Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
November-2017 Volume 14 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients

  • Authors:
    • Guangya Wang
    • Guangyao Song
    • Linxia Wang
    • Fang Gao
    • Ningning Guo
    • Yunna Zhang
    • Nairui Zhao
    • Xiuping Yin
  • View Affiliations / Copyright

    Affiliations: Teaching and Research Section of Medicine, Hebei Medical University, Shijiazhuang, Hebei 050017, P.R. China, Second Department of Endocrinology and Metabolism, Cangzhou Central Hospital, Cangzhou, Hebei 061001, P.R. China
    Copyright: © Wang et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5002-5006
    |
    Published online on: September 20, 2017
       https://doi.org/10.3892/etm.2017.5149
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to determine the correlation between adiponectin (APN) gene polymorphism, metabolic syndrome incidence, and degree of atherosclerosis in patients with this disease. The study was conducted on 369 unrelated patients, diagnosed with metabolic abnormalities. The patients were divided into the metabolic syndrome group (MS group, n=182), the metabolic abnormality group (n=187) and the control group with metabolic normality (n=134), as per the degree of metabolic abnormality. The gene polymorphism of rs121917815 site of APN gene was detected by TaqMAN probe technique, and the OR values of different genotypes and alleles were calculated. The APN protein, C-reactive protein (CRP), IL-1 and high-density lipoprotein (HDL) 2a and 2b expression level changes were detected by immunoblotting. The atherosclerosis index (AI) of each allele in patients with MS was calculated. Compared with the control group, the expression levels of APN protein in the metabolic abnormality and MS groups were significantly decreased. However, there was no distinct difference in the comparison of gene polymorphism between the control and metabolic abnormality groups. The CC genotype frequency and C allele frequency of rs121917815 polymorphic site in the MS group were significantly increased, compared with the control group. The TT genotype frequency and T allele frequency were significantly decreased and the OR values of the CC genotype and C allele were increased. The results of immunoblotting showed that there was no obvious change of CRP, IL-1, HDL-2a and HDL-2b in the three groups, and there was no statistically significant difference in the comparison of AI between the MS and control groups as well as the metabolic abnormality group. The APN gene polymorphic site rs121917815 is associated with MS. The occurrence of CC genotype and C allele increased the incidence of MS, but it did not increase the degree of atherosclerosis in MS patients.

Introduction

Metabolic syndrome is a pathological state that contains multiple metabolic abnormalities, which is manifested in the form of hyperglycemia, hyperlipoidemia, blood lipid disorder, obesity and other clinical features (1). Blood glucose and blood lipid metabolic disorders also significantly increase the probability of cardiovascular disease in patients (2). Atherosclerosis is the main cause for the induction of multiple cardiovascular diseases, but whether there is a direct correlation between MS and atherosclerosis remains unclear. Many clinical data and studies have found that the central link of metabolic syndrome is insulin resistance (3).

Adiponectin (APN) is located on chromosome 3q27 and contains three exons and two groups of introns. Human APN protein structure has 244 amino acids, while the C-terminal aromatic amino acid globular sequence is the key part of the activity of APN protein (4). As an important upstream factor regulating the activity of insulin, APN has widely drawn attention since its discovery (5). Previous studies have confirmed that APN gene has important physiological functions and is closely associated with the incidence of cardio-cerebral vascular disease, obesity, and MS (6–8). Completion of genome sequencing plays an important role in the diagnosis and prediction of human diseases. In recent years, an increasing number of APN polymorphic sites have been found in the genome, while many polymorphic sites have an important relationship with the occurrence of multiple diseases (9–11). Previous studies found that APN gene single nucleotide polymorphism (SNP) rs266729 is closely related to Type 2 diabetes mellitus (T2DM), but whether this site could increase the incidence of MS and the degree of atherosclerosis in patients with MS remains unclear. Therefore, APN rs266729 gene polymorphisms in the metabolic syndrome group (n=182), the metabolic abnormality group (n=187) and the control group (n=134) were detected, and the levels of plasma in APN protein and atherosclerosis-related protein were examined to analyze the correlation between adiponectin (APN) gene polymorphism and metabolic syndrome and its relationship with the degree of atherosclerosis in the patients included in the present study.

Materials and methods

Subjects

The study was conducted on 264 subjects, admitted to the Department of Medicine April 2008 and May 2013, and who were diagnosed as obese (BMI ≥28). There were 145 male and 119 female cases, with an average age of 54±0.6 years. Of the 264 subjects, 114 cases were selected as the control group; 71 male and 43 female cases, with an average age of 55±0.3 years.

Informed consent was obtained from all the subjects and it was taken into consideration that the subjects were not related to each other. The study was approved by the Ethics Committee of Hebei Medical University.

MS observation index and measurement

The body mass index (BMI), waist circumference and hip circumference were measured to calculate the waist-to-hip ratio. The triglyceride and high-density lipoprotein (HDL) were detected by MINDRAY sublimation automatic analyzer (Mindray, Shenzhen, China). The fasting blood glucose was determined by glucose oxidase assay and the fasting insulin was determined by radioimmunoassay.

Diagnosis and grouping of MS

Diagnosis of MS was based on WHO (1999) T2DM diagnostic criteria, the hyperglycemia criterion which included impaired glucose tolerance, impaired fasting blood glucose and impaired glucose regulation. As per the 1999 WHO/ISII diagnostic criteria, the hypertension criterion was defined as for the multiple blood pressure measurements on the different days, the systolic blood pressure was ≥140 mmHg and/or the diastolic blood pressure was ≥90 mmHg. MS criterion was in accordance with the diagnostic criteria proposed by the Chinese Medical Association in 2004. The subjects were divided into three groups based on the presence and degree of metabolic abnormality. The MS group (n=142) required three items or all of the four items as follows: i) overweight and/or obesity: BMI ≥25.0 kg/m2; ii) hyperglycemia: fasting blood glucose ≥6.1 mmol/l and/or 2 h PG ≥7.8 mmol/l, and/or the patients who were diagnosed as having diabetes and were receiving treatment; iii) hypertension: blood pressure ≥140/90 mmHg, and/or the patients who diagnosed as hypertension and were receiving treatment; iv) blood lipid disorder: triglyceride ≥1.7 mmol/l and/or HDL-C: male <0.9 mmol/l and female <1.0 mmol/l. The 122 cases in the metabolic abnormality group met one or two of the above MS criteria. The normal control group comprised individuals who met none of the MS criteria.

Sample collection

Venous blood (5 ml) was taken after patients fasted for 12 h. Five milliliters was used to extract the peripheral blood genomic DNA using the routine chloroform method after anticoagulation. One milliliter was used to detect blood glucose, blood lipid and HDL after procoagulation and separating the serum. Then, 4 ml was used to detect the related protein expression level changes in serum by immunoblotting.

Gene polymorphism detection

The rs121917815 gene sequence was ACCTGGAGAAGGTGCCTATGTATAC[C/T]GCTCA GCATTCAGTGTGGGATTGGA. The PCR primer sequence was rs121917815 upstream 5′-AGGTCCCCGAGGCTTTCCG-3 and downstream primer 5′-TAGAAGATCTTGGTAAAGGCG AAT-3. TaqMAN probe sequence was 5′-ACCTGGAGAAGG TGCCTATGTATACT(C)GCTCAGCATTCAGTG-3, and FAM was marked at the T allele 5-terminal, VIC was marked at the C allele 5-terminal, while TAMRA was marked at 3-terminal (Shanghai Shengshun Biological Technology Co., Ltd., Shanghai, China). APN rs121917815 gene polymorphism was detected by quantitative PCR. The reaction conditions were activating UNG enzyme at 50°C for 2 min, pre-denaturation at 94°C for 4 min, denaturation at 94°C for 30 sec, annealing at 54°C for 40 sec, extension at 60°C for 45 sec, a total of 40 cycles, and extension at 72°C for 10 min was the final condition. After each cycle, the fluorescence intensity of the PCR product was detected.

Evaluation of the degree of atherosclerosis

C-reactive protein (CRP), IL-1, HDL-2a and HDL-2b immunoblotting as well as AI were used to evaluate the degree of atherosclerosis in the patients. The atherosclerosis index (AI) was calculated as: [Total cholesterol (TC)-HDL]/HDL. Normal AI was set as <4, while AI >4 suggests presence of atherosclerosis.

Detecting APN protein, CRP, IL-1, HDL-2a and HDL-2b expression level changes by immunoblotting

After separating the target protein using 12% SDS gel, a cross-flow transferring membrane using 350 mA current was performed for 4 h, and the sample was sealed using 10% BSA for 1 h. The primary antibody dilution was performed in accordance with the antibody specification. After 4°C overnight, the membrane was washed three times with TBST buffer for 20 min. Then, it was diluted in accordance with the secondary antibody specification, at room temperature for 1 h, and the membrane was washed three times with TBST buffer for 20 min. The sample was then treated with ECL, and color development was carried out in the dark. After scanning, the optical density was analyzed by ImageJ, and the data were collected for statistical treatment using SPSS software.

Statistical analysis

SPSS 15.0 software (Chicago, IL, USA) was used for the analysis of collected data. The experimental data were expressed as mean ± SD, and a t-test was used for analyzing the difference among the groups. The Chi-square test was used for the comparison of countable data among the groups. P<0.05 suggested that the difference was statistically significant.

Results

Comparison of clinical data and serum APN protein expression changes in the three groups

The clinical data of the control, the metabolic abnormality and the MS group showed that the body mass index, waist-to-hip ratio, abdominal fat area, systolic blood pressure, diastolic blood pressure, and fasting insulin levels in the MS group were higher than those in the control group and the metabolic abnormality group (P<0.05), while the index levels in the metabolic abnormality group were higher than those in the control group (P<0.05). The serum APN and HDL levels of the MS group were lower than those of the metabolic abnormality group. The HDL level in the metabolic abnormality group was lower than that in the control group (P<0.05), but there was no statistical significance in the difference of serum APN between the two groups (P>0.05) (Table I). Compared with the control group, serum APN protein expression levels in the metabolic abnormality group and the MS group were decreased (Fig. 1).

Figure 1.

Serum APN protein expression levels in the control group, the metabolic abnormality (MA) group and the MS group.

Table I.

Comparison of physical and baseline clinical data between the three study groups.

Table I.

Comparison of physical and baseline clinical data between the three study groups.

Detection itemsControl groupMetabolic abnormality groupMS group
BMI (kg/m2) 21.54±0.212 4.61±0.34a 27.68±0.15a
Waist-to-hip ratio 0.78±0.06 0.87±0.03a 0.95±0.04b
Abdominal fat area (cm2) 37.64±4.527 1.26±3.43b 109.13±1.26a
Systolic blood pressure (mmHg) 113.56±1.2312 4.32±1.35a 140.13±1.52b
Diastolic blood pressure (mmHg) 70.92±1.017 9.03±0.92a 90.42±0.77b
Triglyceride (mmol/l) 1.10±0.04 1.52±0.06a 2.42±0.03b
HDL (mmol/l) 1.36±0.02 1.19±0.07b 1.12±0.06a
Fasting blood glucose (mmol/l) 4.97±0.11 5.54±0.06a 6.01±0.73a
Fasting insulin (nmol/l) 0.06±0.01 0.09±0.02b 0.11±0.01b

a P<0.05

b P<0.01 compared with the control group, aP<0.05, bP<0.01 compared with the metabolic abnormality group. 1 mmHg = 0.133 kPa.

Gene rs121917815 polymorphic site detection and allele frequency

TaqMAN probe was inserted into the PCR product containing the mutation sequence to detect the product containing different alleles using different fluorescence, and to determine the APN polymorphic site in the individual. The results are shown in Fig. 2.

Figure 2.

Detecting gene polymorphic sites by quantitative PCR. The blue line was T genotype fluorescence intensity, the red line is C genotype fluorescence intensity, and the green line is the blank sample fluorescence intensity.

The TT, TC and CC genotype frequency and the T and C allele probability were obtained by the statistical analysis of polymorphic site rs121917815 genotype in the control group, the metabolic abnormality group and the MS group (Table II). There was no significant difference in the comparison of the three genotype and allele frequencies between the control and metabolic abnormality groups (P>0.05). The CC genotype and C allele frequencies in the MS group were significantly increased. Compared with the control group, TT genotype and T allele frequencies in the MS group were significantly decreased, while the comparison of CT genotype frequency between the two groups had no significant difference. These data showed that the difference of the three genotypes and two alleles in the MS and control groups was statistically significant, showing 26.52 and 34.73 as the Chi-square test value, with a statistically significant difference.

Table II.

rs121917815 genotype and allele frequency.

Table II.

rs121917815 genotype and allele frequency.

GenotypeAllele


GroupsCasesTTCTCCTC
Control group11437 (32.45%)36 (31.58%)41 (35.96%)110 (48.24%)118 (51.76%)
Metabolic abnormality group12242 (34.42%)37 (30.32%)43 (35.24%)120 (49.59%)123 (50.41%)
MS group14232 (22.53%)42 (29.58%)68 (47.89%)106 (37.32%)178 (62.68%)
χ226.5234.73
P-value<0.001<0.001
Relationship between APN gene polymorphism and the incidence of MS

The distribution of rs121917815 genotypes and alleles in patients with MS is shown in Table III. To estimate the relationship between APN rs121917815 gene polymorphic site and the incidence of MS, the risk of MS was expressed by the odds ratio (OR). The OR of TT genotype was 0.60 (32×78/37×110), the OR of CT genotype was 0.91 (42×78/36×100), and the OR of CC genotype was 1.64 (68×73/41×74). The OR of T allele was 0.56 (110×106/118×118), and the OR of C allele was 1.71 (178× 110/106×108). The above results of OR indicated that CC genotype and C allele significantly increased the risk of MS.

Table III.

Distribution of rs121917815 genotypes and alleles in patients with MS.

Table III.

Distribution of rs121917815 genotypes and alleles in patients with MS.

GenotypesAlleles


GroupsCasesTTTCCCTC
Control group114373641110118
Metabolic abnormality group122423743120123
MS group142324268106178
Relationship of atherosclerosis-related indexes in patients with MS

The expression level changes of CRP, IL-1, HDL-2a and HDL-2b in the blood of the control group, the metabolic abnormality group and the MS group were detected (Fig. 3), the total cholesterol and HDL of different genotypes in the three groups were detected using the MINDRAY biochemical automatic analyzer, and the AI values of the three genotypes of patients were calculated (Table IV). The study found that there was no statistical difference in the degree of atherosclerosis between the MS group and the control group as well as the metabolic abnormality group, which suggested that the rs121917815 polymorphic site was not correlated with the degree of atherosclerosis.

Figure 3.

Expression level changes of atherosclerosis-related indexes including CRP, IL-1, HDL-2a and HDL-2b.

Table IV.

Comparison of genotype AI value between the MS and control groups.

Table IV.

Comparison of genotype AI value between the MS and control groups.

Genotypes

GroupsTTCTCC
Control3.79±0.343.82±0.194.26±0.41
(n=37)(n=36)(n=41)
MS3.82±0.423.77±0.294.36±0.14
(n=32)(n=42)(n=38)

Discussion

Metabolic syndrome is a comprehensive disease with insulin resistance as its central link, which is manifested by central obesity, hypertension, hyperglycemia and other diseases caused by the metabolic abnormalities of glucose and lipid (12). Previous findings have shown that individuals aged more than 60 years are likely to suffer from MS, showing serious condition (13). However, data regarding the clinical description of early onset MS patients and whether MS may cause other diseases are limited. In this study, the patients with an approximate age of 55 years were selected as the main research objects to investigate the possible pathogenesis of early onset MS.

APN has been found to play an important role in blood glucose and lipid metabolism which are regulated by insulin, while it has been reported that APN multiple polymorphic sites also account for a large proportion in the pathogenesis of MS (14,15). Additionally, the rs121917815 gene polymorphic site can cause T2DM, leading to severe clinical symptoms in patients (16). However, there is limited literature available regarding whether there is a relationship between this site and MS.

The origin of atherosclerosis is well known, mainly due to the metabolic abnormalities of glucose and lipid, which is similar to the pathological phenomenon caused by MS (17,18). However, to the best of our knowledge, there is no report on the relationship between early onset MS and atherosclerosis. In patients with atherosclerosis, CRP and regulatory factor IL-1, which have different degrees of increase, can be used as the indexes of atherosclerosis. Additionally, combined with the calculation of atherosclerosis index, the degree of atherosclerosis in patients with MS may be evaluated by these methods (19).

Based on the above research background, this study found that through the clinical data of patients with MS and immunoblotting for serum APN protein expression, the grouping mode and disease diagnosis were correct. In the analysis of the three groups of APN SNP rs121917815 site genotypes, we found that CC genotype frequency and C allele frequency in the MS group were significantly increased. Compared with the control group, TT genotype and T allele frequencies in the MS group were significantly decreased, while the comparison of CT genotype frequency between the two groups had no significant difference concerning the clinical description, we found that more MS symptoms appeared in this population, which indicated that C allele at rs121917815 was the pathogenic factor of MS. At the same time, the OR value of the three genotypes and two alleles suggested that the occurrence of CC genotype and C allele in rs121917815 site could increase the incidence of MS.

CRP and its regulatory factor IL-1 play an important role in the evaluation of atherosclerosis, while the serum HDL-2a and HDL-2b are also of significance in the process of atherosclerosis (20). To the best of our knowledge, for the first time, we found that there was no distinct change of CRP, IL-1, HDL-2a and HDL-2b in the patients with C allele in the MS group, while the difference was not statistically significant in the comparison of the AI between the MS and control groups as well as the metabolic abnormality group. There was no direct correlation between rs121917815 and atherosclerosis in cardiovascular disease.

In conclusion, APN rs121917815 gene polymorphic site is associated with the early MS and could increase the risk of MS, but the difference is not statistically significant in atherosclerosis-related indexes in MS patients with rs121917815 polymorphic site, which indicates that APN rs121917815 polymorphic site is related to MS, but it is not directly involved in the aggravation of atherosclerosis. This study has provided a theoretical basis for the pathogenesis of MS and atherosclerosis, which may be conducive to seek a particular approach for clinical treatment.

Acknowledgements

The present study was supported by the Hebei Province Science and Technology Plan (no. 15277794D).

References

1 

Alberti KGM, Zimmet P and Shaw J: IDF Epidemiology Task Force Consensus Group: The metabolic syndrome - a new worldwide definition. Lancet. 366:1059–1062. 2005. View Article : Google Scholar : PubMed/NCBI

2 

Gastrich MD, Lasser NL, Wien M and Bachmann G: Dietary complex carbohydrates and low glycemic index/load decrease levels of specific metabolic syndrome/cardiovascular disease risk factors. Top Clin Nutr. 23:76–96. 2008. View Article : Google Scholar

3 

Kim B and Feldman EL: Insulin resistance as a key link for the increased risk of cognitive impairment in the metabolic syndrome. Exp Mol Med. 47:e1492015. View Article : Google Scholar : PubMed/NCBI

4 

Yamauchi T, Kamon J, Minokoshi Y, Ito Y, Waki H, Uchida S, Yamashita S, Noda M, Kita S, Ueki K, et al: Adiponectin stimulates glucose utilization and fatty-acid oxidation by activating AMP-activated protein kinase. Nat Med. 8:1288–1295. 2002. View Article : Google Scholar : PubMed/NCBI

5 

Kadowaki T, Yamauchi T, Kubota N, Hara K, Ueki K and Tobe K: Adiponectin and adiponectin receptors in insulin resistance, diabetes, and the metabolic syndrome. J Clin Invest. 116:1784–1792. 2006. View Article : Google Scholar : PubMed/NCBI

6 

Lee S and Kwak HB: Role of adiponectin in metabolic and cardiovascular disease. J Exerc Rehabil. 10:54–59. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Nigro E, Scudiero O, Monaco ML, Palmieri A, Mazzarella G, Costagliola C, Bianco A and Daniele A: New insight into adiponectin role in obesity and obesity-related diseases. Biomed Res Int. 2014:6589132014.https://doi.org/10.1155/2014/658913 View Article : Google Scholar : PubMed/NCBI

8 

Fu Y: Adiponectin signaling and metabolic syndrome. Prog Mol Biol Transl Sci. 121:293–319. 2014. View Article : Google Scholar : PubMed/NCBI

9 

Bouatia-Naji N, Meyre D, Lobbens S, Séron K, Fumeron F, Balkau B, Heude B, Jouret B, Scherer PE, Dina C, et al: ACDC/adiponectin polymorphisms are associated with severe childhood and adult obesity. Diabetes. 55:545–550. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Al-Daghri NM, Al-Attas OS, Alokail MS, Alkharfy KM, Hussain T, Yakout S, Vinodson B and Sabico S: Adiponectin gene polymorphisms (T45G and G276T), adiponectin levels and risk for metabolic diseases in an Arab population. Gene. 493:142–147. 2012. View Article : Google Scholar : PubMed/NCBI

11 

Cai X, Gan Y, Fan Y, Hu J, Jin Y, Chen F, Chen T, Sun Y, Wang J, Qin W, et al: The adiponectin gene single-nucleotide polymorphism rs1501299 is associated with hepatocellular carcinoma risk. Clin Transl Oncol. 16:166–172. 2014. View Article : Google Scholar : PubMed/NCBI

12 

Samson SL and Garber AJ: Metabolic syndrome. Endocrinol Metab Clin North Am. 43:1–23. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Yesil A and Yilmaz Y: Review article: Coffee consumption, the metabolic syndrome and non-alcoholic fatty liver disease. Aliment Pharmacol Ther. 38:1038–1044. 2013. View Article : Google Scholar : PubMed/NCBI

14 

Stumvoll M, Tschritter O, Fritsche A, Staiger H, Renn W, Weisser M, Machicao F and Häring H: Association of the T-G polymorphism in adiponectin (exon 2) with obesity and insulin sensitivity: Interaction with family history of type 2 diabetes. Diabetes. 51:37–41. 2002. View Article : Google Scholar : PubMed/NCBI

15 

Fredriksson J, Carlsson E, Orho-Melander M, Groop L and Ridderstråle M: A polymorphism in the adiponectin gene influences adiponectin expression levels in visceral fat in obese subjects. Int J Obes. 30:226–232. 2006. View Article : Google Scholar

16 

Zietz B, Buechler C, Kobuch K, Neumeier M, Schölmerich J and Schäffler A: Serum levels of adiponectin are associated with diabetic retinopathy and with adiponectin gene mutations in Caucasian patients with diabetes mellitus type 2. Exp Clin Endocrinol Diabetes. 116:532–536. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Hutter N, Baena M, Sangüesa G, Dávalos A, Latasa MJ, Escolà-Gil JC, Sánchez RM, Roglans N, Alegret M and Laguna JC: Liquid fructose supplementation in LDL-R−/− mice fed a western-type diet enhances lipid burden and atherosclerosis despite identical calorie consumption. Int J Cardiol. 9:12–21. 2015.

18 

Shih DM, Wang Z, Lee R, Meng Y, Che N, Charugundla S, Qi H, Wu J, Pan C, Brown JM, et al: Flavin containing monooxygenase 3 exerts broad effects on glucose and lipid metabolism and atherosclerosis. J Lipid Res. 56:22–37. 2015. View Article : Google Scholar : PubMed/NCBI

19 

Rudolf J and Lewandrowski KB: Cholesterol, lipoproteins, high-sensitivity c-reactive protein, and other risk factors for atherosclerosis. Clin Lab Med. 34(113–127): vii. 2014.PubMed/NCBI

20 

Parhofer KG: Increasing HDL-cholesterol and prevention of atherosclerosis: A critical perspective. Atheroscler Suppl. 18:109–111. 2015. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang G, Song G, Wang L, Gao F, Guo N, Zhang Y, Zhao N and Yin X: Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients. Exp Ther Med 14: 5002-5006, 2017.
APA
Wang, G., Song, G., Wang, L., Gao, F., Guo, N., Zhang, Y. ... Yin, X. (2017). Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients. Experimental and Therapeutic Medicine, 14, 5002-5006. https://doi.org/10.3892/etm.2017.5149
MLA
Wang, G., Song, G., Wang, L., Gao, F., Guo, N., Zhang, Y., Zhao, N., Yin, X."Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients". Experimental and Therapeutic Medicine 14.5 (2017): 5002-5006.
Chicago
Wang, G., Song, G., Wang, L., Gao, F., Guo, N., Zhang, Y., Zhao, N., Yin, X."Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients". Experimental and Therapeutic Medicine 14, no. 5 (2017): 5002-5006. https://doi.org/10.3892/etm.2017.5149
Copy and paste a formatted citation
x
Spandidos Publications style
Wang G, Song G, Wang L, Gao F, Guo N, Zhang Y, Zhao N and Yin X: Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients. Exp Ther Med 14: 5002-5006, 2017.
APA
Wang, G., Song, G., Wang, L., Gao, F., Guo, N., Zhang, Y. ... Yin, X. (2017). Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients. Experimental and Therapeutic Medicine, 14, 5002-5006. https://doi.org/10.3892/etm.2017.5149
MLA
Wang, G., Song, G., Wang, L., Gao, F., Guo, N., Zhang, Y., Zhao, N., Yin, X."Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients". Experimental and Therapeutic Medicine 14.5 (2017): 5002-5006.
Chicago
Wang, G., Song, G., Wang, L., Gao, F., Guo, N., Zhang, Y., Zhao, N., Yin, X."Analysis of the correlation between adiponectin gene polymorphism and metabolic syndrome incidence and its relationship with the degree of atherosclerosis in patients". Experimental and Therapeutic Medicine 14, no. 5 (2017): 5002-5006. https://doi.org/10.3892/etm.2017.5149
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team