Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
July-2016 Volume 12 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
July-2016 Volume 12 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway

  • Authors:
    • Te Liu
    • Suwei Wang
    • Lina Zhang
    • Lihe Guo
    • Zhihua Yu
    • Chuan Chen
    • Jin Zheng
  • View Affiliations / Copyright

    Affiliations: Department of Gynecology, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai 200031, P.R. China, Shanghai Geriatric Institute of Chinese Medicine, Longhua Hospital, Shanghai University of Traditional Chinese Medicine, Shanghai 200031, P.R. China, Institute of Biochemistry and Cell Biology, Shanghai Institute for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, P.R. China
    Copyright: © Liu et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 215-221
    |
    Published online on: May 10, 2016
       https://doi.org/10.3892/etm.2016.3326
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Premature ovarian failure (POF) is a condition affecting 1% of women in the general population, causing amenorrhea, hypergonadotropism and hypoestrogenism before the age of 40. Currently, POF cannot be reversed and, although treatments are available, there is an urgent need for improved treatment strategies. Growth hormone (GH) is a pleiotropic hormone that affects a broad spectrum of physiological functions, from carbohydrate and lipid metabolism to the immune response. GH has previously been used to treat POF in non‑transgenic preclinical trials, but the biochemical mechanism underlying these effects are unclear. In the present study, a mouse model of POF was generated using cyclophosphamide. Treatment of POF mice with recombinant mouse growth hormone (rmGH) was revealed to markedly reduce POF histopathology in ovarian tissue, relieve ovarian granulosa cell injury, reduce the number of atretic follicles and significantly increase the number of mature oocytes. Furthermore, an enzyme‑linked immunosorbent assay revealed that plasma estradiol levels increased and plasma follicle stimulating hormone levels decreased with time in a group of mice treated with a medium dose of rmGH (0.8 mg/kg) when compared with the POF model group (P<0.05). In addition, reverse transcription‑quantitative polymerase chain reaction and immunohistochemical analysis demonstrated elevated levels of Notch‑1 signaling pathway factors (Notch1, CBF1, and HES1) in wild‑type mice and those treated with medium and high doses of rmGH, but not in those treated with low doses of rmGH. In conclusion, GH may promote ovarian tissue repair, estrogen release and oocyte maturation via activation of the Notch‑1 signaling pathway in ovarian tissue.

Introduction

Premature ovarian failure (POF) is a condition that causes amenorrhea and hypergonadotropic hypoestrogenism before the age of 40 (1–5). POF affects 1% of women in the general population, but its prevalence is steadily increasing (1–5). Patients with POF demonstrate a number of characteristic symptoms, as follows: i) Primary or secondary amenorrhea (2,6–8); ii) intermittent or chronic hypoestrogenism (2,6); and iii) hypergonadotropism (7,8). Furthermore, the age of patients at the time of onset is typically under 40 years of age (3–6). In a number of reports describing patients with POF, laparoscopy has revealed an absence of developing follicles, and ovarian biopsies have demonstrated a network of connective tissue interspersed with fibroblasts. Previous studies have reported that the uterus and vaginal mucosa in patients with POF undergo atrophy due to estrogen understimulation as a result of inactive ovaries (4,9). Currently, POF is irreversible and, although treatments are available, drugs to treat POF are very limited; there are no particularly effective treatments and drugs. Hormonal therapy and in vitro fertilization methods are available to help patients with POF conceive, but there is an urgent requirement for improved treatment strategies (5–7,9).

Growth hormone (GH) is a pleiotropic hormone that affects a broad spectrum of physiological functions, from carbohydrate and lipid metabolism to immune response (10–16). Several previous studies have used GH to treat autoimmune diseases and POF. For example, Rojanathammanee et al (14) reported that GH alters the glutathione S-transferase and mitochondrial thioredoxin systems in long-living Ames dwarf mice. Villares et al (16) used GH to treat type 1 diabetes, demonstrating that it prevented the development of diabetes by a mechanism involving specific GH-mediated effects on islet β-cells, Th17/Th1 plasticity, M1/M2 macrophage differentiation and Treg cell function. Visser et al (11) reported that serum anti-Müllerian hormone levels correlated with karyotype, pubertal development, luteinizing hormone and follicle-stimulating hormone (FSH), and is detected at higher levels in patients with Turner syndrome undergoing GH therapy. Furthermore, Hartmann et al (12) evaluated the effects of oral hormone replacement therapy (HRT) on body weight, insulin-like growth factor 1 (IGF-1) levels and GH response to exogenous GnRH in women with POF. This previous study revealed that women with POF who were not treated with HRT had significantly higher IGF-1 levels, compared with women with POF treated with HRT, which reduced during HRT; however, the body weight of these patients remained stable (12). Numerous studies are beginning to generate and characterize a number of GH-encoding transgenes in mice, expressing factors such as ovine GH, human GH and bovine GH (11–13,16). Although GH has been used in preclinical trials to treat POF, the mechanisms underlying its activity in the alleviation of POF are poorly understood.

The Notch signaling pathway has critical roles in the development and homeostasis of tissues by regulating cell fate, proliferation, differentiation and apoptosis, and in stem cell self-renewal (17,18). The Notch proteins are a family of evolutionarily conserved receptors that regulate cell fate (17–22). These Notch receptors are activated following direct contact with their ligands, which are expressed on adjacent cells (18,19). In mammals, there are four Notch receptors (NOTCH1-NOTCH4) and five ligands (Jagged-1 and −2 and delta-like protein 1, 3, and 4) (18,20). NOTCH receptors have extracellular, transmembrane and intracellular domains (18,19). Upon ligand binding, the NOTCH intracellular domain (NICD) of the receptor is cleaved by γ-secretase and translocates to the nucleus, where it associates with the recombination signal-binding protein jκ (RBPjκ) (16,17,20). RBPjκ is a key transcription factor in the canonical Notch signaling pathway, and acts downstream of all four NOTCH receptors (19–21). Within the nucleus, NICD forms a large transcriptional activator complex with RBPjκ/CBF1 and Mastermind (19–21). This transcriptional complex then activates the transcription of target genes such as hairy/enhancer of split (Hes) and Hes-associated with YRPW motif, two proteins of the basic helix-loop-helix gene families (21,22). A previous study has demonstrated that the Notch/Hes-1 signaling pathway controls the proliferation of intestinal immature progenitor cells (21). A number of previous studies have indicated that Notch also works with other transcription factors to regulate the expression of its target genes such as cyclin D1, B cell lymphoma 2 and Survivin (16–19,21,22). Furthermore, Notch-1 overexpression has been reported to inhibit apoptosis in numerous types of human cancer, suggesting that it has potential as a therapeutic target (19–22).

The current study aimed to determine whether recombinant GH can be used as a treatment of POF, and to investigate whether the therapeutic activity of GH is associated with the activation of the Notch-1 signaling pathway.

Materials and methods

Generation of a mouse model of POF and treatment with recombinant mouse growth hormone (rmGH)

Female C57BL/6 mice (n=72) at 4–5 weeks of age, ~20 g weight, were obtained from the Animal Research Center, Longhua Hospital (Shanghai, China). The present study received ethical approval from the Animal Ethics Committee of the Shanghai University of Traditional Chinese Medicine, in compliance with the Experimental Animal Regulations of the National Science and Technology Commission, China. A total of 3–4 mice per cage were maintained for 14 days in a temperature-controlled environment under 12 h light-dark cycles with ad libitum access to food and water as previously described (23). To induce POF, mice were administered a single intraperitoneal injection of 70 mg/kg cyclophosphamide (Sigma-Aldrich, St. Louis, MO, USA) at 7 weeks of age. The animals were divided into control and experimental groups as follows: i) An untreated control group (wild-type; WT) of 12 mice; ii) a negative control group of 12 POF mice receiving a saline injection (100 µl); four experimental groups of 12 POF mice, injected daily with 100 µl of either iii) 0.4 (low-dose); iv) 0.8 (medium-dose); or v) 1.6 (high-dose) mg/kg rmGH (Sigma-Aldrich), dissolved in saline; vi) 12 POF mice were not administered any treatment. Injections of saline or rmGH were provided a week after induction of POF, and additional experiments were conducted 21 days after this treatment. At this point, mice were sacrificed by cervical dislocation.

Enzyme-linked immunosorbent assay (ELISA)

Mouse blood plasma (100 µl) was obtained by mouse retro-orbital blood collection (23), centrifuged at 453 × g at 4°C for 10 min, and the supernatant was collected. The mouse estradiol (E2) and FSH ELISA kit (cat. nos. 29764 and 29755; Westang Bio, Shanghai, China) was used according to the manufacturer's protocol, in order to determine the levels of E2 or FSH in the mouse blood plasma. Briefly, 100 µl of mouse E2 or FSH antigens standardized to 125–8,000 pg/ml or 0.156–10 ng/ml, or diluted mouse plasma, were added to the anti-E2 or FSH antibody-precoated microwells (as appropriate, in the case of the antigens) and incubated for 60 min. Following 3 washes, horseradish peroxidase-conjugated detection antibodies were added, followed by the substrate solution (Westang Bio). The absorbance of each well was measured at 450 nm using a microplate reader (BioTek Synergy Mx; BioTek Instruments, Inc., Winooski, VT, USA).

Hematoxylin and eosin staining

Briefly, all ovarian tissue samples were washed 3 times with phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde (Sigma-Aldrich) for 30 min, dehydrated using a graded series of ethanol, vitrified in xylene and embedded in paraffin (both purchased from Sigma-Aldrich). Following this, serial 6-µm thick sections (Leica RM2235 microtome; Leica Microsystems, Wetzlar, Germany) were made and stained with hematoxylin and eosin (Sigma-Aldrich).

RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA (200 ng/µl) was isolated from mouse ovary tissue from each cell type using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. RNA samples were treated with DNase I (2.0 mU/µl; Sigma-Aldrich), quantified and reverse-transcribed into cDNA (20 µl) using the ReverTra Ace-α reverse transcription kit (cat. no. FKS-101; Toyobo Co., Ltd., Osaka, Japan). RT-qPCR was conducted using a realplex4 real-time PCR detection system (Eppendorf, Hamburg, Germany) with SYBR Green PCR Master mix (Toyobo Co., Ltd.). Primers used for cDNA amplification are listed in Table I. RT-qPCR amplification was performed over 40 cycles of denaturation at 95°C for 15 sec, annealing at 58°C for 45 sec and final elongation at 72°C for 42 sec (initial denaturation at 95°C for 5 min for 1 cycle, and final elongation at 72°C for 10 min for 1 cycle). Target cDNA levels were then measured using the 2−ΔΔCq relative quantification method (24). Comparative quantification cycle (Cq) values were used to determine relative gene expression, normalized to 18S rRNA. For each sample, Cq values were normalized using the following formula: ΔCq = Cq experimental genes - Cq 18S rRNA. Relative expression levels were calculated using the formula: ΔΔCq = ΔCq all groups - ΔCq untreated control group.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

Table I.

Primers used for reverse transcription-quantitative polymerase chain reaction.

GenePrimer (5′-3′)
NOTCH1
  F CTCCAACTGTGACACCAACCCTG
  R TGTAGCCCTGTAGACACTGGCACTC
CBF1
  F GTGGCACTGTTCAATCGCCTTCG
  R CAGTCTGCCCGTAATGGATGTAG
Hes1
  F GAGAAGAGGCGAAGGGCAAGAATAAA
  R CAACACGCTCGGGTCTGTGCTGA
Ccnd1
  F TGTGAGGAGCAGAAGTGCGAAGA
  R GCCGGATAGAGTTGTCAGTGTAGATGC
18S rRNA
  F AGGGGAGAGCGGGTAAGAGA
  R GGACAGGACTAGGCGGAACA

[i] F, forward; R, reverse; Hes1, hairy/enhancer of split; Ccnd1, cyclin D1; rRNA, ribosomal RNA.

Immunohistochemistry

Immunohistochemical analysis was performed as previously described (23,25). Briefly, all ovarian tissue samples were washed 3 times with PBS, fixed with 4% paraformaldehyde for 30 min, dehydrated through a graded series of ethanol, vitrified in xylene and embedded in paraffin. Subsequently, serial 6-µm thick sections were made, rinsed with 3% phosphate buffer (Sigma-Aldrich), and subjected to microwave heat repairing. The samples were then incubated with primary antibodies for 45 min at 37°C, as follows: Anti-NOTCH-1 (1:1,000 dilution; mouse polyclonal; cat. no. sc-6014); anti-CBF-1 (1:1,000 dilution; mouse polyclonal; cat. no. sc-9417); anti-Hes-1 (1:100 dilution; mouse polyclonal; cat. no. sc-13844); and anti-p53 (1:100 dilution; goat polyclonal; sc-1313) (all Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Horseradish-peroxidase conjugated goat anti-rabbit immunoglobulin G (1:1,000 dilution; sc-2768; Santa Cruz Biotechnology Inc.) was then incubated with samples for 45 min at 37°C. Finally, ABC chromogenic reagent (Sigma-Aldrich) was added to aid the visualization of the secondary antibody, in addition to color detection. PBS (pH 7.4) was used as a negative control in the place of primary antibody. Five randomly selected fields of view (magnification, ×200; Olympus BX43; Olympus Corporation, Tokyo, Japan) were observed for each tissue section and analyzed using IPP software (version 4.0; Intel Corporation, Santa Clara, CA, USA).

Statistical analysis

All data were analyzed using GraphPad Prism version 5.0 (GraphPad Software, Inc., La Jolla, CA, CA, USA). The data in each experiment are reported as the mean ± standard error, where applicable, and the differences were evaluated for statistical significance with one-way analysis of variance. P<0.05 was considered to represent a statistically significant difference.

Results

Medium doses of rmGH rescue ovarian weight, hormone secretion and the number of normal follicles in POF mice

At 14 days after injection, the weight of the ovaries in each group was determined (Fig. 1A). A statistically significant difference was not observed in ovarian weight between POF mice (2.934±0.257 mg), POF mice treated with a low dose of rmGH (3.939±0.321 mg) and POF mice treated with saline (3.014±0.365 mg) 14 days after injection. However, ovarian weight in medium-dose (4.268±0.405 mg) and high-dose groups (6.545±0.551 mg) was significantly increased when compared with that of the POF model group (P<0.05; n=12 mice; Fig. 1A). An ELISA revealed no observably statistically significant difference in plasma E2 levels between the POF model group (64.58±7.93 pg/ml), the low-dose group (112.41±10.15 pg/ml) and the negative control group treated with saline (72.94±9.32 pg/ml). Conversely, the plasma E2 levels increased with time in medium-dose (242.12±15.39 pg/ml) and high-dose (463.32±29.91 pg/ml) groups compared with that of the POF model group (P<0.05; n=12 mice; Fig. 1B). An ELISA also indicated that plasma FSH levels did not appear to vary significantly between the POF model group (1,351.01±68.61 pg/ml), the low-dose group (778.41±97.48 pg/ml) and the saline-treated group (1,308.02±81.14 pg/ml), but decreased significantly with time in the medium-dose group (618.22±95.11 pg/ml) compared with the POF model group (P<0.05; n=12 mice; Fig. 1B). Conversely, the plasma FSH levels increased with time in the high-dose group (3,357.04±407.81 pg/ml) when compared with the POF model group (P<0.01; n=12 mice; Fig. 1B).

Figure 1.

Ovarian weight, plasma E2 and FSH levels and follicle count following treatment with rmGH or saline, reported as means ± standard error. (A) Ovarian weight in Wt mice was significantly higher compared with the POF model and saline-treated mice, but no significant difference was identified between medium- and high-dose rmGH-treated POF mice. (B) Plasma E2 levels increased with time in medium-dose and high-dose groups compared with the POF model group. Meanwhile, plasma FSH levels did not appear to vary significantly between the POF model group, the low-dose group and the saline-treated group, but decreased significantly with time in the medium-dose group compared with the POF model group. (C) Follicle counts revealed no statistically significant difference in normal and atretic follicles counts between the POF model and saline-treated groups. Conversely, medium- and high-dose groups had a lower number of atretic follicles than the POF model group. **P<0.01, vs. the POF group; *P<0.05, vs. the POF group; #P>0.05, vs. the POF group; n=12 mice/group. Wt, wild-type; POF, premature ovarian failure model (untreated group); rmGH, recombinant mouse growth hormone; E2, estradiol; FSH, follicle stimulating hormone.

Following this, the number of normal and atretic ovarian follicles were counted in each group. A statistically significant difference was not identified in the number of normal follicles and atretic follicles between the POF model group (3±1 and 11±2, respectively), the low-dose group (5±2 and 9±1, respectively) and the saline-treated group (3±2 and 11±2, respectively). Conversely, the medium-dose (10±2 normal and 4±1 atretic follicles) and high-dose (6±2 normal and 6±2 atretic follicles) groups had a lower number of atretic follicles than that observed in the POF model group (P<0.05; n=12 mice; Fig. 1C).

Hematoxylin and eosin staining revealed that the ovaries of WT mice contained a large number of follicles at all stages of development, ranging from immature to mature (Fig. 2). Conversely, the atrophied ovaries of POF mice consisted primarily of interstitial cells in a fibrous matrix, with a reduced number of follicles at each stage. Furthermore, the ovaries of the POF mice contained an increased number of collapsed oocytes and ovaries were smaller than those of WT mice (Fig. 2). However, following treatment with rmGH, mice exhibited a significant reduction in POF pathology within their ovaries, attenuation of ovarian granulosa cell injury, reduction in the number of atretic follicles and a significant increase in the number of mature oocytes (Fig. 2).

Figure 2.

Pathology of mouse ovarian tissue samples following treatment with rmGH or saline, observed using hematoxylin and eosin staining. rmGH treatment significantly improved ovarian tissue pathology, attenuated ovarian granulosa cell injury, reduced the number of atretic follicles and increased the number of mature oocytes in a dose-dependent manner. Magnification, ×200. Scale bar = 200 µm. Wt, wild-type; rmGH, recombinant mouse growth hormone.

Medium doses of rmGH activate the Notch-1 signaling pathway in the ovarian granulosa cells of POF mice

At 14 days after injection, the expression levels of the genes involved in the Notch-1 signaling pathway in mouse ovarian granulosa cells were analyzed by RT-qPCR and immunohistochemistry. The RT-qPCR results revealed that the expression levels of Notch1 signaling pathway genes (NOTCH1, Cbf1 and Hes1) and cell proliferation factor (Ccnd1; cyclin D1) had decreased in the POF model group compared with the WT group (P<0.05; n=12 mice; Fig. 3). Furthermore, a statistically significant difference was not identified in the expression levels of the Notch-1 signaling pathway genes and the Ccnd1 between the POF model group, the low-dose group, high-dose group and the saline-treated group (P>0.05; n=12 mice; Fig. 3). However, the expression levels of Notch-1 signaling pathway genes and Ccnd1 were significantly elevated in the medium-dose group compared with the POF model group (P<0.01; n=12 mice; Fig. 3). Immunohistochemical staining also revealed positive staining for Notch1 signaling pathway factors (Notch1, CBF1, and HES1) in the WT group, medium-dose group and high-dose group, but not in the low-dose or saline-treated groups (Fig. 4). However, p53 staining was positive in the low-dose and saline-treated groups, but not in the WT, medium-dose or high-dose groups (Fig. 4).

Figure 3.

mRNA expression analysis of the Notch1 signaling pathway and cell proliferation factors using reverse transcription-quantitative polymerase chain reaction. Expression levels of Notch1 signaling pathway genes (Notch1, Cbf1, and Hes1) and cell proliferation factor (Ccnd1) were significantly elevated in the medium-dose group compared with the POF model group. **P<0.01, vs. the POF (untreated) group; n=12 mice/group. Wt, wild-type; POF, premature ovarian failure model; rmGH, recombinant mouse growth hormone; Hes1, hairy/enhancer of split; Ccnd1, cyclin D1.

Figure 4.

Protein expression of Notch1 signaling pathway factors and p53 using immunohistochemistry. Staining indicated positive or markedly positive staining for Notch1 signaling pathway factors (Notch1, CBF1, and HES1), but not for p53 in the Wt, medium-dose, and high-dose groups, as compared with the low-dose and saline-treated groups. Magnification, ×200. Scale bar=200 µm. POF, premature ovarian failure model; rmGH, recombinant mouse growth hormone; Wt, wild-type; HES1, hairy/enhancer of split.

Discussion

POF is an impactful disease and, at present, there is no cure or effective treatment available for POF. Women diagnosed with POF are faced with significant physical and emotional challenges, as this disease can lead to loss of fertility, in addition to osteoporosis and other complications (1–5). GH is a pleiotropic hormone that affects a broad spectrum of physiological functions, from carbohydrate and lipid metabolism to the immune response (10–16). Several previous studies have reported the effective use of GH to treat autoimmune diseases and POF (14–16). However, the mechanism underlying GH activity in the treatment of these diseases remains unclear. In the present study, three main questions are addressed: i) Does rmGH improve hormone release and oocyte maturation in mice exhibiting POF? ii) Is the effect of rmGH on the regulation of hormone levels and oocyte maturation dose-dependent? and iii) What therapeutic mechanism does rmGH employ to control hormone release and oocyte maturation in POF mice?

Although E2 and FSH hormone levels in POF mice were significantly improved following treatment with medium and high doses of rmGH treatment, a medium dose of rmGH was the most effective, leading to significantly increased E2 levels and decreased FSH levels in the peripheral blood of POF mice. High doses of rmGH also elevated E2 levels in peripheral blood, although FSH levels significantly increased from that observed in the medium-dose group. It may be speculated that high doses of GH stimulate the body to release hormones in a non-specific manner, causing this increase in FSH. GH was also reported to stimulate oocyte maturation and reduce the number of atretic follicles in a dose-dependent manner; these effects were only observed in POF mice treated with medium and high doses of rmGH. Oocyte maturation is closely associated with several factors, including the ovarian microenvironment, the extent of development of the ovarian corpus luteum, the activity of ovarian granulosa cells, hormone release and endocrine regulation (1–5). The results of the current study confirm that GH may effectively treat multiple features of POF in mice displaying disease symptoms.

The novel evidence that GH regulates the expression of Notch-1 signaling pathway genes in ovarian tissue from POF mice in order to induce regeneration and repair was also presented. The Notch-1 signaling pathway is known to regulate cell proliferation and tumorigenesis but, to the best of our knowledge, it has not previously been associated with POF. In the current study, Notch-1 signaling pathway genes were expressed at different levels when POF mice were treated with varying concentrations of GH. For example, a medium dose of rmGH caused the greatest activation of Notch-1 signaling pathway genes in the ovarian tissue of POF mice. The hypothesized role of the Notch pathway genes based on the current model suggests that the direct effect of Notch-1 signaling pathway activation is the proliferation of ovarian cells to restore function, and thus, repair and replace damaged ovarian cells in the POF mouse model. It is therefore hypothesized that GH was activated through the expression of the Notch-1 pathway in ovarian cells to repair ovarian function.

In conclusion, the results of the present study suggest that GH promotes ovarian tissue repair and regeneration, estrogen release and oocyte maturation by activating the expression of Notch-1 signaling pathway factors in the ovarian tissue of mice exhibiting POF.

Acknowledgements

The present study was supported by the National Natural Science Foundation of China (grant no. 81273794), the National Natural Science Foundation of China (grant no. 81202811), and the China Postdoctoral Science Foundation (grant nos. 2014M550250 and 2015T80455).

References

1 

Bandyopadhyay S, Chakrabarti J, Banerjee S, Pal AK, Goswami SK, Chakravarty BN and Kabir SN: Galactose toxicity in the rat as a model for premature ovarian failure: An experimental approach readdressed. Hum Reprod. 18:2031–2038. 2003. View Article : Google Scholar : PubMed/NCBI

2 

Beck-Peccoz P and Persani L: Premature ovarian failure. Orphanet J Rare Dis. 1:92006. View Article : Google Scholar : PubMed/NCBI

3 

Persani L, Rossetti R and Cacciatore C: Genes involved in human premature ovarian failure. J Mol Endocrinol. 45:257–279. 2010. View Article : Google Scholar : PubMed/NCBI

4 

McGuire MM, Bowden W, Engel NJ, Ahn HW, Kovanci E and Rajkovic A: Genomic analysis using high-resolution single-nucleotide polymorphism arrays reveals novel microdeletions associated with premature ovarian failure. Fertil Steril. 95:1595–1600. 2011. View Article : Google Scholar : PubMed/NCBI

5 

Vujović S, Ivović M, Tancić-Gajić M, Marina L, Barać M, Arizanorić Z, Nenezić A, Ivaniserić M, Micić J, Sajić S and Micić D: Premature ovarian failure. Srp Arh Celok Lek. 140:806–811. 2012. View Article : Google Scholar : PubMed/NCBI

6 

Qin Y, Sun M, You L, Wei D, Sun J, Liang X, Zhang B, Jiang H, Xu J and Chen ZJ: ESR1, HK3 and BRSK1 gene variants are associated with both age at natural menopause and premature ovarian failure. Orphanet J Rare Dis. 7:52012. View Article : Google Scholar : PubMed/NCBI

7 

Rebar RW: Premature ovarian 'failure' in the adolescent. Ann N Y Acad Sci. 1135:138–145. 2008. View Article : Google Scholar : PubMed/NCBI

8 

Kalantari H, Madani T, Zari Moradi S, Mansouri Z, Almadani N, Gourabi H and Mohseni Meybodi A: Cytogenetic analysis of 179 Iranian women with premature ovarian failure. Gynecol Endocrinol. 29:588–591. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Duncan M, Cummings L and Chada K: Germ cell deficient (gcd) mouse as a model of premature ovarian failure. Biol Reprod. 49:221–227. 1993. View Article : Google Scholar : PubMed/NCBI

10 

Cecchi CR, Higuti E, Oliveira NA, Lima ER, Jakobsen M, Dagnaes-Hansen F, Gissel H, Aagaard L, Jensen TG, Jorge AA, et al: A novel homologous model for gene therapy of dwarfism by non-viral transfer of the mouse growth hormone gene into immunocompetent dwarf mice. Curr Gene Ther. 14:44–51. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Visser JA, Hokken-Koelega AC, Zandwijken GR, Limacher A, Ranke MB and Flück CE: Anti-Müllerian hormone levels in girls and adolescents with Turner syndrome are related to karyotype, pubertal development and growth hormone treatment. Hum Reprod. 28:1899–1907. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Hartmann BW, Kirchengast S, Albrecht A, Huber JC and Söregi G: Effect of hormone replacement therapy on growth hormone stimulation in women with premature ovarian failure. Fertil Steril. 68:103–107. 1997. View Article : Google Scholar : PubMed/NCBI

13 

Kopchick JJ, List EO, Kelder B, Gosney ES and Berryman DE: Evaluation of growth hormone (GH) action in mice: Discovery of GH receptor antagonists and clinical indications. Mol Cell Endocrinol. 386:34–45. 2014. View Article : Google Scholar : PubMed/NCBI

14 

Rojanathammanee L, Rakoczy S and Brown-Borg HM: Growth hormone alters the glutathione S-transferase and mitochondrial thioredoxin systems in long-living Ames dwarf mice. J Gerontol A Biol Sci Med Sci. 69:1199–1211. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Chesnokova V, Zhou C, Ben-Shlomo A, Zonis S, Tani Y, Ren SG and Melmed S: Growth hormone is a cellular senescence target in pituitary and nonpituitary cells. Proc Natl Acad Sci USA. 110:E3331–E3339. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Villares R, Kakabadse D, Juarranz Y, Gomariz RP, Martínez AC and Mellado M: Growth hormone prevents the development of autoimmune diabetes. Proc Natl Acad Sci USA. 110:E4619–E4627. 2013. View Article : Google Scholar : PubMed/NCBI

17 

Subramaniam D, Ponnurangam S, Ramamoorthy P, Standing D, Battafarano RJ, Anant S and Sharma P: Curcumin induces cell death in esophageal cancer cells through modulating Notch signaling. PLoS One. 7:e305902012. View Article : Google Scholar : PubMed/NCBI

18 

Yao L, Kan EM, Kaur C, Dheen ST, Hao A, Lu J and Ling EA: Notch-1 signaling regulates microglia activation via NF-κB pathway after hypoxic exposure in vivo and in vitro. PLoS One. 8:e784392013. View Article : Google Scholar : PubMed/NCBI

19 

Ji X, Wang Z, Geamanu A, Goja A, Sarkar FH and Gupta SV: Delta-tocotrienol suppresses notch-1 pathway by upregulating miR-34a in nonsmall cell lung cancer cells. Int J Cancer. 131:2668–2677. 2012. View Article : Google Scholar : PubMed/NCBI

20 

Zhang H, Hilton MJ, Anolik JH, Welle SL, Zhao C, Yao Z, Li X, Wang Z, Boyce BF and Xing L: NOTCH inhibits osteoblast formation in inflammatory arthritis via noncanonical NF-κB. J Clin Invest. 124:3200–3214. 2014. View Article : Google Scholar : PubMed/NCBI

21 

Chen G, Qiu Y, Sun L, Yu M, Wang W, Xiao W, Yang Y, Liu Y, Yang S, Teitelbaum DH, et al: The Jagged-2/Notch-1/Hes-1 pathway is involved in intestinal epithelium regeneration after intestinal ischemia-reperfusion injury. PLoS One. 8:e762742013. View Article : Google Scholar : PubMed/NCBI

22 

Wang Z, Azmi AS, Ahmad A, Banerjee S, Wang S, Sarkar FH and Mohammad RM: TW-37, a small-molecule inhibitor of Bcl-2, inhibits cell growth and induces apoptosis in pancreatic cancer: Involvement of Notch-1 signaling pathway. Cancer Res. 69:2757–2765. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Liu T, Huang Y, Zhang J, Qin W, Chi H, Chen J, Yu Z and Chen C: Transplantation of human menstrual blood stem cells to treat premature ovarian failure in mouse model. Stem Cells Dev. 23:1548–1557. 2014. View Article : Google Scholar : PubMed/NCBI

24 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(−delta delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

25 

Shen DZ, Xin SL, Chen C and Liu T: Effect of atorvastatin on expression of TLR4 and NF-κB p65 in atherosclerotic rabbits. Asian Pac J Trop Med. 6:493–496. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Liu T, Wang S, Zhang L, Guo L, Yu Z, Chen C and Zheng J: Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway. Exp Ther Med 12: 215-221, 2016.
APA
Liu, T., Wang, S., Zhang, L., Guo, L., Yu, Z., Chen, C., & Zheng, J. (2016). Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway. Experimental and Therapeutic Medicine, 12, 215-221. https://doi.org/10.3892/etm.2016.3326
MLA
Liu, T., Wang, S., Zhang, L., Guo, L., Yu, Z., Chen, C., Zheng, J."Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway". Experimental and Therapeutic Medicine 12.1 (2016): 215-221.
Chicago
Liu, T., Wang, S., Zhang, L., Guo, L., Yu, Z., Chen, C., Zheng, J."Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway". Experimental and Therapeutic Medicine 12, no. 1 (2016): 215-221. https://doi.org/10.3892/etm.2016.3326
Copy and paste a formatted citation
x
Spandidos Publications style
Liu T, Wang S, Zhang L, Guo L, Yu Z, Chen C and Zheng J: Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway. Exp Ther Med 12: 215-221, 2016.
APA
Liu, T., Wang, S., Zhang, L., Guo, L., Yu, Z., Chen, C., & Zheng, J. (2016). Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway. Experimental and Therapeutic Medicine, 12, 215-221. https://doi.org/10.3892/etm.2016.3326
MLA
Liu, T., Wang, S., Zhang, L., Guo, L., Yu, Z., Chen, C., Zheng, J."Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway". Experimental and Therapeutic Medicine 12.1 (2016): 215-221.
Chicago
Liu, T., Wang, S., Zhang, L., Guo, L., Yu, Z., Chen, C., Zheng, J."Growth hormone treatment of premature ovarian failure in a mouse model via stimulation of the Notch-1 signaling pathway". Experimental and Therapeutic Medicine 12, no. 1 (2016): 215-221. https://doi.org/10.3892/etm.2016.3326
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team