Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2016 Volume 12 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus

  • Authors:
    • Hong Zhang
    • Haiqing Li
    • Yan Liu
    • Qingyan Li
    • Yufang Bi
    • Guiqing Fang
  • View Affiliations / Copyright

    Affiliations: Department of Clinical Laboratory, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China, Department of Nursing, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China, Health Management Center, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China, Operation Room, The Sixth People's Hospital of Jinan, Jinan, Shandong 250200, P.R. China, Department of Clinical Laboratory, Jinan Stomatological Hospital, Jinan, Shandong 250001, P.R. China
    Copyright: © Zhang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 3571-3574
    |
    Published online on: October 14, 2016
       https://doi.org/10.3892/etm.2016.3805
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the study was to investigate the characteristic function of the upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus (MRSA). After separating the MRSA in clinic, the expression of miR-7 mRNA was tested by reverse transcription polymerase chain reaction. The overexpression, inhibition of miR-7, and control group were established by plasmid in vitro. Following transfection of the bacterial strain, the effect of β-lactam antibiotics in minimum inhibitory concentration (MIC) was observed using the microporous dilution method, and antibacterial effects in vitro were observed using the dynamic growth curve method. The expression of miR-7 in sensitive MRSA was upregulated distinctly, with significant difference (P<0.05). MIC and the number of bacteria in the miR-7 overexpression group significantly increased while the inhibition group decreased prominently, with significant difference (P<0.05). The control and null plasmid groups revealed no significant difference. In conclusion, miR-7 upregulated the antimicrobial activity of MRSA, and the intervention of its expression may become a possible antibacterial target.

Introduction

As a super bacteria, methicillin-resistant Staphylococcus aureus (MRSA) shows resistance to a great deal of antibacterial agents, except for a few agents including vancomycin, teicoplanin, and linezolid (1). The domain resistance mechanism of MRSA to β-lactam antibiotics: i) Producing β-lactamase, which hydrolyzes β-lactams ring by means of serine in its active site and then hydrolyzes β-lactam antibiotics to resist drugs (2); ii) reducing content of drugs in vivo, including by enhancing permeability of bacterial outer membrane or restraining the active efflux system in bacteria (3); and iii) expressing a great number of special penicillin-binding proteins PBP2a (4). miRNA is a type of untranslated RNA, and 50–75% of them control transcription and translation with help of binding target mRNA (5). MRSA expresses various types of miRNA abnormally, in particular, the markedly upregulated miR-7 (6).

The aim of the study was to investigate whether miR-7 was associated with the development of MRSA and its possible mechanism, providing a reference for the intervention of MRSA targets.

Materials and methods

MRSA in clinic

In total, 1,500 samples from the Department of Clinical Laboratory, Jinan Stomatological Hospital (Shandong, China) during the period January 2015 to January 2016 were selected in sequence and were authenticated as well as analyzed by VITEK-2, a fully automatic bacterial identification/drug sensitivity system (bioMérieux, Lyon, France). Seven cases of MRSA were detected (0.47%). Criteria of the Clinical and Laboratory Standards Institute (2012) were taken as the reference (7). Agar plate microporous dilution method was used to test the minimum inhibitory concentration (MIC) value from collective MRSA against vancomycin.

Testing the expression of miR-7 mRNA with reverse transcription polymerase chain reaction (RT-PCR) method

We prepared before the test: PCR Premix Taq reagent and synthesis of the primer (Takara, Tokyo, Japan), electrophoretic buffers and DNA marker (Beijing TransGen Biotech Co., Ltd., Beijing, China), using PCR amplifier (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Whole DNA was extracted by extracting post-resuscitation single bacteria colony from blood agar (plate) and placing it in 500 µl tri-distilled water, and then boiling at 100°C for 10 min, followed by centrifugation at 4°C 10,000 × g in a refrigerated centrifuge for 10 min. The supernatant after centrifugation was bacterial DNA. Supernatant (100 µl) was extracted and delivered to another sterile centrifuge tube, preserved at −20°C. Primer sequence: miR-7 forward, 5′-CCGGAATTCAAGAAGCCTTAACCAAGCA-3′ and reverse, 5′-CGCGGATCCGAGTAGTAAATCGGACATTAGTAGA-3′; internal reference GAPDH forward, 5′-CAAAGTCAAGGCTGAGAAC-3′ and reverse, 5′-TGGTGAAGACGCCAGTGG-3′. For the reaction system 2X Taq MasterMix 25 µl, upstream and downstream primer (10 µM) 2 µl, respectively, was used; a DNA template (4 µl) was created; and H2O was added for a total volume of 50 µl. The reaction conditions were: Pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, and extension at 72°C for 1 min. After 35 cycles, extended once more at 72°C for 10 min. For sequence analysis, amplicon was extracted for agarose gel electrophoresis, 5 µl PCR amplicon for each well, with a voltage 110 V for 40 min. After electrophoresis, agarose gel was observed in ultraviolet spectrophotometer (Bio-Rad, Hercules, CA, USA). GenBank (https://www.ncbi.nlm.nih.gov/genbank/) was employed for analyzing and comparison of the sequences, and the results are expressed with the 2−∆∆Cq method.

Establishment of miR-7 overexpression, inhibition, and control group with plasmid in vitro

TRIzol, liposome transfection reagent (Lipofectamine™ 2000) was purchased from Invitrogen (Carlsbad, CA, USA). The miRNA RT-PCR kit for RT-PCR was purchased from Applied Biosystems Life Technologies (Foster City, CA, USA), DNA extraction kit and SYBR-Green method RT-PCR kit were purchased from Takara, and 24-well, 96-well plates, Petri dishes were purchased from Corning Costar, Inc. (Corning, NY, USA), and the pCDN3.1 and pCDNA-Sponge-Ready empty carrier was purchased rom R&D Systems, Inc. (Minneapolis, MN, USA). The synthesis of primer sequence and sequencing was managed by BGI-Tech (Shenzhen, China).

Presequences of miR-7 were amplified from DNA of HepG2 genome, with the same conditions as above. XhoI and HindIII were regarded as insertion site of amplicon. Through genetic recombination, target segment of miR-7 precursor was inserted into pCDNA3.1 carrier and sequenced for detection as well as establishment of overexpression of miR-7. Synthetic length 45 bp, oligonucleotide included two repetitive miR-7 reaction sequences (TCGTACCGTGAGTAATAATGCG). Through annealing, oligonucleotide was inserted into pCDNA-Sponge-Ready empty carrier and sequenced for detection as well as establishment of miR-7 interference carrier. According to Lipofection transfection instruction book, 5-µl transfection reagent Lipofectamine™ 2000 and 2-µl plasmid were combined and preserved in room temperature for 20 min, then added to cultured supernatant slowly, culturing them after shaking and mixing, and the fluorescence was observed after 24 h.

Observation of the effect of β-lactam antibiotics in MIC

Vancomycin 10 µl + MRSA 190 µl (1,024 µg/ml) was in the first well, MRSA 100 µl (512 µg/ml) in the second well, MRSA 100 µl (256 µg/ml) in the third one, MRSA 100 µl (128 µg/ml) in the fourth one, MRSA 100 µl (64 µg/ml) in the fifth one, MRSA 100 µl (32 µg/ml) in the sixth one, MRSA 100 µl (16 µg/ml) in the seventh one, MRSA 100 µl (8 µg/ml) in the eighth one, MRSA 100 µl (4 µg/ml) in the ninth one, MRSA 100 µl (2 µg/ml) in the tenth one, and negative control LB liquid 100 µl in the eleventh one. Bacteria solution in the first well and medicine were mixed, 100 µl was extracted from the first well and added to the second well. After combination, 100 µl was extracted out and added to the third one, double-diluted successively until the tenth one, discarding 100 µl in order to keep the volume consistent. Following culture at 37°C in an incubator for 48 h the effect of β-lactam antibiotics in MIC was observed. The negative well was clear while the positive one was muddy. β-lactam antibiotics in MIC was the minimum inhibition concentration, which inhibited bacteria from growing at a speed observed by the naked eye.

Antibiotic effect in vitro of bacteria with dynamic growth curve method

After 1/2 MIC concentration of antibiotics was added, and agitated in orbital shaker at 120 × g, 37°C for 24 h, the OD600 was evaluated of the bacterial liquid in 3, 6, 12 and 24 h, respectively, and the time-bacterial concentration curve was drawn.

Statistical analysis

Data were analyzed by SPSS 20.0 software (SPSS Inc., Chicago, IL, USA). Quantitative data were assessed by mean ± standard deviation. Differences between the two groups were assessed by Student's t-test, differences among the multiple groups were assessed by single-factor analysis of variance (ANOVA), and the two groups were compared by least significant difference method. Different time data in the groups were compared by ANOVA of repetitive data, P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of miR-7 mRNA

The expression of miR-7 mRNA in sensitive MRSA was upregulated distinctly, with significant difference (P<0.05) (Fig. 1).

Figure 1.

Comparison of the expression of miR-7 mRNA.

Comparison of the MIC of vancomycin in MRSA

MIC in miR-7 overexpression group increased drastically while in inhibition group it decreased prominently, with significant difference (P<0.05). Control group and null plasmid group show no significant difference (Fig. 2).

Figure 2.

Comparison of MIC of vancomycin in MRSA. MIC, minimum inhibitory concentration; MRSA, methicillin-resistant Staphylococcus aureus.

Time-bacterial concentration curve

OD600 value of different time-points in miR-7 overexpression group, numbers of bacteria, increased significantly while it decreased in inhibition group, with significant difference (P<0.05). Control group and null plasmid group showed no significant difference (Fig. 3).

Figure 3.

Time-bacterial concentration curve.

Discussion

Previously, studies of miRNAs were concentrated mainly on eucaryon, and various functional miRNAs were found, which would be complementary with target gene and then regulated the expression of a particular gene (8). With the development of research on prokaryotes, there are similar non-coded miRNAs found in bacteria, carrying out a variety of functions which associate with development, reproduction, antibacterial activity, resistance and variation of bacteria (9).

A great deal of miRNAs in bacteria is closely associated with the development and metabolism and toxicity regulation procedures (10). Research on miRNAs of prokaryote was concentrated mainly on Escherichia coli, and hundreds of miRNAs were found (11). Recent findings suggested that there were new miRNAs in gram-positive Staphylococcus aureus. Of these, partly located in pathogenicity islands of Staphylococcus aureus genome or only existing in pathogenicity bacteria, indicated that miRNAs probably participated in regulating the expression of pathogenic bacteria toxicity (12). RNAIII of Staphylococcus aureus (a type of miRNA) was verified as a toxicity-associated gene, participating the regulation of Staphylococcus aureus pathogenicity (13). Hfq protein was first found in Escherichia coli, owing to chaperone activity of RNA, whose main biological function was to affect RNA stability through hexamer and combined with RNA or to regulate the expression of target genes by assisting a combination of miRNAs and mRNA. This is vital for miRNA function through comparison (14). During research on gene expression regulation, some transcriptional-level control miR-7 molecule needs the assistance of Hfq protein, indicating that the miRNAs may be a family whose characteristic was the combination with Hfq protein effectively, and to be affected with target mRNA molecules through base pairing and then regulated the expression of target mRNA (15). At present, in Escherichia coli, more than 30% non-coding miRNAs are found to be able to combine with Hfq protein (16).

In conclusion, the expression of miR-7 in sensitive MRSA was clearly upregulated. MIC and number of bacteria in miR-7 overexpression group increased greatly while in inhibition group they decreased prominently, with significant difference. miR-7 upregulated the antimicrobial activity of MRSA, and the intervention of its expression may become a possible antibacterial target. Whether miR-7 upregulated the antimicrobial activity of MRSA associated with the Hfq protein assistant regulated effect, development of MBL as well as expression mechanism of porin OprC, and relevant cell signal pathway is still needed and should be explored.

References

1 

Hale CM, Seabury RW, Steele JM, Darko W and Miller CD: Are vancomycin trough concentrations of 15 to 20 mg/L associated with increased attainment of an AUC/MIC ≥ 400 in patients with presumed MRSA infection? J Pharm Pract. 12:12–13. 2016.

2 

Aktaş Z, Satana D, Kayacan C, Can B, Gönüllü N and Küçükbasmacı O: Antibiotic susceptibility rates and beta-lactam resistance mechanisms of Pseudomonas aeruginosa strains. Mikrobiyol Bul. 46:386–397. 2012.(In Turkish). PubMed/NCBI

3 

Li H, Luo YF, Williams BJ, Blackwell TS and Xie CM: Structure and function of OprD protein in Pseudomonas aeruginosa: from antibiotic resistance to novel therapies. Int J Med Microbiol. 302:63–68. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Harrison EM, Ba X, Blane B, Ellington MJ, Loeffler A, Hill RL, Holmes MA and Peacock SJ: PBP2a substitutions linked to ceftaroline resistance in MRSA isolates from the UK. J Antimicrob Chemother. 71:268–269. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Ostojić M and Hukić M: Genotypic and phenotypic characteristics of methicillin-resistant Staphylococcus aureus (MRSA) strains, isolated on three different geography locations. Bosn J Basic Med Sci. 15:48–56. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, et al: Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3. J Immunol. 190:1491–1500. 2013. View Article : Google Scholar : PubMed/NCBI

7 

Magiorakos AP, Srinivasan A, Carey RB, Carmeli Y, Falagas ME, Giske CG, Harbarth S, Hindler JF, Kahlmeter G, Olsson-Liljequist B, et al: Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistance. Clin Microbiol Infect. 18:268–281. 2012. View Article : Google Scholar : PubMed/NCBI

8 

Datta J, Islam M, Dutta S, Roy S, Pan Q and Teknos TN: Suberoylanilide hydroxamic acid inhibits growth of head and neck cancer cell lines by reactivation of tumor suppressor microRNAs. Oral Oncol. 56:32–39. 2016. View Article : Google Scholar : PubMed/NCBI

9 

Li MM, Addepalli B, Tu MJ, Chen QX, Wang WP, Limbach PA, LaSalle JM, Zeng S, Huang M and Yu AM: Chimeric microRNA-1291 biosynthesized efficiently in Escherichia coli is effective to reduce target gene expression in human carcinoma cells and improve chemosensitivity. Drug Metab Dispos. 43:1129–1136. 2015. View Article : Google Scholar : PubMed/NCBI

10 

Li MM, Wang WP, Wu WJ, Huang M and Yu AM: Rapid production of novel pre-microRNA agent hsa-mir-27b in Escherichia coli using recombinant RNA technology for functional studies in mammalian cells. Drug Metab Dispos. 42:1791–1795. 2014. View Article : Google Scholar : PubMed/NCBI

11 

Jin W, Ibeagha-Awemu EM, Liang G, Beaudoin F, Zhao X and Guan L: Transcriptome microRNA profiling of bovine mammary epithelial cells challenged with Escherichia coli or Staphylococcus aureus bacteria reveals pathogen directed microRNA expression profiles. BMC Genomics. 15:1812014. View Article : Google Scholar : PubMed/NCBI

12 

Sun J, Aswath K, Schroeder SG, Lippolis JD, Reinhardt TA and Sonstegard TS: MicroRNA expression profiles of bovine milk exosomes in response to Staphylococcus aureus infection. BMC Genomics. 16:8062015. View Article : Google Scholar : PubMed/NCBI

13 

Zhou Y, Zhao R, Ma B, Gao H, Xue X, Qu D, Li M, Meng J, Luo X and Hou Z: Oligomerization of RNAIII-inhibiting peptide inhibits adherence and biofilm formation of methicillin-resistant Staphylococcus aureus in vitro and in vivo. Microb Drug Resist. 22:193–201. 2016. View Article : Google Scholar : PubMed/NCBI

14 

Gupta RK, Luong TT and Lee CY: RNAIII of the Staphylococcus aureus agr system activates global regulator MgrA by stabilizing mRNA. Proc Natl Acad Sci USA. 112:14036–14041. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Ma B, Zhou Y, Li M, Yu Q, Xue X, Li Z, Da F, Hou Z and Luo X: RIP-V improves murine survival in a sepsis model by down-regulating RNAIII expression and α-hemolysin release of methicillin-resistant Staphylococcus aureus. Pharmazie. 70:81–87. 2015.PubMed/NCBI

16 

Zhang X, Zhu Q, Tian T, Zhao C, Zang J, Xue T and Sun B: Identification of RNAIII-binding proteins in Staphylococcus aureus using tethered RNAs and streptavidin aptamers based pull-down assay. BMC Microbiol. 15:1022015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhang H, Li H, Liu Y, Li Q, Bi Y and Fang G: Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus. Exp Ther Med 12: 3571-3574, 2016.
APA
Zhang, H., Li, H., Liu, Y., Li, Q., Bi, Y., & Fang, G. (2016). Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus. Experimental and Therapeutic Medicine, 12, 3571-3574. https://doi.org/10.3892/etm.2016.3805
MLA
Zhang, H., Li, H., Liu, Y., Li, Q., Bi, Y., Fang, G."Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus". Experimental and Therapeutic Medicine 12.6 (2016): 3571-3574.
Chicago
Zhang, H., Li, H., Liu, Y., Li, Q., Bi, Y., Fang, G."Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus". Experimental and Therapeutic Medicine 12, no. 6 (2016): 3571-3574. https://doi.org/10.3892/etm.2016.3805
Copy and paste a formatted citation
x
Spandidos Publications style
Zhang H, Li H, Liu Y, Li Q, Bi Y and Fang G: Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus. Exp Ther Med 12: 3571-3574, 2016.
APA
Zhang, H., Li, H., Liu, Y., Li, Q., Bi, Y., & Fang, G. (2016). Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus. Experimental and Therapeutic Medicine, 12, 3571-3574. https://doi.org/10.3892/etm.2016.3805
MLA
Zhang, H., Li, H., Liu, Y., Li, Q., Bi, Y., Fang, G."Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus". Experimental and Therapeutic Medicine 12.6 (2016): 3571-3574.
Chicago
Zhang, H., Li, H., Liu, Y., Li, Q., Bi, Y., Fang, G."Upregulated effects of miR-7 in methicillin-resistant Staphylococcus aureus". Experimental and Therapeutic Medicine 12, no. 6 (2016): 3571-3574. https://doi.org/10.3892/etm.2016.3805
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team