Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
August-2018 Volume 16 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
August-2018 Volume 16 Issue 2

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1

  • Authors:
    • Ying He
    • Wen Yao
    • Meng Zhang
    • Ying Zhang
    • Dan Zhang
    • Zhuocheng Jiang
    • Tianyou Ma
    • Jian Sun
    • Mingming Shao
    • Jinghong Chen
  • View Affiliations / Copyright

    Affiliations: Institute of Endemic Diseases, School of Public Health, Xi'an Jiaotong University Health Science Center, Key Laboratory of Trace Elements and Endemic Diseases, National Health and Family Planning Commission, Xi'an, Shaanxi 710061, P.R. China, Department of Neurology, Xi'an Children's Hospital, Xi'an, Shaanxi 710003, P.R. China, Department of Biochemistry and Molecular Biology, School of Basic Medical Sciences, Xi'an Jiaotong University Health Science Center, Xi'an, Shaanxi 710061, P.R. China
    Copyright: © He et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 609-618
    |
    Published online on: June 7, 2018
       https://doi.org/10.3892/etm.2018.6261
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The molecular mechanisms underlying osteoarthritis (OA) and Kashin‑Beck disease (KBD) remain poorly understood. Hypertrophic chondrocytes serve an important role in the development of both OA and KBD, whereas oxidative stress can contribute to the pathological progression of cartilage damage. Therefore, the aim of the present study was to detect altered expression of osteogenesis‑related genes in hypertrophic chondrocytes, following treatment with 3‑morpholinosydnonimine (SIN‑1). ATDC5 cells were induced to develop into hypertrophic chondrocytes via Insulin‑Transferrin‑Selenium. The appropriate concentration and time of SIN‑1 treatment was determined via MTT assay. Following hypertrophic chondrocyte stimulation with SIN‑1, a liquid chip was analyzed using a polymerase chain reaction (PCR) array. Reverse transcription‑quantitative PCR was conducted on individual genes to validate the array‑based data. Analyses of protein‑protein interactions, gene ontology functions and Kyoto Encyclopedia of Genes and Genomes pathway enrichment of the differentially expressed genes were also performed. A total of 6 upregulated and 34 downregulated genes were identified, including the mothers against decapentaplegic homolog (Smad) family (Smad1‑4), bone morphogenetic proteins and their receptors (Bmp2, Bmp3, Bmpr1α and Bmpr1β), and matrix metalloproteinases (MMP2, ‑9 and ‑10). These genes are associated with collagen biology, transcriptional control, skeletal development, bone mineral metabolism, and cell adhesion. SIN‑1 induced death of hypertrophic chondrocytes likely through TGF‑β/Smad or BMP/Smad pathways. Oxidative‑stress‑dependent induction of abnormal gene expression may be associated with chondronecrosis in the cartilage of patients with OA or KBD.

Introduction

Osteoarthritis (OA) is a common form of arthritis, a disease of the joints, considered the leading cause of disability worldwide (1). Kashin-Beck disease (KBD) is an endemic OA, prevailing in China, Eastern Siberia, and North Korea (2). OA and KBD not only affect physical function, but also cause emotional stress to patients (3). Although OA and KBD have similar clinical features, such as common articular cartilage lesions and chronic pain, the pathogenesis is quite different. KBD is characterized by degeneration and necrosis in the deep zone of articular cartilage and epiphyseal plate cartilage, whereas in OA, progressive articular cartilage degeneration and synovial inflammation are the major pathological processes (4). OA is more common in the elderly, whereas KBD typically affects children and adolescents (3). A clear understanding of the molecular mechanisms underlying both OA and KBD remains elusive, and prevents the development of effective therapeutic strategies.

Cartilage is composed of chondrocytes and the extracellular matrix (ECM). Chondrocytes have a strong biological activity and can differentiate and hypertrophy (5). The ECM has an important role in cartilage regeneration and degradation (5). The family of matrix metalloproteinases (MMPs) has been reported as the primary factor in arthritis (6). Integrin, as a transmembrane receptor, mediates the connection between the cell and its external environment (such as the ECM) (5). Therefore, when MMP activity is abnormal, the function of chondrocytes will inevitably be affected through integrins (7,8). In OA, cartilage may contain excessive numbers of hypertrophy-like chondrocytes (9); however, chondrocytes can exhibit dedifferentiation in KBD. Although the two diseases have certain differences, there is no doubt that chondrocyte hypertrophy is abnormal in both OA and KBD. Furthermore, OA and KBD are oxidative-stress-associated diseases. In affected joints, oxidative DNA damage occurring in chondrocytes accumulates with OA progression (10).

In a previous study, 4-hydroxy-2-nonenal and 8-hydroxydeoxyguanisine were demonstrated to accumulate in the articular cartilage of KBD patients (11). A generator of peroxynitrite (ONOO−) in an aqueous solution, 3-morpholinosydnonimine (SIN-1), has been widely used in studies on oxidative or nitrosative stress (12,13). Considering the instability of authentic ONOO− at physiological pH, SIN-1 was chosen as an NO donor in the present study. Although numerous studies have been performed on deregulated hypertrophic differentiation and oxidative stress in chondrocytes of joint cartilages, studies that explore the exact molecular mechanism of oxidative stress in hypertrophic chondrocytes have not been published in recent years. In the present study, expression of osteogenesis genes was detected in hypertrophic chondrocytes treated with SIN-1 using chip array, and the interactions between these deregulated genes and how signaling factors change in OA was discussed. These data will provide new insights into the pathogenesis of OA and KBD.

Materials and methods

Cell culture and establishment of the hypertrophic chondrocyte model

The murine chondrogenitor cell line ATDC5 is internationally used to study cartilage differentiation in vitro, and has previously been applied to set up a hypertrophic chondrocyte model (14). For the present study, the ATDC5 cell line was purchased from the European Collection of Cell Cultures (Salisbury, UK). ATDC5 cells were cultured in a 1:1 mixture of Dulbecco's modified Eagle's medium and Ham's F-12 medium (DMEM/F-12 medium; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA), supplemented with 5% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences), penicillin (100 U/ml; Hyclone; GE Healthcare Life Sciences), and streptomycin (100 µg/ml; Hyclone; GE Healthcare Life Sciences). The cells were maintained at 37°C. ATDC5 cells were driven to hypertrophy using Insulin-Transferrin-Selenium (ITS) differentiation medium [DMEM/F-12 containing 5% FBS, penicillin (100 U/ml), streptomycin (100 µg/ml) and 1% ITS (cat. no. 354352; BD Biosciences, Franklin Lakes, NJ, USA)]. The ITS differentiation medium was changed every other day.

Identification of the hypertrophic chondrocyte model via reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

ATDC5 cells were seeded at a density of 4×104 cells/well in a six-well plate. Total RNA was isolated at 7, 14 and 21 days following ITS addition, using an RNeasy Plus Mini Kit (cat. no. 74104; Qiagen GmbH, Hilden, Germany). The concentration and purity of total RNA were determined by spectrophotometric measurement on a NanoDrop ND-2000 (NanoDrop; Thermo Fisher Scientific, Inc., Wilmington, Delaware, USA). A total of 1 µg of total RNA from each sample was reverse transcribed using a Revert Aid™ First cDNA Synthesis Kit (cat. no. K1622; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and the resulting cDNA was diluted five times in nuclease-free water. Type X collagen (Col X) and runt-related transcription factor 2 (Runx2), as marker genes of hypertrophy, were assessed during the induction of hypertrophy in ATDC5 cells using the QuantiFast SYBR Green PCR kit (cat. no. 204054; Qiagen GmbH, Hilden, Germany). The thermocycling conditions were as follows: One cycle at 95°C for 10 min; 40 cycles at 95°C for 5 sec, 60°C for 10 sec and 72°C for 10 sec. GAPDH mRNA served as an endogenous control. The synthetic oligonucleotide primers (Shanghai Boya Biotechnology Co., Ltd., Shanghai, China) for RT-qPCR are presented in Table I. The relative mRNA expression of the target genes were calculated using relative quantification (2−ΔΔCq) (15).

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction experiments.

Table I.

Primers used in reverse transcription-quantitative polymerase chain reaction experiments.

GenesForward primer (5′-3′)Reverse primer (5′-3′)
GAPDH GGGCTCATGACCACAGTCCATGC CCTTGCCCACAGCCTTGGCA
Col X ACGCATCTCCCAGCACCAGAATC GGGGCTAGCAAGTGGGCCCT
Runx2 GGTTGTAGCCCTCGGAGAGG GCCATGACGGTAACCACAGTC
Smad1 AAAGACCTGTGGCTTCCGTCT TTATCGTGGCTCCTTCGTCAG
Smad2 ATGTCGTCCATCTTGCCATTC AACCGTCCTGTTTTCTTTAGCTT
Smad3 GCTGCCCTCCTAGCTCAG GGTGCTGGTCACTGTCTGTC
Smad4 GAGAACATTGGATGGACGACT CACAGACGGGCATAGATCAC
Col2a1 CCAGCTGACCTCGCCACTGC GGGTCCAGGCGCACCCTTTT
MMP10 GCAGCCCATGAACTTGGCCACT AGGGACCGGCTCCATACAGGG
Vcam1 GATAGACAGCCCACTAAACGCG GAATCTCTGGATCCTTGGGG

[i] Col X, type X collagen; Runx2, runt-related transcription factor 2; Smad, mothers against decapentaplegic homolog; Col 2a, collagen, type II, α; MMP10, matrix metalloproteinase 10; Vcam1, vascular cell adhesion molecule 1.

Identification of the hypertrophic chondrocyte model by a western blotting assay

Proteins were harvested at 7, 14 and 21 days following ITS addition using radioimmunoprecipitation assay reagent (Beyotime Institute of Biotechnology, Haimen, China). Proteins were measured using a BCA kit (Beyotime Institute of Biotechnology). The protein levels of Col X and Runx2 were measured by western blotting. Equal amounts (20 µg) of total protein were separated by 10% SDS-PAGE, and were then transferred to an Immobilon polyvinylidene difluoride membrane (EMD Millipore, Billerica, MA, USA). Following blocking in 5% skimmed milk for 30 min at room temperature, the membranes were incubated with primary antibodies against Col X (1:200; cat. no. ab58632; Abcam, Cambridge, UK), Runx2 (1:1,000; cat. no. 12556; Cell Signaling Technology, Inc., Danvers, MA, USA) and GAPDH (1:500; Boster Biological Technology, Pleasanton, CA, USA) for 40 min at 37°C and then overnight at 4°C. After washing, the secondary antibody [horseradish peroxidase (HRP)-conjugated anti-rabbit antibody (1:10,000; cat. no. 120745; Jackson ImmunoResearch Laboratories Inc, West Grove, PA, USA)] was incubated for 30 min at 37°C. Following washing, the membrane was reacted with the Immobilon Chemiluminescent HRP substrate (EMD Millipore) in accordance with the manufacturer's protocol. Images were captured and analyzed by means of the SuperSignal Ultra Western blot chemiluminescence system (Gene Co., Ltd., Hong Kong, China).

MTT assay to determine suitable SIN-1 concentration and incubation time

ATDC5 cells were seeded in a 96-well plate (1×103 cells/well) and the ITS differentiation medium was used from the next day-day 21. The medium was changed every other day. Cells were incubated with 0, 1, 5 and 10 mM SIN-1 for 4 h, or 0, 1, 2, 3, 4 or 5 mM SIN-1 for 24 h at 37°C, and then further incubated for another 4 h in medium containing 0.5 mg/ml MTT (MP Biomedicals, LLC, Santa Ana, CA, USA) at 37°C. The cell culture medium was discarded and the intracellular purple formazan in each well was dissolved in 150 µl dimethyl sulfoxide. The purple crystals were quantified by measuring the absorbance at a wavelength of 490 nm in a microplate reader (3550; Bio-Rad Laboratories, Inc., Hercules, CA, USA).

RNA preparation for PCR array analysis

Total RNA from hypertrophic chondrocytes stimulated by 0 or 3 mM SIN-1 for 24 h was isolated using the RNeasy Plus Mini Kit (Qiagen GmbH). The concentration and purity of total RNA were measured, and RNA quality and integrity were evaluated by 2% agarose gel electrophoresis. cDNA was synthesized from 1 µg total RNA from each sample with the RT2 First Strand Kit (cat. no. 330401; Qiagen GmbH). Eliminating genomic DNA contamination with the RT2 Profiler PCR Array was essential for obtaining optimal real-time gene expression profiling results. The mixed sample was incubated at 42°C for 15 min and 95°C for 5 min. A total of 91 µl RNase-free water was added to each 20 µl cDNA synthesis reaction. The samples were mixed by pipetting up and down several times. The mixtures were kept on ice until the PCR procedure or stored at−20°C until processing.

Liquid chip analysis using RT2 Profiler PCR Arrayss®

The 102 µl cDNA synthesis reaction was diluted with 1,248 µl RNase-free water and then added to 1,350 µl RT2 qPCR SYBR Green Mastermix (cat. no. 330522; Qiagen GmbH). A total of 25 µl PCR master mix was dispensed into each well of the 96-well Mouse Osteogenesis RT2 Profiler PCR Array (cat. no. PAMM-026Z; Qiagen GmbH). qPCR was performed on a Thermal Cycler Dice Real Time System (TP-800; Takara Bio, Inc., Otsu, Japan) via SYBR Green detection, and the following thermal cycling program: 1 cycle at 95°C for 10 min; 40 cycles of 95°C for 15 sec, 55°C for 40 sec, and 72°C for 30 sec; and 1 cycle at 95°C for 15 sec, 60°C for 30 sec and 95°C for 15 sec. All data from the real-time instrument were interpreted via the PCR Array Data web tool (https://www.qiagen.com/cn/shop/genes-and-pathways/data-analysis-center-overview-page/?akamai-feo=off; SABiosciences; Qiagen GmbH).

Statistical analysis of PCR array data

Each PCR array included 5 housekeeping genes (Actb, B2m, GAPDH, Gusb, and Hsp90ab1) for normalization of the sample data. According to the manusfacturer's instructions of the aforementioned Mouse Osteogenesis RT2 Profiler PCR Array, if the Cq value of Mouse Genomic DNA Contamination (MGDA) control was >30, then no genomic DNA contamination was detectable. Although the PCR array was performed only once, the fold changes and P-values were calculated by means of the PCR Array Data web tool.

RT-qPCR validation

RT-qPCR was conducted to validate PCR array data. A total of 8 genes were selected, including 7 downregulated genes (Smad1-4, ColX, Vcam1 and MMP10) and 1 upregulated gene (Col2a1). The samples were prepared in the same way as described above. Total RNA was extracted using the RNeasy Plus Mini Kit (Qiagen GmbH). A total of 1 µg total RNA from each sample was reverse-transcribed with the Revert Aid™ First cDNA Synthesis kit (cat. no. K1622; Thermo Fisher Scientific, Inc.), and the resulting cDNA was diluted 5 times. GAPDH expression served as an endogenous control to normalize all samples for potential variations in mRNA content. The synthetic oligonucleotide primers for qPCR are presented in Table I. Single-stranded cDNA was amplified with the QuantiFast SYBR Green PCR Kit (cat. no. 204054; Qiagen GmbH). The thermal cycling program was the same as that in the PCR array experiment. The relative mRNA expression levels of the target genes were calculated using relative quantification (2−ΔΔCq) (15).

Analysis of protein-protein interactions (PPIs), gene ontology (GO) functions and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment

In the present study, PPIs, GO functions and KEGG pathway enrichment of 40 differentially expressed genes were analyzed in the STRING 10.05 software (https://string-db.org/) to understand their biological processes, molecular function, cellular components, KEGG pathways as well as their interactions at the protein level. The parameters of the reliability and the additional nodes could be adjusted according to the concrete analysis results. The PPI networks were constructed. A gene-pathway network analysis was conducted using Cytoscape 3.4.0 (http://www.cytoscape.org/).

Statistical analysis

All data were expressed as the mean ± standard deviation and analyzed using SPSS version 16.0 (SPSS, Inc., Chicago, IL, USA). Differences between two sampled were analyzed using Student's t-test. Data with more than two comparisons were analyzed using one-way analysis of variance followed by post hoc Fisher's least significant difference test or Bonferroni's multiple-comparison test, as required. P<0.05 was considered to indicate a statistically significant difference.

Results

Establishment of the hypertrophic chondrocyte model

During the induction of hypertrophy, mRNA expression of Col X was significantly upregulated (P<0.05) and it peaked on day 21 (P<0.05; Fig. 1A). The mRNA expression of Runx2 was also significantly changed (P<0.05); it increased significantly on day 21 (P<0.05), but decreased on day 14 (P<0.05) compared with day 7 (P<0.05; Fig. 1B). Concurrently, protein expression levels of Col X and Runx2 also markedly increased on day 21, according to western blotting. Representative data from three independent experiments are presented (Fig. 1C and D). Thus, culturing ATDC5 cells for 21 days to set up the hypertrophic chondrocyte model was carried out for all subsequent experiments.

Figure 1.

Establishment of the hypertrophic chondrocyte model. The mRNA expression levels of (A) Col X and (B) Runx2 during the differentiation process were detected by reverse transcription-quantitative polymerase chain reaction. The group treated for 7 days served as a control. Simultaneously, protein expression levels of (C) Col X and (D) Runx2 were assessed via western blotting. Data are expressed as the mean ± standard deviation from three independent experiments. *P<0.05 vs. day 7. Col X, type X collagen; Runx2, runt-related transcription factor 2.

The effect of SIN-1 on vitality of hypertrophic chondrocytes

Subsequently, 0, 1, 5 or 10 mM SIN-1 was added to hypertrophic chondrocytes for 4 h incubation and cellular viability was measured via the MTT assay. All SIN-1 concentrations significantly decreased the cell viability (P<0.05). The results demonstrated a high degree of toxicity with 10 mM SIN-1 P<0.05; Fig. 2A). Subsequently, 0, 1, 2, 3, 4 or 5 mM SIN-1 was added to hypertrophic chondrocytes for 24 h incubation and cell viability was measured via the MTT assay. All SIN-1 concentrations significantly decreased the cell viability (P<0.05). There was a significant negative association between cellular viability and SIN-1 concentration, and 3 mM SIN-1 decreased viability by 50% (P<0.05; Fig. 2B). Therefore, 3 mM SIN-1 treatment was selected for 24 h as the standard procedure for the subsequent experiments.

Figure 2.

Viability of hypertrophic chondrocytes treated with SIN-1. (A) Cells were treated with 0, 1, 5 or 10 mM SIN-1 for 4 h. (B) Cells were treated with 0, 1, 2, 3, 4 or 5 mM SIN-1 for 24 h. Data are expressed as the mean ± standard deviation from three independent experiments. *P<0.05 vs. 0 mM. SIN-1, 3-morpholinosydnonimine.

Differentially expressed genes in the chip array

In the PCR array, a total of 84 genes associated with osteogenesis were compared between the control and 3-mM SIN-1 group in hypertrophic chondrocytes. A scatter plot of 84 genes indicated that 40 genes were differentially expressed by 3-fold or greater (Fig. 3). In total, 34 genes were downregulated (Table II), which were mostly associated with collagen, gene expression regulation (transcription factors), skeletal development, bone mineral metabolism and cell adhesion. A total of 6 genes were upregulated (Table III), which were mostly associated with collagen, skeletal development and cell adhesion molecules.

Figure 3.

A scatter plot of 84 genes associated with osteoarthritis. Genes whose expression levels were altered by ≥3-fold were deemed differentially expressed. Upregulated genes are marked with a red circle, whereas downregulated genes are marked with a green circle. Black circles represent genes whose expression was unchanged. SIN-1, 3-morpholinosydnonimine.

Table II.

Significantly downregulated genes in hypertrophic chondrocytes treated with 3-morpholinosydnonimine.

Table II.

Significantly downregulated genes in hypertrophic chondrocytes treated with 3-morpholinosydnonimine.

No.IDSymbolDescriptionFold regulation
  1NM_013465Ahsg α-2-HS-glycoprotein−6.19
  2NM_007553BMP2Bone morphogenetic protein 2−6.11
  3NM_173404BMP3Bone morphogenetic protein 3−8.52
  4NM_009758BMPR1aBone morphogenetic protein receptor, type 1A−4.17
  5NM_007560BMPR1bBone morphogenetic protein receptor, type 1B−7.16
  6NM_007643Cd36Cluster of differentiation 36 antigen−7.26
  7NM_009866Cdh11Cadherin 11−3.05
  8NM_009893ChrdChordin−5.28
  9NM_009925Col10a1Collagen, type X, α 1−4.03
10NM_016685CompCartilage oligomeric matrix protein−5.17
11NM_007802CtskCathepsin K−3.14
12NM_010197Fgf1Fibroblast growth factor 1−7.89
13NM_010206Fgfr1Fibroblast growth factor receptor 1−11.16
14NM_010207Fgfr2Fibroblast growth factor receptor 2−3.34
15NM_010228Flt1FMS-like tyrosine kinase 1−7.41
16NM_010512Igf1Insulin-like growth factor 1−3.48
17NM_008396Itga2Integrin α 2−4.76
18NM_008402ItgavIntegrin α V−7.52
19NM_010578Itgb1Integrin β 1 (fibronectin receptor β)−4.20
20NM_019471MMP10Matrix metalloproteinase 10−45.25
21NM_008610MMP2Matrix metalloproteinase 2−3.66
22NM_013599MMP9Matrix metalloproteinase 9−4.66
23NM_008689Nfkb1Nuclear factor of κ light polypeptide gene enhancer in B cells 1, p105−3.66
24NM_011077PhexPhosphate regulating gene with homologies to endopeptidases on the X chromosome−4.44
25NM_008539Smad1Mothers against decapentaplegic homolog 1 (Drosophila)−3.89
26NM_010754Smad2Mothers against decapentaplegic homolog 2 (Drosophila)−3.10
27NM_016769Smad3Mothers against decapentaplegic homolog 3 (Drosophila)−4.63
28NM_008540Smad4Mothers against decapentaplegic homolog 4 (Drosophila)−4.17
29NM_009367Tgfb2Transforming growth factor, β 2−5.31
30NM_009370Tgfbr1Transforming growth factor, β receptor I−16.00
31NM_009371Tgfbr2Transforming growth factor, β receptor II−5.70
32NM_013693TnfTumor necrosis factor−9.19
33NM_011613Tnfsf11Tumor necrosis factor (ligand) superfamily, member 11−4.14
34NM_011693Vcam1Vascular cell adhesion molecule 1−6.68

[i] Differentially expressed genes that were deemed differentially expressed by 3-fold or greater are presented.

Table III.

Significantly upregulated genes in hypertrophic chondrocytes treated with 3-morpholinosydnonimine.

Table III.

Significantly upregulated genes in hypertrophic chondrocytes treated with 3-morpholinosydnonimine.

No.IDSymbolDescriptionFold regulation
  1NM_007542BgnBiglycan5.82
  2NM_007555Bmp5Bone morphogenetic protein 57.26
  3NM_007743Col1a2Collagen, type I, α 24.08
  4NM_031163Col2a1Collagen, type II, α 17.26
  5NM_010544IhhIndian hedgehog3.32
  6NM_024449SostSclerostin4.26

[i] Differentially expressed genes that were deemed differentially expressed by 3-fold or greater are presented.

mRNA levels of 9 associated genes in experimental hypertrophic chondrocytes

To further confirm these PCR array data, 8 differentially expressed genes (Smad1-4, Col X, MMP10, Vcam1, and Col2a1) were validated in hypertrophic chondrocytes treated with 0 or 3 mM SIN-1. The RT-qPCR results demonstrated that 3 mM SIN-1 induced Smad1-4, Col X, MMP10, and Vcam1 downregulation and Col2a1 upregulation (Fig. 4). These results are consistent with and support the reliability of the PCR array findings.

Figure 4.

A histogram presenting mRNA expression levels of 8 selected genes in hypertrophic chondrocytes treated with 3-morpholinosydnonimine. GAPDH served as an internal control. Data are expressed as the mean ± standard deviation. PCR, polymerase chain reaction; RT-qPCR, reverse transcription-quantitative PCR; Smad, mothers against decapentaplegic homolog; Col X, type X collagen; MMP, matrix metalloproteinase; Vcam1, vascular cell adhesion molecule 1; Col 2a, collagen, type II, α.

Transforming growth factor (TGF)-β signaling cascades are the key pathways in hypertrophic chondrocytes treated with SIN-1

The results of PPI analysis demonstrated that there were four clusters in the PPI network (Fig. 5). The most important cluster included TGF-βs [TGF-β2 and TGF-β receptors (TGF-βr1 and−2)], bone morphogenic proteins (BMPs; BMP2,−3, and−5, and BMP receptors 1A and 1B) and mothers against decapentaplegic homologs (Smads; Smad3 and−4), which were beneficial for the elucidation of biological systems participating in the oxidative stress in hypertrophic chondrocytes. KEGG pathway enrichment results (Table IV) also demonstrated that TGF-β signaling cascades were the key pathways in hypertrophic chondrocytes treated with SIN-1, indicating that TGF-β/Smad signaling and BMP/Smad signaling were potential pathways associated with the above process. Once again, the gene-pathway network analysis yielded results similar to the above findings (Fig. 6).

Figure 5.

Network of protein-protein interactions for differentially expressed genes.

Figure 6.

Analysis of signaling pathways for differentially expressed genes.

Table IV.

Results on top five GO functions and KEGG pathway enrichment analysis of differentially expressed genes.

Table IV.

Results on top five GO functions and KEGG pathway enrichment analysis of differentially expressed genes.

Function and pathwayIDDescriptionCount in gene setFalse discovery rate
Biological processGO: 0001501Skeletal system development20 2.03×10−20
(GO)GO: 0009888Tissue development27 3.18×10−19
GO: 0001503Ossification16 2.27×10−18
GO: 0071495Cellular response to endogenous stimulus21 4.40×10−18
GO: 0071363Cellular response to growth factor stimulus17 5.39×10−18
Molecular functionGO: 0046332Mothers against decapentaplegic homolog binding10 5.84×10−14
(GO)GO: 0005515Protein binding32 4.67×10−13
GO: 0005160Transforming growth factor β receptor binding  8 1.02×10−11
GO: 0005126Cytokine receptor binding10 1.09×10−9
GO: 0019838Growth factor binding  8 1.58×10−9
Cellular componentGO: 0005615Extracellular space20 2.99×10−13
(GO)GO: 0044421Extracellular region part26 2.01×10−10
GO: 0005576Extracellular region27 3.32×10−10
GO: 0031012Extracellular matrix12 3.32×10−10
GO: 0005578Proteinaceous extracellular matrix11 1.35×10−9
KEGG pathways4350Transforming growth factor-β signaling pathway13 1.50×10−20
5200Pathways in cancer17 2.04×10−19
4390Hippo signaling pathway12 1.87×10−15
5205Proteoglycans in cancer12 1.53×10−13
4151Phosphoinositide 3-kinase-protein kinase B signaling pathway12 2.49×10−11

[i] GO, gene ontology; KEGG, Kyoto Encyclopedia of Genes and Genomes.

Discussion

The oxidative stress in hypertrophic chondrocytes is regulated by multiple intricate signal transduction pathways. The crosstalk among these signals has a fine balance in normal hypertrophic chondrocytes (16). Free radicals, called ‘the second messengers,’ may adjust the expression of relevant target proteins through nuclear transcription factors and regulate chondrocyte growth, differentiation, and maturation (17,18). In the normal physiological state, there is a dynamic balance between the free-radical-generating system and the scavenging system (19). Once excessive free radicals are produced or ingested, the original balanced state is disrupted and then causes cell damage (20). On the basis of previous research findings that implicated oxidative damage in the hypertrophy of chondrocytes in OA and KBD (14,21), the present study was designed to profile altered gene expression of the intricate signaling network associated with oxidative stress to mimic cellular responses within an articular joint affected by OA or KBD.

In the present study, the TGF-β (TGF-β1, −2 and -3, and TGF-βr1,−2 and -3) and Smad (Smad1-5) families of genes. A total of 7 genes were downregulated in hypertrophic chondrocytes following treatment with SIN-1, including TGF-β2, TGF-βr1, TGF-βr2, Smad1, Smad2, Smad3, and Smad4. Smads are the downregulated gene targets of the TGF-β family of genes. TGF-β transduces signals from the cell membrane to the nucleus via its receptors and Smad proteins (22). In a European patient cohort, a single nucleotide polymorphism in the intron region of the Smad3 gene has been demonstrated to be associated with hip and knee OA (23). TGF-β may stimulate chondrocyte matrix production and has been demonstrated to promote cartilage repair to alleviate OA (24). TGF-β/Smad3 signals could repress chondrocyte hypertrophic differentiation, and are essential for maintaining articular cartilage (22). TGF-β3 and phosphorylated Smad2 levels were significantly reduced in two murine models of osteoarthritis, accompanied by a loss of proteoglycans (25). In analyses of PPIs, KEGG pathway enrichment and gene-pathway network in the present study, it was demonstrated that TGF-β signaling cascades were the key pathways in hypertrophic chondrocytes treated with SIN-1. In accordance with previous results, the present study indicates that these differentially expressed TGF-β- and Smad-family genes may provide novel approaches for drug targeting in OA and other osteoarthroses.

BMPs are members of the pleiotropic TGF-β superfamily and are key regulators of skeletal development, osteogenesis and bone healing (26,27). BMP signals are mediated by type I and type II receptors (BMPR1a, BMPR1b and BMPR2) (26). BMP signal binding to BMPRs is translocated to the nucleus via Smad signaling (mainly via Smad1,−5 and−8) (28). BMP2 significantly promotes bone formation and stimulates osteoblast differentiation of C2C12 cells in conjunction with specific levels of static stretching force (29). In addition, it has been confirmed that BMP2 stimulates chondrocyte hypertrophy during chondrogenesis of progenitor ATDC5 cells (30), and in the present study it was also demonstrated that BMP2 was downregulated in hypertrophic chondrocytes treated with SIN-1. Therefore, BMP2 is important for the progression of hypertrophy. BMP3 accelerates the differentiation of human mesenchymal stem cells (31), and is associated with rabbit articular cartilage repair (32). The BMP5 gene contains an ‘injury response’ control region, which is activated by multiple types of injury in adult animals (33). In the present study, it was demonstrated that BMP2, BMP3, BMPR1a and BMPR1b were downregulated in hypertrophic chondrocytes treated with SIN-1 and BMP5 was upregulated. Combined with the above discussion on Smads, these data suggest that the BMP/SMAD pathway may also take part in an oxidative stress reaction. The increased expression of BMP5 was probably the result of the ‘injury response’ to oxidative stress.

Matrix metalloproteinases (MMPs) serve important roles in ECM remodeling and degradation. MMPs and their inhibitors (TIMPs) are believed to be associated with the mechanisms underlying KBD (34). In the present study, it was demonstrated that the mRNA expression levels of MMP2, -9 and -10 were downregulated in hypertrophic chondrocytes following treatment with SIN-1. MMP2 and 9 are known to participate in significant degradation of collagen in the muscle of fish (35). In the present study, the mRNA expression levels of Col I and Col II were both increased; thus it was speculated that this increase was caused by downregulation of MMPs. Nevertheless, the mRNA expression level of Col X, which is mainly expressed in hypertrophic chondrocytes, was decreased in the present study. This phenomenon may be directly caused by oxidative stress induced by SIN-1. Combined with the literature, the present data suggest that the alteration of Mmp2,−9, and -10 genes led to a change in ECM, which may further affect the cell differentiation.

Integrins are the major family of ECM receptors, which have a vital role in cell-ECM interactions (36). Integrins are transmembrane heterodimeric glycoproteins consisting of α and β subunits, combining functions of cell adhesion and bidirectional signal transduction (5). In the present study, levels of α2, αv, and β1 integrins were decreased in hypertrophic chondrocytes following treatment with SIN-1. It has been previously reported that the expression of α2 and α5 integrins increased at later stages of OA in rats, and these levels were associated with the severity of OA (37). Additionally α1, α5β1, and αvβ5 integrins have been demonstrated to mediate human chondrocyte adhesion to cartilage (38). Increased expression of Indian hedgehog (Ihh) and sclerostin was also observed, as was decreased expression of Col X. Ihh is expressed in prehypertrophic chondrocytes on growth plates (39), whereas Col X was mainly expressed in hypertrophic chondrocytes. Sclerostin is a novel BMP antagonist, which competes with type I and type II BMP receptors (40). Thus, SIN-1 may first increase sclerostin and further decrease BMP signaling.

In conclusion, the present study indicated that oxidative stress produced by NO donor induced death of hypertrophic chondrocytes is probably mediated by TGF-β/Smad or BMP/Smad pathways, and dysfunctional pathways may then induce abnormal expression of MMPs and collagens. The present results may provide several novel clues to the molecular mechanisms underlying OA and KBD, which may help to find novel diagnostic and therapeutic targets for these debilitating diseases.

There were, however, certain limitations in the present study: i) KBD does not immediately lead to death, and harvesting the cartilage tissue of patients with KBD is traumatic for patients, so it was very difficult to obtain fresh human cartilage; and ii) there are no functional verification experiments to be conducted. Therefore, further research is required.

Acknowledgements

The authors would like to thank Professor Rongqiang zhang from Shaanxi University of Chinese Medicine (Xi'an, China) for guidance in writing the manuscript.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81273006 and 81573102) and the Shaanxi Natural Science Research Project (grant no. 2017JM8122).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

JC and YH conceived and designed experiments; YH and JC performed the experiments; YH, WY, MZ, YZ, DZ, ZJ, TM, JS and MS analyzed the data; TM, JS and MS also contributed reagents/materials/analysis tools; YH wrote the manuscript; and JC revised it.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Tsolis KC, Bei ES, Papathanasiou I, Kostopoulou F, Gkretsi V, Kalantzaki K, Malizos K, Zervakis M, Tsezou A and Economou A: Comparative proteomic analysis of hypertrophic chondrocytes in osteoarthritis. Clin Proteomics. 12:122015. View Article : Google Scholar : PubMed/NCBI

2 

Moreno-Reyes R, Suetens C, Mathieu F, Begaux F, Zhu D, Rivera MT, Boelaert M, Nève J, Perlmutter N and Vanderpas J: Kashin-Beck osteoarthropathy in rural Tibet in relation to selenium and iodine status. N Engl J Med. 339:1112–1120. 1998. View Article : Google Scholar : PubMed/NCBI

3 

Zhang F, Guo X, Duan C, Wu S, Yu H and Lammi M: Identification of differentially expressed genes and pathways between primary osteoarthritis and endemic osteoarthritis (Kashin-Beck disease). Scand J Rheumatol. 42:71–79. 2013. View Article : Google Scholar : PubMed/NCBI

4 

Gao ZQ, Guo X, Duan C, Ma W, Xu P, Wang W and Chen JC: Altered aggrecan synthesis and collagen expression profiles in chondrocytes from patients with Kashin-Beck disease and osteoarthritis. J Int Med Res. 40:1325–1334. 2012. View Article : Google Scholar : PubMed/NCBI

5 

Kim SJ, Kim EJ, Kim YH, Hahn SB and Lee JW: The modulation of integrin expression by the extracellular matrix in articular chondrocytes. Yonsei Med J. 44:493–501. 2003. View Article : Google Scholar : PubMed/NCBI

6 

Peterson JT: The importance of estimating the therapeutic index in the development of matrix metalloproteinase inhibitors. Cardiovasc Res. 69:677–687. 2006. View Article : Google Scholar : PubMed/NCBI

7 

Schulze-Tanzil G, de Souza P, Merker HJ and Shakibaei M: Co-localization of integrins and matrix metalloproteinases in the extracellular matrix of chondrocyte cultures. Histol Histopathol. 16:1081–1089. 2001.PubMed/NCBI

8 

Pal S, Ganguly KK, Moulik S and Chatterjee A: Modulation of MMPs by cell surface integrin receptor α5β1. Anticancer Agents Med Chem Sep. 12:726–732. 2012. View Article : Google Scholar

9 

van der Kraan PM and van den Berg WB: Chondrocyte hypertrophy and osteoarthritis: Role in initiation and progression of cartilage degeneration? Osteoarthritis Cartilage. 20:223–232. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Chen AF, Davies CM, De Lin M and Fermor B: Oxidative DNA damage in osteoarthritic porcine articular cartilage. J Cell Physiol. 217:828–833. 2008. View Article : Google Scholar : PubMed/NCBI

11 

Wang W, Wei S, Luo M, Yu B, Cao J, Yang Z, Wang Z, Goldring MB and Chen J: Oxidative stress and status of antioxidant enzymes in children with Kashine-Beck disease. Osteoarthritis Cartilage. 21:1781–1789. 2013. View Article : Google Scholar : PubMed/NCBI

12 

Konishi K, Watanabe N and Arai T: SIN-1 cytotoxicity to PC12 cells is mediated by thiol-sensitive short-lived substances generated through SIN-1 decomposition in culture medium. Nitric Oxide. 20:270–278. 2009. View Article : Google Scholar : PubMed/NCBI

13 

Tian J, Yan J, Wang W, Zhong N, Tian L, Sun J, Min Z, Ma J and Lu S: T-2 toxin enhances catabolic activity of hypertrophic chondrocytes through ROS-NF-jB-HIF-2α pathway. Toxicol In Vitro. 26:1106–1113. 2012. View Article : Google Scholar : PubMed/NCBI

14 

Hunter DJ and Felson DT: Osteoarthritis. BMJ. 332:639–642. 2006. View Article : Google Scholar : PubMed/NCBI

15 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

16 

Ueno T, Yamada M, Sugita Y and Ogawa T: N-Acetyl cysteine protects TMJ chondrocytes from oxidative stress. J Dent Res. 90:353–359. 2011. View Article : Google Scholar : PubMed/NCBI

17 

Hinoi E, Takarada T, Fujimori S, Wang L, Iemata M, Uno K and Yoneda Y: Nuclear factor E2 p45-related factor 2 negatively regulates chondrogenesis. Bone. 40:337–344. 2007. View Article : Google Scholar : PubMed/NCBI

18 

Morita K, Miyamoto T, Fujita N, Kubota Y, Ito K, Takubo K, Miyamoto K, Ninomiya K, Suzuki T, Iwasaki R, et al: Reactive oxygen species induce chondrocyte hypertrophy in endochondral ossification. J Exp Med. 204:1613–1623. 2007. View Article : Google Scholar : PubMed/NCBI

19 

Hoshida S, Kuzuya T, Yamashita N, Oe H, Fuji H, Hori M, Tada M and Kamada T: Brief myocardial ischemia affects free radical generating and scavenging systems in dogs. Heart Vessels. 8:115–120. 1993. View Article : Google Scholar : PubMed/NCBI

20 

Del Carlo M Jr and Loeser RF: Nitric oxide-mediated chondrocyte cell death requires the generation of additional reactive oxygen species. Arthritis Rheum. 46:394–403. 2002. View Article : Google Scholar : PubMed/NCBI

21 

Guo X, Zuo H, Cao CX, Zhang Y, Geng D, Zhang ZT, Zhang YG, von der Mark K and von der Mark H: Abnormal expression of Col X, PTHrP, TGF-beta, bFGF, and VEGF in cartilage with Kashin-Beck disease. J Bone Miner Metab. 24:319–328. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Yang X, Chen L, Xu X, Li C, Huang C and Deng CX: TGF-beta/Smad3 signals repress chondrocyte hypertrophic differentiation and are required for maintaining articular cartilage. J Cell Biol. 153:35–46. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Valdes AM, Spector TD, Tamm A, Kisand K, Doherty SA, Dennison EM, Mangino M, Tamm A, Kerna I, Hart DJ, et al: Genetic variation in the SMAD3 gene is associated with hip and knee osteoarthritis. Arthritis Rheum. 62:2347–2352. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Blom AB, van der Kraan PM and van den Berg WB: Cytokine targeting in osteoarthritis. Curr Drug Targets. 8:283–292. 2007. View Article : Google Scholar : PubMed/NCBI

25 

Davidson Blaney EN, Vitters EL, van der Kraan PM and van den Berg WB: Expression of transforming growth factor-beta (TGFbeta) and the TGFbeta signalling molecule SMAD-2P in spontaneous and instability-induced osteoarthritis: Role in cartilage degradation, chondrogenesis and osteophyte formation. Ann Rheum Dis. 65:1414–1421. 2006. View Article : Google Scholar : PubMed/NCBI

26 

Bragdon B, Moseychuk O, Saldanha S, King D, Julian J and Nohe A: Bone morphogenetic proteins: A critical review. Cell Signal. 23:609–620. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Long J, Li P, Du HM, Liu L, Zheng XH, Lin YF, Wang H, Jing W, Tang W, Chen WH, et al: Effects of bone morphogenetic protein 2 gene therapy on new bone formation during mandibular distraction osteogenesis at rapid rate in rabbits. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 112:50–57. 2011. View Article : Google Scholar : PubMed/NCBI

28 

Retting KN, Song B, Yoon BS and Lyons KM: BMP canonical Smad signaling through Smad-1 and Smad-5 is required for endochondral bone formation. Development. 136:1093–1104. 2009. View Article : Google Scholar : PubMed/NCBI

29 

Kim IS, Song YM, Cho TH, Kim JY, Weber FE and Hwang SJ: Synergistic action of static stretching and BMP-2 stimulation in the osteoblast differentiation of C2C12 myoblasts. J Biomech. 42:2721–2727. 2009. View Article : Google Scholar : PubMed/NCBI

30 

Caron MM, Emans PJ, Cremers A, Surtel DA, Coolsen MM, van Rhijn LW and Welting TJ: Hypertrophic differentiation during chondrogenic differentiation of progenitor cells is stimulated by BMP-2 but suppressed by BMP-7. Osteoarthritis Cartilage. 21:604–613. 2013. View Article : Google Scholar : PubMed/NCBI

31 

Zhou X, Tao Y, Liang C, Zhang Y, Li H and Chen Q: BMP3 alone and together with TGF-β promote the differentiation of human mesenchymal stem cells into a nucleus pulposus-like phenotype. Int J Mol Sci. 16:20344–20359. 2015. View Article : Google Scholar : PubMed/NCBI

32 

Zhang Z, Yang W, Cao Y, Shi Y, Lei C, Du B, Li X and Zhang Q: The functions of BMP3 in rabbit articular cartilage repair. Int J Mol Sci. 16:25934–25946. 2015. View Article : Google Scholar : PubMed/NCBI

33 

Guenther CA, Wang Z, Li E, Tran MC, Logan CY, Nusse R, Pantalena-Filho L, Yang GP and Kingsley DM: A distinct regulatory region of the Bmp5 locus activates gene expression following adult bone fracture or soft tissue injury. Bone. 77:31–41. 2015. View Article : Google Scholar : PubMed/NCBI

34 

Chen J, Luo M, Wang W, Zhang Z, He Y, Duance VC, Hughes CE, Caterson B and Cao J: Altered proteolytic activity and expression of MMPs and aggrecanases and their inhibitors in Kashin-Beck disease. J Orthop Res. 33:47–55. 2015. View Article : Google Scholar : PubMed/NCBI

35 

Michelin AC, Justulin LA Jr, Delella FK, Padovani CR, Felisbino SL and Dal-Pai-Silva M: Differential MMP-2 and MMP-9 activity and collagen distribution in skeletal muscle from pacu (Piaractus mesopotamicus) during juvenile and adult growth phases. Anat Rec (Hoboken). 292:387–395. 2009. View Article : Google Scholar : PubMed/NCBI

36 

Tian J, Zhang FJ and Lei GH: Role of integrins and their ligands in osteoarthritic cartilage. Rheumatol Int. 35:787–798. 2015. View Article : Google Scholar : PubMed/NCBI

37 

Almonte-Becerril M, Costell M and Kouri JB: Changes in the integrins expression are related with the osteoarthritis severity in an experimental animal model in rats. J Orthop Res. 32:1161–1166. 2014. View Article : Google Scholar : PubMed/NCBI

38 

Kurtis MS, Schmidt TA, Bugbee WD, Loeser RF and Sah RL: Integrin-mediated adhesion of human articular chondrocytes to cartilage. Arthritis Rheum. 48:110–118. 2003. View Article : Google Scholar : PubMed/NCBI

39 

Vortkamp A, Lee K, Lanske B, Segre GV, Kronenberg HM and Tabin CJ: Regulation of rate of cartilage differentiation by Indian hedgehog and PTH-related protein. Science. 273:613–622. 1996. View Article : Google Scholar : PubMed/NCBI

40 

Winkler DG, Sutherland MK, Geoghegan JC, Yu C, Hayes T, Skonier JE, Shpektor D, Jonas M, Kovacevich BR, Staehling-Hampton K, et al: Osteocyte control of bone formation via sclerostin, a novel BMP antagonist. EMBO J. 22:6267–6276. 2003. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
He Y, Yao W, Zhang M, Zhang Y, Zhang D, Jiang Z, Ma T, Sun J, Shao M, Chen J, Chen J, et al: Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1. Exp Ther Med 16: 609-618, 2018.
APA
He, Y., Yao, W., Zhang, M., Zhang, Y., Zhang, D., Jiang, Z. ... Chen, J. (2018). Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1. Experimental and Therapeutic Medicine, 16, 609-618. https://doi.org/10.3892/etm.2018.6261
MLA
He, Y., Yao, W., Zhang, M., Zhang, Y., Zhang, D., Jiang, Z., Ma, T., Sun, J., Shao, M., Chen, J."Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1". Experimental and Therapeutic Medicine 16.2 (2018): 609-618.
Chicago
He, Y., Yao, W., Zhang, M., Zhang, Y., Zhang, D., Jiang, Z., Ma, T., Sun, J., Shao, M., Chen, J."Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1". Experimental and Therapeutic Medicine 16, no. 2 (2018): 609-618. https://doi.org/10.3892/etm.2018.6261
Copy and paste a formatted citation
x
Spandidos Publications style
He Y, Yao W, Zhang M, Zhang Y, Zhang D, Jiang Z, Ma T, Sun J, Shao M, Chen J, Chen J, et al: Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1. Exp Ther Med 16: 609-618, 2018.
APA
He, Y., Yao, W., Zhang, M., Zhang, Y., Zhang, D., Jiang, Z. ... Chen, J. (2018). Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1. Experimental and Therapeutic Medicine, 16, 609-618. https://doi.org/10.3892/etm.2018.6261
MLA
He, Y., Yao, W., Zhang, M., Zhang, Y., Zhang, D., Jiang, Z., Ma, T., Sun, J., Shao, M., Chen, J."Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1". Experimental and Therapeutic Medicine 16.2 (2018): 609-618.
Chicago
He, Y., Yao, W., Zhang, M., Zhang, Y., Zhang, D., Jiang, Z., Ma, T., Sun, J., Shao, M., Chen, J."Changes in osteogenic gene expression in hypertrophic chondrocytes induced by SIN‑1". Experimental and Therapeutic Medicine 16, no. 2 (2018): 609-618. https://doi.org/10.3892/etm.2018.6261
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team