Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2017 Volume 14 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2017 Volume 14 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis

  • Authors:
    • Ying Jin
    • Dixin Liu
    • Xiaoping Lin
  • View Affiliations / Copyright

    Affiliations: Department of Stomatology, Shengjing Hospital of China Medical University, Shenyang, Liaoning 110004, P.R. China
  • Pages: 5605-5610
    |
    Published online on: October 3, 2017
       https://doi.org/10.3892/etm.2017.5255
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

T lymphocyte cells, including regulatory T (Treg) and T helper 17 cells, have important roles in the human periodontium. However, the basis for Treg cytokine expression in various compartments of the periodontium remains unclear. The aim of the present study was to investigate the expression of interleukin (IL)‑35 in the peripheral blood mononuclear cells (PBMCs) and periodontal tissues of patients with chronic periodontitis (CP), with a view to understanding its role in this disease, and ultimately providing improved treatments. Peripheral blood, periodontal tissues and gingival crevicular fluids (GCFs) were collected from patients with CP or impacted teeth, the latter serving as healthy controls. The expression levels of IL‑35 subunit mRNAs in PBMCs and periodontal tissues were determined using reverse transcription‑quantitative polymerase chain reaction, while the IL‑35 protein expression in GCFs and sera was quantified by ELISA. The relative expression of IL‑35 subunit mRNAs in the affected tissues of patients with CP was significantly higher compared with that in samples from healthy controls (P<0.05). The mean concentration of IL‑35 protein in the GCFs and sera of patients with periodontitis was also significantly higher compared with that in samples from healthy controls (P<0.001). IL‑35 protein and periodontal clinical indicators were negatively correlated. It was hypothesized that the increased level of IL‑35 plays a protective role in periodontal disease by maintaining immune system homeostasis and dampening the inflammatory response, and highlights IL‑35 as a potential new therapy for the treatment of periodontitis.

Introduction

Chronic periodontitis (CP) is an infectious disease that affects the periodontium and gradually destroys periodontal tissues (1). Bacterial plaque is a well-known cause of CP, which stimulates a local inflammatory response and activation of the innate immune system (1,2). This eventually results in the characteristic pathology of periodontal disease, the main clinical features of which are advancing gingival inflammation, irreversible alveolar bone loss, and the loosening and/or loss of teeth (3). Numerous studies (4,5) have highlighted the role of T lymphocyte cells in periodontitis; in particular, T lymphocyte phenotype and function are important in the susceptibility, onset and severity of periodontitis (6).

Regulatory T (Treg) cells are a critical sub-population of CD4+ T cells that are essential for maintaining self-tolerance and preventing autoimmunity, for limiting chronic inflammatory diseases, and for regulating homeostatic lymphocyte expansion (7–11). A recent study by Wang et al (12) demonstrated that the imbalance between Treg cells and T helper 17 (Th17) cells plays an essential role in the progression of periodontitis.

Interleukin (IL)-35, as a Forkhead box P3 (Foxp3)+ Treg cell immunosuppressive/anti-inflammatory cytokine, is required for the maximum regulatory activity of Treg cells (13). IL-35 is a heterodimer formed by an IL-12p35 subunit and an IL-27β chain, the latter of which is encoded by the Epstein-Barr virus-induced 3 (EBi3) gene (14). The known functions of IL-35 include: Maintenance of the peripheral immune system; regulation of the proliferation of T effector cells; inhibition of Th17 cell differentiation and IL-17 synthesis (15). Thus, it has a close association with immunological and infectious diseases (16,17). Although studies on IL-35 are relatively few, and the signal transduction mechanisms involved in its actions are not yet elucidated, IL-35 therapy shows promising potential for the treatment of immunological and infectious diseases (15,18).

In the present study, the expression of Foxp3, IL-12p35 and EBi3 mRNA in peripheral blood mononuclear cells (PBMCs) and periodontal tissue, and the concentration of IL-35 protein in serum and gingival crevicular fluid (GCF), were compared between patients with CP and healthy individuals. Elucidating the potential signaling mechanisms of IL-35 in CP may provide a basis for improvements in the future clinical treatments of periodontitis.

Materials and methods

Study population

The study included 20 patients with CP (the CP group) and 20 healthy individuals (the control group) at Shengjing Hospital of China Medical University (Shenyang, China). Participants were recruited from February to December 2013, and their ages ranged from 18 to 55 years. Subjects were included according to the following three criteria: i) A diagnosis of moderate to severe chronic periodontitis [moderate: 4 mm<pocket depth (PD) ≤6 mm and clinical attachment loss (CAL) 3–5 mm, or radiographic bone loss between one-third and one-half root length; severe: PD>6 mm and CAL>5 mm, or radiographic bone loss ≥ one-half root length (19)]; ii) retention of ≥20 teeth; iii) being generally healthy and without systemic disease. Exclusion criteria included: i) Recent intake of any pharmaceutical that had the potential to influence the outcome of the study or inflammatory clinical indices, e.g. antibiotics; ii) use of systemic antibiotics or local antimicrobial agents in the previous 3 months prior to the start of the trial; iii) pregnancy or lactation in female subjects; iv) received periodontal supportive treatment within 6 months prior to the start of the trial. The study protocol was approved by the Ethics Committee of Shengjing Hospital of China Medical University. All trial participants provided informed consent.

Clinical examination

To diagnose and document periodontal disease, trial participants were assessed for probing depth (PD) and clinical attachment level (CAL) by a single examiner using a Florida Probe system (Florida Probe Corporation, Gainesville, FL, USA). Testing was conducted for six sites per tooth for all teeth.

GCF and periodontal tissue collection

A tooth site without untreated caries, overhang fillings, food impaction or any inflammation with the exception of CP in each quadrant was selected. In the majority of cases the mesiobuccal site of the first molar was selected. If the first molar was not available, a second molar or a premolar in the same quadrant was selected. Plaque and chunks of calculus were removed and the tooth was then dried with dry, sterile cotton and an air gun. After waiting for 1 min, a Whatman paper strip was inserted, until mild resistance was encountered, for GCF collection from a periodontal pocket. Each paper strip was left in its position for 30 sec. Paper strips contaminated with blood were discarded. Four paper strips were collected from each participant (a total of 80 sites from the CP or control groups) and inserted into an Eppendorf tube, 200 µl PBS added and the tubes were then stored at −80°C.

Patients received local anesthesia and periodontal tissue biopsies were obtained by surgical excision from the labial/buccal surface of the gingival margin/papilla of multirooted teeth. Tissue biopsies from patients with periodontitis were collected with flap surgery. Healthy biopsies were also collected from patients following surgery for impacted teeth. Each tissue was repeatedly washed with 0.9% saline until blood was no longer seen, then 1 ml of RNAiso Reagent (Takara Biotechnology Co., Ltd., Dalian, China) was added to each sample and the sample was stored in an RNase-free Eppendorf tube at −80°C.

Blood collection

Peripheral venous blood was drawn from each individual and collected in heparin tubes. PBMCs were isolated from 2 ml blood by density gradient centrifugation using the separation medium Ficoll according to the manufacturer's instructions (Haoyang Biotechnology Co., Ltd., Tianjin, China). Peripheral blood taken at rest was centrifuged (20°C, 400 × g for 20 min) and serum aspirated into new tubes. PBMCs and sera were separately stored at −80°C until use.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

PBMCs or 1-mm3 periodontal tissue samples were processed for total RNA extraction in 1 ml RNAiso Reagent at 4°C. RNA quality was determined using a bioanalyzer and total RNA was quantified using a spectrophotometer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA) at A260nm/A280nm between 1.8 and 2.0. RT was performed using a PrimeScript RT system (Takara Biotechnology Co., Ltd.) following the manufacturer's recommendations. The expression levels of I Foxp3, IL-12p35, EBi3 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) transcripts were quantified using RT-qPCR with SYBR Premix Ex Taq II (TaKaRa Biotechnology Co. Ltd.) and a LightCycler system (Roche Molecular Biochemicals, Mannheim, Germany) in accordance with the manufacturer's protocol. Primers for Foxp3, IL-12p35, EBi3 and GAPDH are listed in Table I. Cycling conditions used were: 95°C for 30 sec, 95°C for 5 sec and 60°C for 34 sec for 40 cycles, then 95°C for 15 sec, 60°C for 1 min and 95°C for 15 sec. In the qPCR process, 2 µl cDNA was added per well, using three wells per sample. Relative target gene quantification was obtained according to the 2−ΔΔCq method (12). Target gene mRNA expression was normalized to GAPDH mRNA expression, and the adjusted expression for healthy individuals was used as a reference (fold change, 1). In the mRNA analysis, 20 patients per group were included.

Table I.

Primer sequences.

Table I.

Primer sequences.

TargetDirectionSequence (5′-3′)
Foxp3Forward CTGGCAAATGGTGTCTGCAAGT
Reverse CTGCCCTTCTCATCCAGAAGATG
IL-12p35Forward AGGAATGTTCCCATGCCTTCA
Reverse CCAATGGTAAACAGGCCTCCAC
EBi3Forward GACCTCACAGACTACGGGGAAC
Reverse CGGGAAGCCCTTGCTACTT
GAPDHForward TGGTGAAGACGCCAGTGGA
Reverse GCACCGTCAAGGCTGAGAAC

[i] Foxp3, Forkhead box P3; IL-12p35, interleukin 12 subunit p35; EBi3, Epstein-Barr virus-induced 3; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.

Enzyme-linked immunosorbent assay (ELISA)

Sera and GCFs were tested using an IL-35 ELISA kit (USCN, Co., Ltd., Wuhan, China) in strict accordance with the manufacturer's instructions. The optical density of each sample was determined at 450 nm. A standard curve was generated, and data were expressed in units of pg/ml IL-35 per liter of serum or GCF.

Statistical analysis

Data are expressed as the mean ± standard error of the mean for each group. An unpaired Student's t-test was used to analyze differences between groups using SPSS version 19.0 software (IBM Corp., Armonk, NY, USA). The correlation analysis between clinical indicators and cytokines was analyzed by the Pearson rank correlation test. P<0.05 was considered to indicate a statistically significant result.

Results

Patient information and clinical parameters

A total of 40 participants were included in this study, with an age range from 18 to 55 years. Table II outlines the basic characteristics and clinical parameters of each group. The mean age of the CP group was 37.12±2.55 years and that of the healthy group was 35.23±2.36 years. The CP group consisted of 7 men and 13 women while the healthy group was composed of 6 men and 14 women. Differences in age and sex were not statistically significant between the two groups (P>0.05 for both). The PD of the healthy controls was 1.60±0.05 mm while for the CP group the PD was 4.72±0.26 mm, a statistically significant increase (P<0.05). The mean PD and CAL for the CP group were significantly higher than those of the healthy group (P<0.05 for both).

Table II.

Patient information and clinical parameters.

Table II.

Patient information and clinical parameters.

GroupSample sizeAge (years)Sex (M/F)PD (mm)CAL (mm)
Control2035.23±2.366/141.60±0.050.12±0.02
CP2037.12±2.557/13 4.72±0.26a 2.18±0.30a

a P<0.05 vs. control group. CP, chronic periodontitis; PD, probing depth; CAL, clinical attachment level.

Foxp3, IL-12p35 and EBi3 mRNAs in periodontal tissues

The mRNA expression levels of Foxp3, and of the IL-35 subunits, IL-12p35 and EBi3, in periodontal tissue were analyzed using RT-qPCR. As shown in Fig. 1, significantly increased Foxp3, IL-12p35 and EBi3 mRNA expression in periodontal tissue (Foxp3, 2.21-fold; IL-12p35, 2.49-fold; EBi3, 2.27-fold; P<0.05 for all) was observed for the CP group in comparison with the healthy control group.

Figure 1.

Foxp3, IL-12p35 and EBi3 mRNAs in periodontal tissues. (A) Foxp3, (B) IL-12p35 and (C) EBi3 mRNA expression in tissues of patients from the healthy control and CP groups. Healthy and periodontal tissue biopsies were collected from patients, mRNA extracted and reverse transcription-quantitative polymerase chain reaction performed using primers for Foxp3, IL-12p35 and EBi3 mRNAs. Data are expressed as the mean + standard error of the mean for each group (n=20). *P<0.05 vs. control. Foxp3, Forkhead box P3; IL-12p35, interleukin 12 p35 subunit; EBi3, Epstein-Barr virus-induced 3; CP, chronic periodontitis.

Foxp3, IL-12p35 and EBi3 mRNA in PBMCs

The mRNA expression levels of Foxp3, IL-12p35 and EBi3 were also examined in PBMCs using RT-qPCR. As shown in Fig. 2, significantly increased Foxp3, IL-12p35 and EBi3 mRNA expression in PBMCs (Foxp3, 2.15-fold; IL-12p35, 2.17-fold; EBi3, 3.06-fold; P<0.05 for all) was observed for the CP group in comparison with the healthy control group.

Figure 2.

Foxp3, IL-12p35 and EBi3 mRNAs in PBMCs from patients. (A) Foxp3, (B) IL-12p35 and (C) EBi3 mRNA expression in PBMCs of patients from the healthy control and CP groups. Following the extraction of mRNA, reverse transcription-quantitative polymerase chain reaction was performed using primers for Foxp3, IL-12p35 and EBi3 mRNAs. Data are expressed as the mean + standard error of the mean for each group (n=20). *P<0.05 vs. control. Foxp3, Forkhead box P3; IL-12p35, interleukin 12 p35 subunit; EBi3, Epstein-Barr virus-induced 3; CP, chronic periodontitis.

IL-35 protein in GCF and serum

Table III and Fig. 3 show the mean levels of IL-35 protein in GCF and serum samples from the CP and healthy control groups. The mean concentration of IL-35 protein was 205.56±1.61 ng/ml in GCF and 330.42±4.30 ng/ml in serum from the CP group, while for the healthy control group it was 101.88±0.37 ng/m in GCF and 206.89±10.06 ng/ml in serum. The mean concentration of IL-35 protein in the GCF and serum was significantly higher for the CP group compared with the healthy group (P<0.001 for both).

Figure 3.

IL-35 protein in GCF and serum. The mean concentration of IL-35 protein in (A) GCF and (B) serum of patients from the healthy control and CP groups as determined using ELISA. Data are expressed as the mean + standard error of the mean for each group (n=20). #P<0.001 vs. control. IL-35, interleukin 35; GCF, gingival crevicular fluid; CP, chronic periodontitis.

Table III.

Concentration of IL-35 protein in GCF and serum.

Table III.

Concentration of IL-35 protein in GCF and serum.

GroupSample sizeGCF (ng/ml)Serum (ng/ml)
Control20101.88±0.37206.89±10.06
CP20 205.56±1.61a 330.42±4.30a

a P<0.05 vs. control group. IL-35, interleukin 35; GCF, gingival crevicular fluid; CP, chronic periodontitis.

Correlation analysis

Using the Pearson rank correlation test, the concentration of IL-35 in the GCF with the CAL at detection sites of the CP group exhibited a negative correlation (P<0.001, R2=0.6101; Fig. 4A), and the concentrations of IL-35 and PD at detection sites were also significantly negative correlation (P<0.001, R2=0.6173; Fig. 4B). Similarly, the concentration of IL-35 in the serum of the CP group with CAL at detection sites exhibited a negative correlation (P<0.001, R2=0.9119; Fig. 4C), and PD at detection sites was also negatively correlated with the concentration of serum IL-35 (P<0.001, R2=0.6812; Fig. 4D).

Figure 4.

Correlation analysis of IL-35 protein and clinical examination results of patients with CP. Correlation of IL-35 with (A) CAL and (B) PD in the GCF, and with (C) CAL and (D) PD in serum. IL-35, interleukin 35; GCF, gingival crevicular fluid; CP, chronic periodontitis; CAL, clinical attachment level; PD, probing depth.

Discussion

Treg cells are necessary in the maintenance of immune homeostasis and the prevention of autoimmune disease. There is evidence (20,21) to suggest that anti-inflammatory Treg cells also play an important role in the development of periodontal disease and are involved in the subsequent inflammation and bone resorption. The infiltration of Treg cells into periodontal tissue reflects their ability to inhibit tissue damage (22). Foxp3 plays an integral role in regulating the differentiation of Treg cells (23). In the present study, Foxp3 was detected in periodontal tissues and PBMCs using RT-qPCR and its expression was found to be significantly higher in the CP group compared with the healthy control group.

IL-35 is an immunosuppressive/anti-inflammatory cytokine, expressed by Foxp3+ Treg cells, that belongs to the IL-12 family of cytokines (24). IL-35 is a dimeric protein comprised of an α chain (p35) and a β chain (EBi3) (14). Unlike other cytokines of the IL-12 family, IL-35 acts as an inhibitory factor for chronic inflammation, autoimmune disease and other immune disorders (7), and the expression of IL-35 in Treg cells is associated with their immune inhibitory ability (25). It has also been suggested that IL-35, as an inhibitory cytokine, plays a central role in infection and immune regulation (26), which includes inhibiting the proliferation of T cells and their effects. In the present study, it was observed that IL-35 was strongly detected in periodontitis tissues and the expression of IL-35 protein was increased in tissues from the CP group compared with those of healthy controls.

As long-living, non-Foxp3-dependent cells within the body, IL-35-producing inducible Treg cells secrete IL-35, which may inhibit the spread of inflammation, increase the number of Treg cell subsets and enhance immune regulation (27). Niedbala et al (15) found that an EBi3-p35-Fc fusion protein promoted the proliferation of CD4+CD25+ Treg cells and inhibited CD4+CD25− T cells in vitro. These observations may explain why as increased expression of IL-35 protein in tissues from the CP group compared with those of healthy controls was detected in the present study.

There is evidence indicating that a loss of IL-35 is associated with the progression of various diseases, including numerous inflammatory diseases (28,29). IL-35 is required for effective Treg cells; animals lacking functional IL-35 exhibit an enhanced inflammatory immune response and progressive deterioration from disease (30,31). The present study found that the concentration of IL-35 in the GCF of the CP group showed a negative correlation with CAL or PD in detection sites, and the concentration of IL-35 in the serum of the CP group correlated with CAL and PD in a similar manner. These data suggest that IL-35 in autoimmune or infectious diseases may regulate the local microenvironment and peripheral immune response, maintaining its homeostasis.

The analysis of IL-12p35 and EBi3 (IL-35) mRNAs using RT-qPCR in PBMCs and periodontal tissues from patients with CP in the present study revealed significantly higher expression in the CP group compared with the healthy control group. This is a similar result to that of Kalburgi et al, which to the best of our knowledge is the only other study to address the role of IL-35 in periodontal disease, albeit using semi-quantitative RT-PCR (32). The present study also found that the mean concentration of IL-35 protein in GCFs and sera from the CP group was significantly higher than for the healthy group, paralleling gene expression. These results suggest that IL-35 is an essential factor for the immune response of Treg cells, and may be useful in the prognosis of CP. Similarly, Nakajima et al (33) reported that the proportion of CD4+CD25+ T cells and Foxp3 expression in periodontal disease tissues was increased compared with those of gingivitis controls. Since EBi3 is a downstream target of Foxp3 (7), the high expression of Foxp3 mRNA, as detected in the present study, would promote EBi3 subunit formation and therefore explain the high IL-35 protein expression that was observed.

The results of the present study indicate that IL-35 expression increases with CP development, which may help to attenuate the process of chronic periodontitis. In addition, although patients included in the study did not exhibit systemic disease, periodontitis may cause, or aggravate, chronic inflammation in systemic disease. More specifically, gram-negative anaerobic bacteria at the bottom of periodontal pockets may invade epithelial cells and hide in host cells, aggravating the destruction of periodontal tissue; they can potentially also invade endothelial cells and access the blood circulation to stimulate a host immune response and cause systemic inflammation (34–36). IL-35, as a negative regulator of immune factors, may slow or inhibit the development of periodontal disease and thus, indirectly, also slow systemic disease. IL-35 is a relatively recently identified cytokine that has not been studied in many disease models. Since the parameters investigated in the present study are few, it is unclear whether IL-35 enhances or antagonizes the effects of other cytokines or immune cells in CP. In future, it will be necessary to increase sample sizes and study a greater number of parameters to more fully understand the role of IL-35 in CP.

IL-35, as a Treg-specific suppressor of inflammatory cytokines, may maintain the balance between bacterial infection in chronic periodontal patients and effector cells by regulating the immune system, in order to avoid periodontal tissue damage caused by an overstimulated immune system (24,32). The detection of higher levels of IL-35 protein and subunit mRNA in diseased tissue compared with healthy tissue indicate that it may play an important role in the development of CP. As GCF is easily sampled, and simple, sensitive and reliable detection methods for IL-35 are available, IL-35 is potentially an important diagnostic tool for clinical use. However, as an appropriate treatment strategy for periodontitis, further studies on IL-35 are required to understand the precise functional role of this cytokine in periodontal disease and within immune and inflammatory regulatory networks.

Acknowledgements

This study was supported by the Natural Science Foundation of China (grant no. 81570988).

References

1 

Di Benedetto A, Gigante I, Colucci S and Grano M: Periodontal disease: Linking the primary inflammation to bone loss. Clin Dev Immunol. 2013:5037542013. View Article : Google Scholar : PubMed/NCBI

2 

Mendes L, Azevedo NF, Felino A and Pinto MG: Relationship between invasion of the periodontium by periodontal pathogens and periodontal disease: A systematic review. Virulence. 6:208–215. 2015. View Article : Google Scholar : PubMed/NCBI

3 

Yucel-Lindberg T and Båge T: Inflammatory mediators in the pathogenesis of periodontitis. Expert Rev Mol Med. 15:e72013. View Article : Google Scholar : PubMed/NCBI

4 

Gonzales JR: T- and B-cell subsets in periodontitis. Periodontol 2000. 69:181–200. 2015. View Article : Google Scholar : PubMed/NCBI

5 

Campbell L, Millhouse E, Malcolm J and Culshaw S: T cells, teeth and tissue destruction - what do T cells do in periodontal disease? Mol Oral Microbiol. 31:445–456. 2016. View Article : Google Scholar : PubMed/NCBI

6 

Hernández M, Dutzan N, García-Sesnich J, Abusleme L, Dezerega A, Silva N, González FE, Vernal R, Sorsa T and Gamonal J: Host-pathogen interactions in progressive chronic periodontitis. J Dent Res. 90:1164–1170. 2011. View Article : Google Scholar : PubMed/NCBI

7 

Collison LW, Workman CJ, Kuo TT, Boyd K, Wang Y, Vignali KM, Cross R, Sehy D, Blumberg RS and Vignali DA: The inhibitory cytokine IL-35 contributes to regulatory T-cell function. Nature. 450:566–569. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Shevach EM, DiPaolo RA, Andersson J, Zhao DM, Stephens GL and Thornton AM: The lifestyle of naturally occurring CD4+ CD25+ Foxp3+ regulatory T cells. Immunol Rev. 212:60–73. 2006. View Article : Google Scholar : PubMed/NCBI

9 

Xystrakis E, Boswell SE and Hawrylowicz CM: T regulatory cells and the control of allergic disease. Expert Opin Biol Ther. 6:121–133. 2006. View Article : Google Scholar : PubMed/NCBI

10 

Coombes JL, Robinson NJ, Maloy KJ, Uhlig HH and Powrie F: Regulatory T cells and intestinal homeostasis. Immunol Rev. 204:184–194. 2005. View Article : Google Scholar : PubMed/NCBI

11 

Annacker O, Pimenta-Araujo R, Burlen-Defranoux O and Bandeira A: On the ontogeny and physiology of regulatory T cells. Immunol Rev. 182:5–17. 2001. View Article : Google Scholar : PubMed/NCBI

12 

Wang L, Wang J, Jin Y, Gao H and Lin X: Oral administration of all-trans retinoic acid suppresses experimental periodontitis by modulating the Th17/Treg imbalance. J Periodontol. 85:740–750. 2014. View Article : Google Scholar : PubMed/NCBI

13 

Collison LW and Vignali DA: Interleukin-35: Odd one out or part of the family? Immunol Rev. 226:248–262. 2008. View Article : Google Scholar : PubMed/NCBI

14 

Choi J, Leung PS, Bowlus C and Gershwin ME: IL-35 and Autoimmunity: A comprehensive perspective. Clin Rev Allergy Immunol. 49:327–332. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Niedbala W, Wei XQ, Cai B, Hueber AJ, Leung BP, McInnes IB and Liew FY: IL-35 is a novel cytokine with therapeutic effects against collagen-induced arthritis through the expansion of regulatory T cells and suppression of Th17 cells. Eur J Immunol. 37:3021–3029. 2007. View Article : Google Scholar : PubMed/NCBI

16 

Hu Y, Dong C, Yue Y and Xiong S: In vivo delivery of interleukin-35 relieves coxsackievirus-B3-induced viral myocarditis by inhibiting Th17 cells. Arch Virol. 159:2411–2419. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Terayama H, Yoshimoto T, Hirai S, Naito M, Qu N, Hatayama N, Hayashi S, Mitobe K, Furusawa J, Mizoguchi I, et al: Contribution of IL-12/IL-35 common subunit p35 to maintaining the testicular immune privilege. PLoS One. 9:e961202014. View Article : Google Scholar : PubMed/NCBI

18 

Guan SY, Leng RX, Khan MI, Qureshi H, Li XP, Ye DQ and Pan HF: Interleukin-35: A potential therapeutic agent for autoimmune diseases. Inflammation. 40:303–310. 2017. View Article : Google Scholar : PubMed/NCBI

19 

Wu X, Offenbacher S, Lόpez NJ, Chen D, Wang HY, Rogus J, Zhou J, Beck J, Jiang S, Bao X, et al: Association of interleukin-1 gene variations with moderate to severe chronic periodontitis in multiple ethnicities. J Periodontal Res. 50:52–61. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Dutzan N, Gamonal J, Silva A, Sanz M and Vernal R: Over-expression of forkhead box P3 and its association with receptor activator of nuclear factor-kappa B ligand, interleukin (IL)-17, IL-10 and transforming growth factor-beta during the progression of chronic periodontitis. J Clin Periodontol. 36:396–403. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Joosten SA and Ottenhoff TH: Human CD4 and CD8 regulatory T cells in infectious diseases and vaccination. Hum Immunol. 69:760–770. 2008. View Article : Google Scholar : PubMed/NCBI

22 

Ohlrich EJ, Cullinan MP and Seymour GJ: The immunopathogenesis of periodontal disease. Aust Dent J. 54 Suppl 1:S2–S10. 2009. View Article : Google Scholar : PubMed/NCBI

23 

Alroqi FJ and Chatila TA: T regulatory cell biology in health and disease. Curr Allergy Asthma Rep. 16:272016. View Article : Google Scholar : PubMed/NCBI

24 

Collison LW, Chaturvedi V, Henderson AL, Giacomin PR, Guy C, Bankoti J, Finkelstein D, Forbes K, Workman CJ, Brown SA, et al: IL-35-mediated induction of a potent regulatory T cell population. Nat Immunol. 11:1093–1101. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Collison LW, Pillai MR, Chaturvedi V and Vignali DA: Regulatory T cell suppression is potentiated by target T cells in a cell contact, IL-35- and IL-10-dependent manner. J Immunol. 182:6121–6128. 2009. View Article : Google Scholar : PubMed/NCBI

26 

Clavel G, Thiolat A and Boissier MC: Interleukin newcomers creating new numbers in rheumatology: IL-34 to IL-38. Joint Bone Spine. 80:449–453. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Ma J and Xie LZ: Eukaryotic expression and biological activity of human interleukin-35. Zhongguo Yi Xue Ke Xue Yuan Xue Bao. 35:618–622. 2013.(In Chinese). PubMed/NCBI

28 

Zhang YL, Zhou XY, Guo XY and Tu JW: Association between serum interleukin-35 levels and severity of acute pancreatitis. Int J Clin Exp Med. 8:7430–7434. 2015.PubMed/NCBI

29 

Egwuagu CE, Yu CR, Sun L and Wang R: Interleukin 35: Critical regulator of immunity and lymphocyte-mediated diseases. Cytokine Growth Factor Rev. 26:587–593. 2015. View Article : Google Scholar : PubMed/NCBI

30 

Liu JQ, Liu Z, Zhang X, Shi Y, Talebian F, Carl JW Jr, Yu C, Shi FD, Whitacre CC, Trgovcich J and Bai XF: Increased Th17 and regulatory T cell responses in EBV-induced gene 3-deficient mice lead to marginally enhanced development of autoimmune encephalomyelitis. J Immunol. 188:3099–3106. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Tirotta E, Duncker P, Oak J, Klaus S, Tsukamoto MR, Gov L and Lane TE: Epstein-Barr virus-induced gene 3 negatively regulates neuroinflammation and T cell activation following coronavirus-induced encephalomyelitis. J Neuroimmunol. 254:110–116. 2013. View Article : Google Scholar : PubMed/NCBI

32 

Kalburgi NB, Muley A, Shivaprasad BM and Koregol AC: Expression profile of IL-35 mRNA in gingiva of chronic periodontitis and aggressive periodontitis patients: A semiquantitative RT-PCR study. Dis Markers. 35:819–823. 2013. View Article : Google Scholar : PubMed/NCBI

33 

Nakajima T, Ueki-Maruyama K, Oda T, Ohsawa Y, Ito H, Seymour GJ and Yamazaki K: Regulatory T-cells infiltrate periodontal disease tissues. J Dent Res. 84:639–643. 2005. View Article : Google Scholar : PubMed/NCBI

34 

Olsen I: From the Acta Prize Lecture 2014: The periodontal-systemic connection seen from a microbiological standpoint. Acta Odontol Scand. 73:563–568. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Linden GJ and Herzberg MC: Working group 4 of the joint EFP/AAP workshop: Periodontitis and systemic diseases: A record of discussions of working group 4 of the joint EFP/AAP workshop on periodontitis and systemic diseases. J Periodontol. 84 4 Suppl:S20–S23. 2013. View Article : Google Scholar : PubMed/NCBI

36 

Paquette DW: The periodontal infection-systemic disease link: A review of the truth or myth. J Int Acad Periodontol. 4:101–109. 2002.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Jin Y, Liu D and Lin X: IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis. Exp Ther Med 14: 5605-5610, 2017.
APA
Jin, Y., Liu, D., & Lin, X. (2017). IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis. Experimental and Therapeutic Medicine, 14, 5605-5610. https://doi.org/10.3892/etm.2017.5255
MLA
Jin, Y., Liu, D., Lin, X."IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis". Experimental and Therapeutic Medicine 14.6 (2017): 5605-5610.
Chicago
Jin, Y., Liu, D., Lin, X."IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis". Experimental and Therapeutic Medicine 14, no. 6 (2017): 5605-5610. https://doi.org/10.3892/etm.2017.5255
Copy and paste a formatted citation
x
Spandidos Publications style
Jin Y, Liu D and Lin X: IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis. Exp Ther Med 14: 5605-5610, 2017.
APA
Jin, Y., Liu, D., & Lin, X. (2017). IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis. Experimental and Therapeutic Medicine, 14, 5605-5610. https://doi.org/10.3892/etm.2017.5255
MLA
Jin, Y., Liu, D., Lin, X."IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis". Experimental and Therapeutic Medicine 14.6 (2017): 5605-5610.
Chicago
Jin, Y., Liu, D., Lin, X."IL‑35 may maintain homeostasis of the immune microenvironment in periodontitis". Experimental and Therapeutic Medicine 14, no. 6 (2017): 5605-5610. https://doi.org/10.3892/etm.2017.5255
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team