This article is mentioned in:

Introduction

As a super bacteria, methicillin-resistant Staphylococcus aureus (MRSA) shows resistance to a great deal of antibacterial agents, except for a few agents including vancomycin, teicoplanin, and linezolid (1). The domain resistance mechanism of MRSA to β-lactam antibiotics: i) Producing β-lactamase, which hydrolyzes β-lactams ring by means of serine in its active site and then hydrolyzes β-lactam antibiotics to resist drugs (2); ii) reducing content of drugs in vivo, including by enhancing permeability of bacterial outer membrane or restraining the active efflux system in bacteria (3); and iii) expressing a great number of special penicillin-binding proteins PBP2a (4). miRNA is a type of untranslated RNA, and 50–75% of them control transcription and translation with help of binding target mRNA (5). MRSA expresses various types of miRNA abnormally, in particular, the markedly upregulated miR-7 (6).

The aim of the study was to investigate whether miR-7 was associated with the development of MRSA and its possible mechanism, providing a reference for the intervention of MRSA targets.

Materials and methods

MRSA in clinic

In total, 1,500 samples from the Department of Clinical Laboratory, Jinan Stomatological Hospital (Shandong, China) during the period January 2015 to January 2016 were selected in sequence and were authenticated as well as analyzed by VITEK-2, a fully automatic bacterial identification/drug sensitivity system (bioMérieux, Lyon, France). Seven cases of MRSA were detected (0.47%). Criteria of the Clinical and Laboratory Standards Institute (2012) were taken as the reference (7). Agar plate microporous dilution method was used to test the minimum inhibitory concentration (MIC) value from collective MRSA against vancomycin.

Testing the expression of miR-7 mRNA with reverse transcription polymerase chain reaction (RT-PCR) method

We prepared before the test: PCR Premix Taq reagent and synthesis of the primer (Takara, Tokyo, Japan), electrophoretic buffers and DNA marker (Beijing TransGen Biotech Co., Ltd., Beijing, China), using PCR amplifier (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Whole DNA was extracted by extracting post-resuscitation single bacteria colony from blood agar (plate) and placing it in 500 µl tri-distilled water, and then boiling at 100°C for 10 min, followed by centrifugation at 4°C 10,000 × g in a refrigerated centrifuge for 10 min. The supernatant after centrifugation was bacterial DNA. Supernatant (100 µl) was extracted and delivered to another sterile centrifuge tube, preserved at −20°C. Primer sequence: miR-7 forward, 5′-CCGGAATTCAAGAAGCCTTAACCAAGCA-3′ and reverse, 5′-CGCGGATCCGAGTAGTAAATCGGACATTAGTAGA-3′; internal reference GAPDH forward, 5′-CAAAGTCAAGGCTGAGAAC-3′ and reverse, 5′-TGGTGAAGACGCCAGTGG-3′. For the reaction system 2X Taq MasterMix 25 µl, upstream and downstream primer (10 µM) 2 µl, respectively, was used; a DNA template (4 µl) was created; and H2O was added for a total volume of 50 µl. The reaction conditions were: Pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 sec, annealing at 56°C for 30 sec, and extension at 72°C for 1 min. After 35 cycles, extended once more at 72°C for 10 min. For sequence analysis, amplicon was extracted for agarose gel electrophoresis, 5 µl PCR amplicon for each well, with a voltage 110 V for 40 min. After electrophoresis, agarose gel was observed in ultraviolet spectrophotometer (Bio-Rad, Hercules, CA, USA). GenBank (https://www.ncbi.nlm.nih.gov/genbank/) was employed for analyzing and comparison of the sequences, and the results are expressed with the 2−∆∆Cq method.

Establishment of miR-7 overexpression, inhibition, and control group with plasmid in vitro

TRIzol, liposome transfection reagent (Lipofectamine™ 2000) was purchased from Invitrogen (Carlsbad, CA, USA). The miRNA RT-PCR kit for RT-PCR was purchased from Applied Biosystems Life Technologies (Foster City, CA, USA), DNA extraction kit and SYBR-Green method RT-PCR kit were purchased from Takara, and 24-well, 96-well plates, Petri dishes were purchased from Corning Costar, Inc. (Corning, NY, USA), and the pCDN3.1 and pCDNA-Sponge-Ready empty carrier was purchased rom R&D Systems, Inc. (Minneapolis, MN, USA). The synthesis of primer sequence and sequencing was managed by BGI-Tech (Shenzhen, China).

Presequences of miR-7 were amplified from DNA of HepG2 genome, with the same conditions as above. XhoI and HindIII were regarded as insertion site of amplicon. Through genetic recombination, target segment of miR-7 precursor was inserted into pCDNA3.1 carrier and sequenced for detection as well as establishment of overexpression of miR-7. Synthetic length 45 bp, oligonucleotide included two repetitive miR-7 reaction sequences (TCGTACCGTGAGTAATAATGCG). Through annealing, oligonucleotide was inserted into pCDNA-Sponge-Ready empty carrier and sequenced for detection as well as establishment of miR-7 interference carrier. According to Lipofection transfection instruction book, 5-µl transfection reagent Lipofectamine™ 2000 and 2-µl plasmid were combined and preserved in room temperature for 20 min, then added to cultured supernatant slowly, culturing them after shaking and mixing, and the fluorescence was observed after 24 h.

Observation of the effect of β-lactam antibiotics in MIC

Vancomycin 10 µl + MRSA 190 µl (1,024 µg/ml) was in the first well, MRSA 100 µl (512 µg/ml) in the second well, MRSA 100 µl (256 µg/ml) in the third one, MRSA 100 µl (128 µg/ml) in the fourth one, MRSA 100 µl (64 µg/ml) in the fifth one, MRSA 100 µl (32 µg/ml) in the sixth one, MRSA 100 µl (16 µg/ml) in the seventh one, MRSA 100 µl (8 µg/ml) in the eighth one, MRSA 100 µl (4 µg/ml) in the ninth one, MRSA 100 µl (2 µg/ml) in the tenth one, and negative control LB liquid 100 µl in the eleventh one. Bacteria solution in the first well and medicine were mixed, 100 µl was extracted from the first well and added to the second well. After combination, 100 µl was extracted out and added to the third one, double-diluted successively until the tenth one, discarding 100 µl in order to keep the volume consistent. Following culture at 37°C in an incubator for 48 h the effect of β-lactam antibiotics in MIC was observed. The negative well was clear while the positive one was muddy. β-lactam antibiotics in MIC was the minimum inhibition concentration, which inhibited bacteria from growing at a speed observed by the naked eye.

Antibiotic effect in vitro of bacteria with dynamic growth curve method

After 1/2 MIC concentration of antibiotics was added, and agitated in orbital shaker at 120 × g, 37°C for 24 h, the OD600 was evaluated of the bacterial liquid in 3, 6, 12 and 24 h, respectively, and the time-bacterial concentration curve was drawn.

Statistical analysis

Data were analyzed by SPSS 20.0 software (SPSS Inc., Chicago, IL, USA). Quantitative data were assessed by mean ± standard deviation. Differences between the two groups were assessed by Student's t-test, differences among the multiple groups were assessed by single-factor analysis of variance (ANOVA), and the two groups were compared by least significant difference method. Different time data in the groups were compared by ANOVA of repetitive data, P<0.05 was considered to indicate a statistically significant difference.

Results

Expression of miR-7 mRNA

The expression of miR-7 mRNA in sensitive MRSA was upregulated distinctly, with significant difference (P<0.05) (Fig. 1).

Figure 1. Comparison of the expression of miR-7 mRNA.

Comparison of the MIC of vancomycin in MRSA

MIC in miR-7 overexpression group increased drastically while in inhibition group it decreased prominently, with significant difference (P<0.05). Control group and null plasmid group show no significant difference (Fig. 2).

Figure 2. Comparison of MIC of vancomycin in MRSA. MIC, minimum inhibitory concentration; MRSA, methicillin-resistant Staphylococcus aureus.

Time-bacterial concentration curve

OD600 value of different time-points in miR-7 overexpression group, numbers of bacteria, increased significantly while it decreased in inhibition group, with significant difference (P<0.05). Control group and null plasmid group showed no significant difference (Fig. 3).

Figure 3. Time-bacterial concentration curve.

Discussion

Previously, studies of miRNAs were concentrated mainly on eucaryon, and various functional miRNAs were found, which would be complementary with target gene and then regulated the expression of a particular gene (8). With the development of research on prokaryotes, there are similar non-coded miRNAs found in bacteria, carrying out a variety of functions which associate with development, reproduction, antibacterial activity, resistance and variation of bacteria (9).

A great deal of miRNAs in bacteria is closely associated with the development and metabolism and toxicity regulation procedures (10). Research on miRNAs of prokaryote was concentrated mainly on Escherichia coli, and hundreds of miRNAs were found (11). Recent findings suggested that there were new miRNAs in gram-positive Staphylococcus aureus. Of these, partly located in pathogenicity islands of Staphylococcus aureus genome or only existing in pathogenicity bacteria, indicated that miRNAs probably participated in regulating the expression of pathogenic bacteria toxicity (12). RNAIII of Staphylococcus aureus (a type of miRNA) was verified as a toxicity-associated gene, participating the regulation of Staphylococcus aureus pathogenicity (13). Hfq protein was first found in Escherichia coli, owing to chaperone activity of RNA, whose main biological function was to affect RNA stability through hexamer and combined with RNA or to regulate the expression of target genes by assisting a combination of miRNAs and mRNA. This is vital for miRNA function through comparison (14). During research on gene expression regulation, some transcriptional-level control miR-7 molecule needs the assistance of Hfq protein, indicating that the miRNAs may be a family whose characteristic was the combination with Hfq protein effectively, and to be affected with target mRNA molecules through base pairing and then regulated the expression of target mRNA (15). At present, in Escherichia coli, more than 30% non-coding miRNAs are found to be able to combine with Hfq protein (16).

In conclusion, the expression of miR-7 in sensitive MRSA was clearly upregulated. MIC and number of bacteria in miR-7 overexpression group increased greatly while in inhibition group they decreased prominently, with significant difference. miR-7 upregulated the antimicrobial activity of MRSA, and the intervention of its expression may become a possible antibacterial target. Whether miR-7 upregulated the antimicrobial activity of MRSA associated with the Hfq protein assistant regulated effect, development of MBL as well as expression mechanism of porin OprC, and relevant cell signal pathway is still needed and should be explored.

References