conserved among different species.

In general, the most severe phenotype of EBS, EBS-DM, has been associated with mutations in more highly conserved helix boundary motifs, including the head of segment 1A and end of segment 2B in the rod domains of KRT5, which induce greater keratin aggregation in basal keratinocytes. By contrast, milder phenotypes, such as EBS-loc and EBS-gen, exhibit keratin monofilaments that appear relatively normal ultrastructurally and have been linked to mutations in linker domains and elsewhere in the rod domain of KRT5 (8–10). Consistent with previous reports, the p.L202Q mutation in this pedigree was identified at the end of the 1A domain, a non-helix boundary motif of KRT5, which resulted in the EBS-loc phenotype.

Computer-assisted prediction results indicated that the L202Q mutation would have a significant effect on the secondary structure and hydrophobicity of the protein. As shown in Fig. 4, the mutant appears to be missing a β sheet at the mutation site, which may due to the alteration of the polarity of the affected amino acid by the replacement of a non-polar hydrophobic leucine by a polar neutral glutamine. It has been demonstrated that a mutation in the coiled-coil motif of 1A domain of KRT5 often results in a significant distortion of the backbone over a turn, increasing the likelihood of impaired chain aggregation, and hence molecular assembly (11). It was therefore speculated that the omission of a β sheet could result in the reduction of hydrophobicity; however, further functional experiments are necessary to explore the underlying mechanisms in detail.

In this pedigree, the individual II:6 suffering from EBS had unaffected parents. There are two possible causes for that: Either the mutation is a de novo mutation or the penetrance of EBS was incomplete.

The present study reported a novel mutation of EBS in a Chinese pedigree. A previous report has revealed EBS types in Israel that have a unique mutation spectrum and different patterns of inheritance, including a higher incidence of recessive cases than in families from Europe or the USA (12). In addition, the proportion of Japanese patients with EBS with KRT5 mutations is 3-fold higher than those with KRT14 mutations, despite the fact that mutations in these two genes have been reported to be equally prevalent (13,14). Whether the mutation spectrum in Chinese patients with EBS is similar or unique to other ethnic groups remains unclear; therefore, further accumulation of clinical data is required, in order to confirm the spectrum of EBS mutations in China.

Acknowledgements

The authors would like to thank all the members of the pedigree for their kind cooperation. This study was supported by the National Natural Science Foundation of China (grant no. 81270365).

References

1 

Fine JD, Eady RA, Bauer EA, Briggaman RA, Tuderman Bruckner L, Christiano A, Heagerty A, Hintner H, Jonkman MF, McGrath J, et al: Revised classification system for inherited epidermolysis bullosa: Report of the Second International Consensus Meeting on diagnosis and classification of epidermolysis bullosa. J Am Acad Dermatol. 42:1051–1066. 2000. View Article : Google Scholar : PubMed/NCBI

2 

Coulombe PA, Kerns ML and Fuchs E: Epidermolysis bullosa simplex: A paradigm for disorders of tissue fragility. J Clin Invest. 119:1784–1793. 2009. View Article : Google Scholar : PubMed/NCBI

3 

Fuchs EV: The molecular biology of epidermolysis bullosa simplex. Clinical. Bauer EA, McGuire J and Moshell A: (Baltimore). Johns Hopkins University Press. 280–299. 1999.

4 

Horn HM and Tidman MJ: The clinical spectrum of epidermolysis bullosa simplex. Br J Dermatol. 142:468–472. 2000. View Article : Google Scholar : PubMed/NCBI

5 

Steinert PM: The two-chain coiled-coil molecule of native epidermal keratin intermediate filaments is a type I-type II heterodimer. J Biol Chem. 265:8766–8774. 1990.PubMed/NCBI

6 

Soetens O, Vauloup-Fellous C, Foulon I, Dubreuil P, De Saeger B, Grangeot-Keros L and Naessens A: Evaluation of different cytomegalovirus (CMV) DNA PCR protocols for analysis of dried blood spots from consecutive cases of neonates with congenital CMV infections. J Clin Microbiol. 46:943–946. 2008. View Article : Google Scholar : PubMed/NCBI

7 

Fine JD, Eady RA, Bauer EA, Bauer JW, Bruckner-Tuderman L, Heagerty A, Hintner H, Hovnanian A, Jonkman MF, Leigh I, et al: The classification of inherited epidermolysis bullosa (EB): Report of the third international consensus meeting on diagnosis and classification of EB. J Am Acad Dermatol. 58:931–950. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Liovic M, Stojan J, Bowden PE, Gibbs D, Vahlquist A, Lane EB and Komel R: A novel keratin 5 mutation (K5V186L) in a family with EBS-K: A conservative substitution can lead to development of different disease phenotypes. J Invest Dermatol. 116:964–969. 2001. View Article : Google Scholar : PubMed/NCBI

9 

Murrell DF, Trisnowati N, Miyakis S and Paller AS: The yin and the yang of keratin amino acid substitutions and epidermolysis bullosa simplex. J Invest Dermatol. 131:1787–1790. 2011. View Article : Google Scholar : PubMed/NCBI

10 

Bolling MC, Lemmink HH, Jansen GH and Jonkman MF: Mutations in KRT5 and KRT14 cause epidermolysis bullosa simplex in 75% of the patients. Br J Dermatol. 164:637–644. 2011.PubMed/NCBI

11 

Smith TA, Steinert PM and Parry DA: Modeling effects of mutations in coiled-coil structures: Case study using epidermolysis bullosa simplex mutations in segment 1a of K5/K14 intermediate filaments. Proteins. 55:1043–1052. 2004. View Article : Google Scholar : PubMed/NCBI

12 

Ciubotaru D, Bergman R, Baty D, Indelman M, Pfendner E, Petronius D, Moualem H, Kanaan M, Ben Amitai D, McLean WH, et al: Epidermolysis bullosa simplex in Israel: Clinical and genetic features. Arch Dermatol. 139:498–505. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Yasukawa K, Sawamura D, Goto M, Nakamura H, Jung SY, Kim SC and Shimizu H: Epidermolysis bullosa simplex in Japanese and Korean patients: Genetic studies in 19 cases. Br J Dermatol. 155:313–317. 2006. View Article : Google Scholar : PubMed/NCBI

14 

Shinkuma S, Natsuga K, Nishie W and Shimizu H: Epidermolysis bullosa in Japan. Dermatol Clin. 28:431–432. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Gao J, Wang X, Zheng F, Dong S and Qiu X: Novel keratin 5 mutation in a family with epidermolysis bullosa simplex. Exp Ther Med 10: 2432-2436, 2015.
APA
Gao, J., Wang, X., Zheng, F., Dong, S., & Qiu, X. (2015). Novel keratin 5 mutation in a family with epidermolysis bullosa simplex. Experimental and Therapeutic Medicine, 10, 2432-2436. https://doi.org/10.3892/etm.2015.2811
MLA
Gao, J., Wang, X., Zheng, F., Dong, S., Qiu, X."Novel keratin 5 mutation in a family with epidermolysis bullosa simplex". Experimental and Therapeutic Medicine 10.6 (2015): 2432-2436.
Chicago
Gao, J., Wang, X., Zheng, F., Dong, S., Qiu, X."Novel keratin 5 mutation in a family with epidermolysis bullosa simplex". Experimental and Therapeutic Medicine 10, no. 6 (2015): 2432-2436. https://doi.org/10.3892/etm.2015.2811
Copy and paste a formatted citation
x
Spandidos Publications style
Gao J, Wang X, Zheng F, Dong S and Qiu X: Novel keratin 5 mutation in a family with epidermolysis bullosa simplex. Exp Ther Med 10: 2432-2436, 2015.
APA
Gao, J., Wang, X., Zheng, F., Dong, S., & Qiu, X. (2015). Novel keratin 5 mutation in a family with epidermolysis bullosa simplex. Experimental and Therapeutic Medicine, 10, 2432-2436. https://doi.org/10.3892/etm.2015.2811
MLA
Gao, J., Wang, X., Zheng, F., Dong, S., Qiu, X."Novel keratin 5 mutation in a family with epidermolysis bullosa simplex". Experimental and Therapeutic Medicine 10.6 (2015): 2432-2436.
Chicago
Gao, J., Wang, X., Zheng, F., Dong, S., Qiu, X."Novel keratin 5 mutation in a family with epidermolysis bullosa simplex". Experimental and Therapeutic Medicine 10, no. 6 (2015): 2432-2436. https://doi.org/10.3892/etm.2015.2811
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team