Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
June-2018 Volume 15 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
June-2018 Volume 15 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma

  • Authors:
    • Jing Wang
    • Shuzhi Wu
    • Tianren Huang
  • View Affiliations / Copyright

    Affiliations: Experimental Department, Affiliated Tumor Hospital of Guangxi Medical University, Nanning, Guangxi Zhuang Autonomous Region 530021, P.R. China, Institute for Viral Disease Control and Prevention, Shandong Center for Disease Control and Prevention, Jinan, Shandong 250014, P.R. China
  • Pages: 5450-5456
    |
    Published online on: May 3, 2018
       https://doi.org/10.3892/etm.2018.6129
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The aim of the present study was to examine the expression and role of vascular endothelial growth factor A (VEGFA) and microRNA (miRNA or miR)‑381 in tumor thrombi from patients with hepatocellular carcinoma and portal vein tumor thrombus (PVTT). Tumor thrombi and adjacent paired tissues were collected from 39 patients with hepatocellular carcinoma with PVTT. VEGFA expression levels were assessed using reverse transcription‑quantitative polymerase chain reaction and western blotting. miRNAs that may regulate VEGFA expression were predicted using bioinformatics analysis and confirmed via a dual luciferase reporter assay. The effects of VEGFA and its upstream miRNA on proliferation of the proliferation of EAhy926 human venous endothelial cells were analyzed using an MTT assay. Compared with the paired adjacent tissues, VEGFA was significantly upregulated at both the mRNA and protein level in tumor thrombi (P<0.05). VEGFA was predicted to be a target of miR‑381 and this was confirmed experimentally. miR‑381 expression was significantly downregulated in tumor thrombi from patients with PVTT compared with paired adjacent tissues (P<0.05). In addition, transfection with antagomirs against miR‑381 or short interfering RNA against VEGFA significantly inhibited EAhy926 cell proliferation (P<0.05). In conclusion, the results of the present study indicate that VEGFA is upregulated in tumor thrombi whereas miR‑381 is downregulated. VEGFA is regulated by miR‑381 and both may be associated with the development of PVTT.

Introduction

Primary hepatocellular carcinoma (HCC) is one of the most common malignant tumors of the digestive system, with high intrahepatic recurrence and metastasis rates leading to poor overall prognosis (1–3). Trousseau (4) reported that patients with cancer suffered complications due to venous thrombosis; the comorbidity of venous thrombosis and cancer was thus named Trousseau syndrome. Venous thrombosis is a common complication that occurs during the development of malignant tumors and is the second leading cause of death in patients with Trosseau syndrome after the cancer itself (5). A previous study suggested that malignant tumor is a high-risk factor for venous thrombosis, with ~12.3% of patients with cancer developing thrombi within 6 months of diagnosis (6). However, the mechanisms underlying the development of tumor thrombosis secondary to malignant tumors is yet to be elucidated.

The development of HCC is dependent on angiogenesis (7). Vascular endothelial growth factor A (VEGFA) serves an important role in the normal physiology and angiogenesis of various abnormal pathologies (8). The expression of VEGF in HCC cells is high due to local hypoxia stimulation, particularly near tumor necrotic areas (9,10). Inhibiting the expression of VEGF or blocking the corresponding signal transduction pathway and other pathways has an anti-angiogenic effect (11). Humanized monoclonal antibodies that bind to VEGFA and block its activity have been approved for the treatment of neoplastic diseases (12).

Several mRNA and microRNA (miR or miRNA) molecules are associated with Trousseau syndrome (13), including integrin β3 and the polyphosphate-factor XII signaling pathway (14). The occurrence of tumor thrombi is associated with neovascularization (15). VEGF, which is also secreted by tumor cells, and its signal transduction pathway serve important roles in the development of tumor thrombosis (16–18). In tumor angiogenesis, there are interactions between the coagulation process, inflammatory cytokines and malignant tumor growth and metastasis (19). The high permeability of tumor neovascular tissues induces plasma leakage resulting in increased specific volume, increased blood viscosity and blood stasis, all risk factors for thrombosis (16).

In the present study, reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting were used to analyze the expression of VEGFA in the tumor thrombi of patients with HCC with portal vein tumor thrombus (PVTT). miRNAs that regulate the expression of VEGFA were predicted by bioinformatics methods and validated using a dual luciferase reporter assay; it was demonstrated that VEGFA is targeted by miR-381. The association between miR-381 and VEGFA was investigated and their roles in venous endothelial cell proliferation were examined using an MTT assay. The results of the present study may provide a novel insight into the regulatory mechanisms of PVTT development in HCC.

Materials and methods

Patients

A total of 39 patients with HCC and PVTT were enrolled in the present study. All patients were diagnosed and underwent tumor thrombus resection between August 2013 and June 2016 at the Affiliated Tumor Hospital of Guangxi Medical University (Nanning, China). PVTT samples and paired adjacent tissues were collected from all patients. The cohort comprised 18 male and 21 female patients with a median age of 46.6 years (range, 26–65 years). All patients were diagnosed by a clinician and diagnoses were confirmed by histopathology. Prior to surgical resection, patients did not receive hormone, herbal, radiotherapy or chemotherapy treatment. PVTT was confirmed by Doppler ultrasound or based on symptoms and patient history. Written informed consent was obtained from every patient and the study was approved by the Ethics Review Board of Guangxi Medical University.

RNA extraction and RT-qPCR

Total RNAs were isolated from thrombi and adjacent tissues using TRIzol® (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. Following quantification using a spectrophotometer at 490 nm, RNA (1 µg) was reverse transcribed into cDNA using a TIANScript II cDNA 1st strand cDNA Synthesis kit (Tiangen Biotech Co., Ltd., Beijing, China). miRNA was reverse transcribed from total RNA using an miRcute miRNA cDNA Synthesis kit (Tiangen Biotech Co., Ltd.). qPCR was performed using the SuperReal SYBR Green PreMix (Tiangen Biotech Co., Ltd.) for mRNA, or the miRcute miRNA qPCR Detection kit (Tiangen Biotech Co., Ltd.) for miRNA using a Bio-Rad IQ5 thermocycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). For mRNA, the reaction mixture was incubated at 94°C for 2 min followed by 35 cycles at 94°C for 30 sec, 55°C for 30 sec and 71°C for 1 min. For miRNA, the reaction mixture was incubated at 95°C for 5 min followed by 40 cycles at 95°C for 15 sec, 60°C for 30 sec, and 72°C for 30 sec. Primers used were as follows: VEGFA. forward 5′-TTGCCTTGCTGCTCTACCTC-3′ and reverse 5′-AAATGCTTTCTCCGCTCTGA-3′; β-actin, forward 5′-TGACGTGGACATCCGCAAAG-3′ and reverse 5′-CTGGAAGGTGGACAGCGAGG-3′; miR-381, forward 5′-ACACTCCAGCTGGGTATACAAGGGCAAGCT-3′ and reverse 5′-TGGTGTCGTGGAGTCG-3′; U6, forward 5′-CTCGCTTCGGCAGCACA-3′ and reverse 5′-AACGCTTCACGAATTTGCGT-3′. The relative expression levels were evaluated using the 2−ΔΔCq method (20). β-actin and small nuclear U6 were used as internal controls for mRNA and miRNA, respectively.

Western blotting

Proteins were extracted using radioimmunoprecipitation assay buffer and protease inhibitor phenylmethane sulfonyl fluoride. The protein concentration was determined by using a bicinchoninic acid assay kit [RTP7102; Real-Times (Beijing) Biotechnology Co., Ltd., Beijing, China]. A total of 20 µg/lane protein was separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes. After blocking with 5% skimmed milk at room temperature for 1 h, the membranes were probed with the rabbit anti-VEGFA (1:1,000; ab46154) or rabbit anti-β-actin (1:5,000; ab129348; both Abcam, Cambridge, MA, USA) at 4°C overnight. After washing five times with Tris-buffered saline and Tween-20 (5 min each time), the membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit secondary antibodies (1:3,000; ab6721; Abcam) at room temperature for 1 h. Signal detection was performed using an enhanced chemiluminescence reaction kit (ab65623; Abcam) on a Gel Doc XR+ system (Bio-Rad Laboratories, Inc.). The acquired images were analyzed using Image lab 3.0 (Bio-Rad Laboratories, Inc.) and the relative protein expression was expressed as the densitometric value ratio of VEGFA to the β-actin band.

Bioinformatics analysis

To further identify the miRNAs that may regulate the expression of VEGFA the following bioinformatics databases were used: miRanda (34.236.212.39/microrna/home.do), TargetScan (targetscan.org), PiTa (genie.weizmann.ac.il/pubs/mir07/mir07_data.html), RNAhybrid (bibiserv.techfak.uni-bielefeld.de/rnahybrid/) and PICTA (pictar.mdc-berlin.de/) were used.

Dual-luciferase reporter gene assay

Based on the results of bioinformatics prediction, the conservative miR-381 binding sequence on 3′-untranslated region (UTR) of wild type (WT) or the mutant VEGFA mRNA was cloned. The primers to clone the WT miR-381 binding sequence were designed by CE Design V1.04 (Vazyme, Nanjing, China) ad follows: WT, forward 5′-tga tga aag ctg cgc act agt AAAGAGTAGGGTTTTTTTTCAGTATTCTT-3′ and reverse 5′-aaaagatcctttattaagcttTGCTGGGGAGCCAGGGGA-3′. Primers for the mutated sequence were constructed using a Mut Express II Fast Mutagenesis kit V2 C214-01/02 (Vazyme). Mutant, forward 5′-GTACCGGTTTaacaataATAAAATTCATGTTTCCAATCTCTCTCT-3′ and reverse 5′-tattgttAAACCGGTACAAATAAGAGAGCAAG-3′. The mutant binding sequence is underlined below:

2821 tgtatcttttgctctctcttgctctcttatttgtaccggtttTTGTATataaaattcatg

2881 tttccaatctctctctccctgatcggtgacagtcactagcttatcttgaacagatattta

Luciferase reporter plasmids were generated by inserting WT or mutant sequences of VEGFA into the multiple cloning site (Spe-1 and HindIII) downstream of the luciferase reporter gene in the pMIR-REPORT™ Luciferase (Thermo Fisher Scientific, Inc.). The 293T cells (American Type Culture Collection, Manassas, VA, USA) were transfected with 0.8 µg constructed luciferase reporters and 100 nM antagomir (agomiR)-381 (Sangon Biotech, Shanghai, China) or negative control RNA (NC) using ExFect Transfection reagent (cat. no. T101-02; Vazyme, Piscataway, NJ, USA). A total of 10 ng pMIR-REPORT™ β-gal Control Plasmid was transfected as an internal control for transfection efficiency. Luminescence was measured at 24 h after transfection using a Dual-Luciferase® Reporter Assay System (Promega Corp., Madison, WI, USA) according to the manufacturer's protocol Measurements of luminescence were performed using a Glomax 20/20 (Promega Corp.).

Cell culture and transfection

Human venous endothelial cells EAhy926 (American Type Culture Collection) were cultured in Dulbecco's Modified Eagle's medium (DMEM; Thermo Fisher Scientific, Inc.) with 10% heat-inactivated fetal bovine serum (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 1% penicillin and streptomycin at 37°C in a humidified atmosphere containing 5% CO2. A total of 3×105 cells were seeded in a 24-well plate and transfected with 25 pmol of agomiR-381 (Sangon Biotech) using Lipofectamine 2000 (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. As a control, EAhy926 cells were transfected with NC RNA without specifically targeting any human gene products. To silence the expression of VEGFA, cells were transfected with 50 nM VEGFA siRNA (siVEGFA) or NC (Sangon Biotech, Shanghai, China). Cells were collected at 48 h post-transfection for further experiments.

MTT assay

Cells were seeded into 96-well plates at a density of 2,000 cell/well. Cells were cultured at in a humidified atmosphere containing 5% CO2 at 37°C. At 24, 48, and 72 h, 20 µl of MTT reagent (5 mg/ml; JRDUN biotechnology, Shanghai, China) were added and cells were incubated at 37°C for 4 h until purple precipitate was visible. On the last day the culture supernatant was removed and 150 µl dimethyl sulfoxide per well was added. The 96-well plate was oscillated for 10 min until purple precipitate was dissolved. The absorbance was measured at 490 nm on a microplate reader. A cell growth curve was generated based on these absorbance values.

Statistical analysis

Data analysis was performed using SPSS version 18.0 (SPSS, Inc., Chicago, IL, USA) and expressed as the mean standard deviation. Differences between groups were evaluated for significance using one-way analysis of variance with Student Newman Keuls, Tamhane's T2 or Dunnett's T3 post hoc tests. P<0.05 was considered to indicate a statistically significant difference.

Results

VEGFA is upregulated in tumor thrombi

The expression of VEGFA mRNA was assessed using RT-qPCR. The results demonstrated that VEGFA mRNA expression was significantly increased in tumor thrombus samples compared with paired adjacent tissues (P<0.01; Fig. 1A). The expression of VEGFA protein was also assessed using western blotting and the results revealed that it was significantly upregulated in tumor thrombi compared with paired adjacent tissues (P<0.05; Fig. 1B). This suggests that VEGFA may be associated with the formation of tumor thrombi.

Figure 1.

VEGFA expression in patients with PVTT. Tumor thrombi and their paired adjacent tissues were collected from patients with HCC and PVTT. The expression of VEGFA (A) mRNA and (B) protein was analyzed using quantitative-polymerase chain reaction and western blotting, respectively. *P<0.05 and **P<0.01 vs. paired adjacent tissues. VEGFA, vascular endothelial growth factor A; PVTT, portal vein tumor thrombus; HCC, hepatocellular carcinoma.

VEGFA is a direct target of miR-381

Potential upstream miRNA regulators of VEGFA were investigated. miRNAs that may bind to the 3′-UTR of VEGFA were predicted using bioinformatics. An miR-381 binding site was identified at the 3′-UTR of VEGFA mRNA (Fig. 2A). A dual luciferase reporter assay was performed to confirm this prediction. Cotransfection of agomiR-381 and pMIR-REPORT-VEGFA WT construct significantly decreased luciferase activity compared with NC and pMIR-REPORT-VEGFA WT construct (P<0.05; Fig. 2B). However, cotransfection with agomiR-381 and pMIR-REPORT-VEGFA mutant construct had no significant effect on luciferase activity (Fig. 2B). These results suggest that VEGFA is a possible target of miR-381, with miR-381 binding to its 3′-UTR sequence.

Figure 2.

VEGFA is a target of miR-381. (A) The results of bioinformatics software revealed the binding sequence of miR-381 on the 3′UTR of VEGFA mRNA. (B) Wild and mutant constructs were cotransfected with NC. Luciferase activities were assayed 24 h post transfection. (C) EAhy926 cells were transfected with agomiR-381 or NC. The expression of miR-381 was analyzed. (D) Following transfection, VEGFA mRNA expression was assessed. (E) VEGFA protein expression was analyzed by immunoblotting following agomiR-381 transfection. **P<0.01 vs. NC. VEGFA, vascular endothelial growth factor A; miR, microRNA; 3′UTR, 3′-untranslated region; Wild, wild type VEGFA 3′UTR luciferase reporter construct; mutant, mutant VEGFA 3′UTR luciferase reporter construct; NC, negative control; agomiR, antagomir.

To confirm the results of the dual luciferase reporter assay, EAhy926 cells were transfected with agomiR-381 or NC. AgomiR-381 transfection significantly increased miR-381 expression (P<0.01; Fig. 2C) and significantly decreased VEGFA mRNA expression in EAhy926 cells (P<0.01; Fig. 2D). AgomiR-381 transfection also markedly reduced VEGFA protein levels (Fig. 2E). These results suggest that the expression of VEGFA is regulated by miR-381.

miR-381 is downregulated in tumor thrombi

The expression of miR-381 was assessed using RT-qPCR. miR-30b expression was significantly downregulated in tumor thrombi compared with adjacent paired tissues (P<0.01; Fig. 3). This indicates that miR-381 may contribute to the development of PVTT.

Figure 3.

Reverse transcription-quantitative polymerase chain reaction was used to assess miR-381 expression in tumor thrombi and their paired adjacent tissues. *P<0.05 vs. paired adjacent tissues.

Overexpression of miR-381 inhibits EAhy926 cell proliferation

To investigate whether miR-381 regulates cell proliferation, EAhy926 cells were transiently transfected with agomiR-381 or NC. An MTT proliferation assay revealed that EAhy926 cells transfected with miR-381 exhibited significantly decreased cell proliferation compared with untreated cells or those transfected with NC (P<0.05; Fig. 4). This result suggests that miR-381 is able to inhibit the proliferation of venous endothelial cells.

Figure 4.

Overexpression of miR-381 inhibits EAhy926 cell proliferation. EAhy926 cells were transfected with agomiR-381 or NC and cell proliferation was analyzed by MTT assay. *P<0.05 vs. NC. miR, microRNA; agomiR, antagomir; NC, negative control; OD, optical density.

Effect of VEGFA on cell proliferation

Eahy926 cell proliferation was examined following siVEGFA transfection. siVEGFA was demonstrated to significantly decrease VEGFA expression at the mRNA (P<0.01; Fig. 5A) and protein level (P<0.05; Fig. 5B). siVEGFA significantly inhibited cell proliferation at 72 h post transfection compared with NC or untransfected control cells (P<0.05; Fig. 5C). This suggests that VEGFA also serves a role in venous endothelial cell proliferation.

Figure 5.

Suppression of VEGFA inhibits EAhy926 cell proliferation. EAhy926 cells were transfected with VEGFA siRNA or NC. (A) VEGFA mRNA expression was analyzed using reverse transcription-quantitative polymerase chain reaction. (B) VEGFA protein expression was analyzed using western blotting. (C) Cell proliferation was analyzed using an MTT assay. *P<0.05, **P<0.01 by one-way ANOVA, compared with NC transfected cells. VEGFA, vascular endothelial growth factor A; si, small interfering; NC, negative control.

Discussion

In the present study, the expression of VEGFA and its upstream regulator, miR-381, was assessed in tumor thrombus and paired adjacent tissues from patients with HCC with PVTT. The association between miR-381 and VEGFA was also analyzed. The effects of miR-381 and VEGFA on venous endothelial cell proliferation were investigated and the mechanism of secondary development of PVTT in cases of HCC was discussed. To the best of our knowledge, the present study is the first to investigate the role of miR-381 and VEGF in tumor thrombosis in patients with HCC.

The 5-year survival rate of patients with HCC is <12% in the USA, ~32.5% overall and 59.1% in patients in the early stages in China (21,22). A number of studies have investigated the association between venous thromboembolism and malignant tumors; for example, it has been reported that almost 10% of patients with renal cell carcinoma develop venous thrombosis (23,24). In addition, 60% of patients with tumor thrombus have tumor metastasis (25). For patients with tumors and venous thrombosis, complete resection of the tumor tissues is currently the only effective treatment option (24). Venous thrombosis causes complications in patients with tumors; tumor cells are able to flow through the blood vessels to the portal vein and gradually grow to form a tumor thrombus, while the tumor cells can also spread along the vein in the liver (26,27).

Blocking cell signaling pathways or inhibiting tumor neovascularization to slow tumor growth is a major focus of tumor targeted therapy and the use of such neoadjuvant therapies have been described in several case studies (28–32). In humans, VEGFA is one of the most effective angiogenic factors as it is able to promote angiogenesis and increase blood supply (33). In the present study, it was demonstrated that VEGFA was significantly upregulated in tumor thrombi compared with normal tissues. Furthermore, silencing VEGFA inhibited EAhy926 cell proliferation. VEGF is also an important factor in HCC (34) and the data herein further suggest that VEGFA serves a crucial role in the development of PVTT.

miRNAs participate in the development of tumors by promoting the downregulation of mRNA expression and regulating protein-coding gene activity (35–37). In the present study, miR-381 was predicted to be an upstream regulator of VEGFA, which is consistent with a previous report in MG-63 cells (38). It has been reported that miR-381 is significantly downregulated in colon cancer tissues, and this induces the proliferation and invasion of colon cancer cells by increasing liver receptor homolog-1 upregulation (39). miRNA-381 in the p53/pituitary tumor-transforming 1 negative feedback loop inhibits the growth of pituitary tumors (40). miR-381 is also associated with multidrug resistance gene 1 and serves a role in multiple drug resistance (41). The combination of miR-381 and miR-424 inhibits the activity of cluster of differentiation 2 in renal cells by targeting WEE1 (42). Furthermore, it has also been demonstrated that miR-381 is associated with lung adenocarcinoma (43). Together, these studies demonstrate that miR-381 is a critical regulator in the development of various tumors. To further investigate the regulatory mechanism of miR-381 on VEGFA, miR-381 was overexpressed in EAhy926 cells via agomiR-381 transfection and cell proliferation was suppressed. Previous clinical studies and reports have indicated an association between tumor cell proliferation and PVTT (44–46). Additionally, miR-381 overexpression resulted in decreased VEGFA mRNA expression. The results of a dual-luciferase reporter assay demonstrated that miR-381 is able to directly target VEGFA. Collectively, the results of the present study indicate that miR-381 is able to directly regulate VEGFA expression.

In summary, VEGFA was upregulated in tumor thrombi from patients with HCC and PVTT, whereas miR-381 was downregulated. miR-381 is able to regulate VEGFA. Furthermore, miR-381 and VEGFA may regulate the proliferation of venous endothelial cells. Therefore, the findings of the present study suggest that miR-381 and VEGFA may be associated with the development of PVTT. However, a limitation of the present study is that the sample size was relatively small and primarily made up of individuals from the Chinese population. In order to further investigate the clinical applications of miR-381 and VEGF in tumor thrombosis, transgenic mice with miR-381 or VEGF knockout should be used in future studies.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

JW and SZW performed the experiments, analyzed the data and drafted the manuscript. TRH conceived and designed the study and wrote and revised the manuscript. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Written informed consent was obtained from every patient and the study was approved by the Ethics Review Board of Guangxi Medical University.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Wedd JP, Nordstrom E, Nydam T, Durham J, Zimmerman M, Johnson T, Purcell Thomas W and Biggins SW: Hepatocellular carcinoma in patients listed for liver transplantation: Current and future allocation policy and management strategies for the individual patient. Liver Transpl. 21:1543–1552. 2015. View Article : Google Scholar : PubMed/NCBI

2 

Kuszyk BS, Beauchamp NJ Jr and Fishman EK: Neurovascular applications of CT angiography. Semin Ultrasound CT MR. 19:394–404. 1998. View Article : Google Scholar : PubMed/NCBI

3 

Kanda M, Sugimoto H and Kodera Y: Genetic and epigenetic aspects of initiation and progression of hepatocellular carcinoma. World J Gastroenterol. 21:10584–10597. 2015. View Article : Google Scholar : PubMed/NCBI

4 

Trousseau Armand: Lectures on clinical medicine, delivered at the Hotel-Dieu, Paris. Translated and edited with notes and appendices by P. Victor Bazire. Med Clin. 1:1801–1867. 1872.

5 

Thodiyil PA and Kakkar AK: Variation in relative risk of venous thromboembolism in different cancers. Thromb Haemost. 87:1076–1077. 2002. View Article : Google Scholar : PubMed/NCBI

6 

Blom JW, Vanderschoot JP, Oostindier MJ, Osanto S, van der Meer FJ and Rosendaal FR: Incidence of venous thrombosis in a large cohort of 66,329 cancer patients: Results of a record linkage study. J Thromb Haemost. 4:529–535. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Folkman J: What is the evidence that tumors are angiogenesis dependent? J National Cancer Institute. 82:4–7. 1990. View Article : Google Scholar

8 

Cosmai L, Gallieni M, Liguigli W and Porta C: Renal toxicity of anticancer agents targeting vascular endothelial growth factor (VEGF) and its receptors (VEGFRs). J Nephroll. 30:171–180. 2017. View Article : Google Scholar

9 

Wu L, Zhang YS, Ye ML, Shen F, Liu W, Hu HS, Li SW, Wu HW, Chen QH and Zhou WB: Overexpression and correlation of HIF-2α, VEGFA and EphA2 in residual hepatocellular carcinoma following high-intensity focused ultrasound treatment: Implications for tumor recurrence and progression. Exp Ther Med. 13:3529–3534. 2017. View Article : Google Scholar : PubMed/NCBI

10 

Rong W, Yang L, Yin L, Gao Y, Xiao T and Cheng S: PSG9 promotes angiogenesis by stimulating VEGFA production and is associated with poor prognosis in hepatocellular carcinoma. Sci China Life Sci. 60:528–535. 2017. View Article : Google Scholar : PubMed/NCBI

11 

Ghosh A, Dasgupta D, Ghosh A, Roychoudhury S, Kumar D, Gorain M, Butti R, Datta S, Agarwal S, Gupta S, et al: miRNA199a-3p suppresses tumor growth, migration, invasion and angiogenesis in hepatocellular carcinoma by targeting VEGFA, VEGFR1, VEGFR2, HGF and MMP2. Cell Death Dis. 8:e27062017. View Article : Google Scholar : PubMed/NCBI

12 

Hsu CH, Kang YK, Yang TS, Shun CT, Shao YY, Su WC, Su WC, Sandoval-Tan J, Chiou TJ, Jin K, et al: Bevacizumab with erlotinib as first-line therapy in Asian patients with advanced hepatocellular carcinoma: A multicenter phase II study. Oncology. 85:44–52. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Meyer G: Venous thromboembolism and cancer. Rev Prat. 65:216–219. 2015.(In French). PubMed/NCBI

14 

Bianconi D, Schuler A, Pausz C, Geroldinger A, Kaider A, Lenz HJ, Kornek G, Scheithauer W, Zielinski CC, Pabinger I, et al: Integrin beta-3 genetic variants and risk of venous thromboembolism in colorectal cancer patients. Thromb Res. 136:865–869. 2015. View Article : Google Scholar : PubMed/NCBI

15 

Kokudo T, Hasegawa K and Kokudo N: Liver, pancreas, biliary tract cancer. I. Surgical treatment of hepatocellular carcinoma associated with vascular tumor thrombosis. Gan To Kagaku Ryoho. 41:1209–1211. 2014.(In Japanese). PubMed/NCBI

16 

Posch F, Thaler J, Zlabinger GJ, Königsbrügge O, Koder S, Zielinski C, Pabinger I and Ay C: Soluble vascular endothelial growth factor (sVEGF) and the risk of venous thromboembolism in patients with cancer: Results from the Vienna cancer and thrombosis study (CATS). Clin Cancer Res. 22:200–206. 2016. View Article : Google Scholar : PubMed/NCBI

17 

Babu Govind K and Bhat GR: Cancer-associated thrombotic microangiopathy. Ecancermedicalscience. 10:6492016. View Article : Google Scholar : PubMed/NCBI

18 

Evans CE, Grover SP, Saha P, Humphries J, Kim JW, Modarai B and Smith A: Suppression of angiogenic response in local vein wall is associated with reduced thrombus resolution. Thromb Res. 134:682–685. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Di Vito C, Navone SE, Marfia G, Hadi Abdel L, Mancuso ME, Pecci A, Crisà FM, Berno V, Rampini P, Campanella R and Riboni L: Platelets from glioblastoma patients promote angiogenesis of tumor endothelial cells and exhibit increased VEGF content and release. Platelets. 28:585–594. 2017. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

El-Serag HB: Hepatocellular carcinoma. N Engl J Med. 365:1118–1127. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Yang BH, Xia JL, Huang LW, Tang ZY, Chen MS, Li JQ, Liang AM, Mo QG, Lu HS, Dai CL, et al: Changes of clinical aspect of primary liver cancer in China during the past 30 years-control study for 3,250 cases with primary liver cancer. Zhonghua Yi Xue Za Zhi. 83:1053–1057. 2003.(In Chinese). PubMed/NCBI

23 

Karnes RJ and Blute ML: Surgery insight: Management of renal cell carcinoma with associated inferior vena cava thrombus. Nat Clin Pract Urol. 5:329–339. 2008.PubMed/NCBI

24 

Lambert EH, Pierorazio PM, Shabsigh A, Olsson CA, Benson MC and McKiernan JM: Prognostic risk stratification and clinical outcomes in patients undergoing surgical treatment for renal cell carcinoma with vascular tumor thrombus. Urology. 69:1054–1058. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Lam JS, Klatte T, Kim HL, Patard JJ, Breda A, Zisman A, Pantuck AJ and Figlin RA: Prognostic factors and selection for clinical studies of patients with kidney cancer. Crit Rev Oncol Hematol. 65:235–262. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Squillaci E, Fanucci E, Sciuto F, Masala S, Sodani G, Carlani M and Simonetti G: Vascular involvement in pancreatic neoplasm: A comparison between spiral CT and DSA. Dig Dis Sci. 48:449–458. 2003. View Article : Google Scholar : PubMed/NCBI

27 

Chow LC and Rubin GD: CT angiography of the arterial system. Radiol Clin North Am. 40:729–749. 2002. View Article : Google Scholar : PubMed/NCBI

28 

Hakenberg OW: Comment on Di Silverio et al: Neodajuvant therapy with sorafenib in advanced renal cell carcinoma with vena cava extension submitted to radical nephrectomy. Urol Int. 80:4542008. View Article : Google Scholar : PubMed/NCBI

29 

Shuch B, Riggs SB, LaRochelle JC, Kabbinavar FF, Avakian R, Pantuck AJ, Patard JJ and Belldegrun AS: Neoadjuvant targeted therapy and advanced kidney cancer: Observations and implications for a new treatment paradigm. BJU Int. 102:692–696. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Karakiewicz PI, Suardi N, Jeldres C, Audet P, Ghosn P, Patard JJ and Perrotte P: Neoadjuvant sutent induction therapy may effectively down-stage renal cell carcinoma atrial thrombi. Eur Urol. 53:845–848. 2008. View Article : Google Scholar : PubMed/NCBI

31 

Harshman LC, Srinivas S, Kamaya A and Chung BI: Laparoscopic radical nephrectomy after shrinkage of a caval tumor thrombus with sunitinib. Nat Rev Urol. 6:338–343. 2009. View Article : Google Scholar : PubMed/NCBI

32 

Bex A, Van der Veldt AA, Blank C, Meijerink MR, Boven E and Haanen JB: Progression of a caval vein thrombus in two patients with primary renal cell carcinoma on pretreatment with sunitinib. Acta Oncol. 49:520–523. 2010. View Article : Google Scholar : PubMed/NCBI

33 

Roberts E, Cossigny DA and Quan GM: The role of vascular endothelial growth factor in metastatic prostate cancer to the skeleton. Prostate Cancer. 2013:4183402013. View Article : Google Scholar : PubMed/NCBI

34 

Yan JJ, Zhang YN, Liao JZ, Ke KP, Chang Y, Li PY, Wang M, Lin JS and He XX: miR-497 suppresses angiogenesis and metastasis of hepatocellular carcinoma by inhibiting VEGFA and AEG-1. Oncotarget. 6:29527–29542. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Zhao X, Mohan R, Özcan S and Tang X: MicroRNA-30d induces insulin transcription factor MafA and insulin production by targeting mitogen-activated protein 4 kinase 4 (MAP4K4) in pancreatic β-cells. J Biol Chem. 287:31155–31164. 2012. View Article : Google Scholar : PubMed/NCBI

36 

Chen K and Rajewsky N: The evolution of gene regulation by transcription factors and microRNAs. Nat Rev Genet. 8:93–103. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Lewis BP, Burge CB and Bartel DP: Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets. Cell. 120:15–20. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Tsai HC, Tzeng HE, Huang CY, Huang YL, Tsai CH, Wang SW, Wang PC, Chang AC, Fong YC and Tang CH: WISP-1 positively regulates angiogenesis by controlling VEGF-A expression in human osteosarcoma. Cell Death Dis. 8:e27502017. View Article : Google Scholar : PubMed/NCBI

39 

Liang Y, Zhao Q, Fan L, Zhang Z, Tan B, Liu Y and Li Y: Down-regulation of MicroRNA-381 promotes cell proliferation and invasion in colon cancer through up-regulation of LRH-1. Biomed Pharmacother. 75:137–141. 2015. View Article : Google Scholar : PubMed/NCBI

40 

Liang HQ, Wang RJ, Diao CF, Li JW, Su JL and Zhang S: The PTTG1-targeting miRNAs miR-329, miR-300, miR-381, and miR-655 inhibit pituitary tumor cell tumorigenesis and are involved in a p53/PTTG1 regulation feedback loop. Oncotarget. 6:29413–29427. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Xu Y, Ohms SJ, Li Z, Wang Q, Gong G, Hu Y, Mao Z, Shannon MF and Fan JY: Changes in the expression of miR-381 and miR-495 are inversely associated with the expression of the MDR1 gene and development of multi-drug resistance. PLoS One. 8:e820622013. View Article : Google Scholar : PubMed/NCBI

42 

Chen B, Duan L, Yin G, Tan J and Jiang X: Simultaneously expressed miR-424 and miR-381 synergistically suppress the proliferation and survival of renal cancer cells-Cdc2 activity is up-regulated by targeting WEE1. Clinics (Sao Paulo). 68:825–833. 2013. View Article : Google Scholar : PubMed/NCBI

43 

Rothschild SI, Tschan MP, Jaggi R, Fey MF, Gugger M and Gautschi O: MicroRNA-381 represses ID1 and is deregulated in lung adenocarcinoma. J Thoracic Oncol. 7:1069–1077. 2012. View Article : Google Scholar

44 

Wu L, Zheng J, Chen P, Liu Q and Yuan Y: Small nucleolar RNA ACA11 promotes proliferation, migration and invasion in hepatocellular carcinoma by targeting the PI3K/AKT signaling pathway. Biomed Pharmacother. 90:705–712. 2017. View Article : Google Scholar : PubMed/NCBI

45 

Hou G, Liu G, Yang Y, Li Y, Yuan S, Zhao L, Wu M, Liu L and Zhou W: Neuraminidase 1 (NEU1) promotes proliferation and migration as a diagnostic and prognostic biomarker of hepatocellular carcinoma. Oncotarget. 7:64957–64966. 2016. View Article : Google Scholar : PubMed/NCBI

46 

Tang Y, Yu H, Zhang L, Wang K, Guo W, Shi J, Liu S, Wu M, Wang H and Cheng S: Experimental study on enhancement of the metastatic potential of portal vein tumor thrombus-originated hepatocellular carcinoma cells using portal vein serum. Chin J Cancer Res. 26:588–595. 2014.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Wang J, Wu S and Huang T: Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma. Exp Ther Med 15: 5450-5456, 2018.
APA
Wang, J., Wu, S., & Huang, T. (2018). Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma. Experimental and Therapeutic Medicine, 15, 5450-5456. https://doi.org/10.3892/etm.2018.6129
MLA
Wang, J., Wu, S., Huang, T."Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma". Experimental and Therapeutic Medicine 15.6 (2018): 5450-5456.
Chicago
Wang, J., Wu, S., Huang, T."Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma". Experimental and Therapeutic Medicine 15, no. 6 (2018): 5450-5456. https://doi.org/10.3892/etm.2018.6129
Copy and paste a formatted citation
x
Spandidos Publications style
Wang J, Wu S and Huang T: Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma. Exp Ther Med 15: 5450-5456, 2018.
APA
Wang, J., Wu, S., & Huang, T. (2018). Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma. Experimental and Therapeutic Medicine, 15, 5450-5456. https://doi.org/10.3892/etm.2018.6129
MLA
Wang, J., Wu, S., Huang, T."Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma". Experimental and Therapeutic Medicine 15.6 (2018): 5450-5456.
Chicago
Wang, J., Wu, S., Huang, T."Expression and role of VEGFA and miR‑381 in portal vein tumor thrombi in patients with hepatocellular carcinoma". Experimental and Therapeutic Medicine 15, no. 6 (2018): 5450-5456. https://doi.org/10.3892/etm.2018.6129
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team