Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain

  • Authors:
    • Yu Zhao
    • Zhanyun Yang
  • View Affiliations / Copyright

    Affiliations: Department of Anesthesiology, Jining No. 1 People's Hospital, Jining, Shandong 272011, P.R. China
  • Pages: 3082-3088
    |
    Published online on: July 23, 2018
       https://doi.org/10.3892/etm.2018.6512
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Neuropathic pain (NP) is a common clinical chronic pain with very complex mechanisms. This study explored the function of activated Wnt signaling pathway in NP. A rat model of chronic constriction injury (CCI) was established. Different doses of IWP-2, a Wnt signal inhibitor, were intrathecally injected to observe the behavior indicators at different time-points, including the pain induced by mechanical stimulation and thermal stimulation. The mRNA and protein levels of Wnt-3a, Frizzled 4 and β-catenin in lumbar (L) 4-6 dorsal root ganglion (DRG) of rats in each group, as well as synaptic plasticity-related molecules in DRG region of rats were detected by RT-PCR and western blotting, respectively. Compared with Sham group and Naive group, paw withdrawal thermal latency and paw withdrawal mechanical threshold were significantly decreased after CCI, while synaptic plasticity was increased (P<0.05). Besides, activation of Wnt/β-catenin signaling pathway was observed in rats with CCI. We found that intrathecal injection of IWP-2 effectively relieved the pain behavior and reduced the synaptic plasticity in rats with neuropathic pain after CCI, suggesting that the inactivated Wnt/β-catenin signaling pathway might be the major mechanism responsible for this effect. Our data demonstrated that intrathecal injection of IWP-2 ameliorated neuropathic pain in CCI rats by inhibiting the Wnt/β-catenin pathway.

Introduction

Neuropathic pain (NP) is caused by primary injury or dysfunction of the nervous system with very complex pathogenesis. However, no effective cure has been developed so far (1,2). NP is currently considered as one of the pain syndromes that is most difficult to cure. Millions of patients worldwide are plagued by NP, which brings great trouble to their daily activities (3–5). It has now been clarified that NP is closely related to the accumulation of ion channels in impaired sites, sympathetic sprouting, Aβ fiber sprouting, central sensitization and depressive effects (6–9). In addition, long-term NP is reported to be associated with altered genes. With further study of glial cells, SP, vasoactive intestinal peptide, purinergic receptor and CGRP, the pathogenesis of NP has been explored in recent years (10,11). NP is a common clinical disease, but there are still many problems such as poor efficacy, poor tolerance and adverse reactions (4,12).

Peripheral nerve injury induces NP through a series of complex molecular cascade reactions in the dorsal root ganglia and spinal cord, including tumor necrosis factor (TNF-α), interleukin-6 (IL-6) and nuclear factor-κB (NF-κB) (13,14). The intracellular second messenger cyclic adenosine monophosphate (cAMP)-dependent protein kinase A (PKA) and cyclic guanosine monophosphate (cGMP)-dependent protein kinase G (PKG) mediate hyperalgesia and high excitability of compressed neurons in CCD rats (15). In addition, a variety of ion channels are also involved in the delivery of noxious stimuli of dorsal root ganglion (DRG) neurons following sustained compression, such as voltage-gated Na+ and K+ channels, hyperpolarization-activated cation channels, and transient receptor potential vanilloid 4 (TRPV4) (16–18). Recent studies have identified several new signaling pathways associated with neuropathic pain, such as mitogen-activated protein kinase family pathway (MAPK), cytokine and neurotrophic growth factor family pathways, TGF-β signaling pathway and 5-HT2A receptor signaling pathway (19–24).

Wnt signaling pathway is greatly involved in embryonic development and tissue homeostasis, and aberrant Wnt signaling is often related to many serious diseases, including cancer, osteoporosis and other degenerative diseases (25). It is reported that Wnt signaling pathway plays a variety of roles in the development of the nervous system, and activation of downstream signaling is associated with synapse formation, structural and functional regulation (26). Wnt-3a is shown to increase the number of presynaptic synapses in the hippocampal neurons, induce the aggregation of Bassoon component in active region and the release of synaptic vesicles, and increase frequency of excitatory synaptic currents (27,28). The activation of multiple Wnt signals can regulate the plasticity of synapses.

Because of the extremely complicated factors involved in the formation and maintenance of NP, it is important to identify the exact mechanism of NP and seek safe and effective treatment drugs.

Materials and methods

Animal

A total of 72 male Sprague-Dawley (SD) rats weighing 180–200 g at specific pathogen-free (SPF) level were assigned into the control group (Naïve group, N=12), sham group (Sham group, N=30) and treatment group (N=30). The rats were housed in a temperature controlled room (21±2°C) on a 12-h light/dark cycle (lights on at 06:00). All rats had free access to water and food. For the sham group, only the bilateral sciatic nerve was exposed without ligation, while SD rats in the treatment group were subjected to sciatic nerve compression injury to establish the rat chronic constriction injury (CCI) model. This study was approved by the Animal Ethics Committee of Jining No. 1 People's Hospital Animal Center (Jining, China).

Animal behavior assessment

i) Determination of mechanical stimulation-induced pain. All rats were placed in specially customized cages with barbed wire at the bottom. Electronic von Frey measurement was performed to record the minimum stimulus intensity of raising foot reflex in rats, and the measurement interval was 3–4 min. The average value of 3 parallel measurements was recorded as the paw withdrawal mechanical threshold (PWMT).

ii) Determination of heat stimulation-induced pain. The BME-410A thermal radiation pain stimulator was used to irradiate the left and right foot of rats. The irradiation was stopped when rats developed rapid contraction of foot, foot lifting or licking foot reaction. The duration of irradiation was taken as the paw withdrawal thermal latency (PWTL), with an interval over 5 min for each measurement. The average value of 3 parallel measurements was taken as the PWTL.

iii) Determination of cold stimulation-induced pain. The number of positive appearance of each rat after acetone stimulation was recorded as the total number of withdrawal according to the method proposed by Datta et al (29).

Intrathecal catheter and administration

The rats were anesthetized by intraperitoneal injection of sodium pentobarbital at a dose of 40–50 mg/kg. According to the intersection of the midline and the spine of the rat, a longitudinal incision ~1 cm was made in the L3-4 space. Then the skin and fascia were cut in sequence, and the muscle tissue was stripped to expose the spinous processes at L5-6. Muscle separation was performed to expose the spinous process at L5-6. Separation of the spinous process on both sides of the muscle and the spine between the initial zones was performed. The yellow zone was then exposed after the muscle and initial zone separated from spinous process. A 22G needle was punctured through the yellow belt and stopped when the rat flicked. Then, a 2 cm PE-10 catheter was gently placed into the inferior cranial subarachnoid space and secured when rats flicked or the cerebrospinal fluid slowly outflowed. Rats in the treatment group were intrathecally injected with 10 µl of IWP-2 (20 µg/20 µl) for 7 days after CCI. Rats in the naive group received intrathecal administration of saline for 7 days continuously.

Animal specimens collection

Rats were anesthetized by intraperitoneal injection of 0.4 g/kg of 10% chloral hydrate and then sacrificed by decapitation. Under aseptic procedures, the skin and muscle were dissected along the spinous process quickly, and the spinal spinous process was removed using scissors. The L4-6 DRG was immediately stored in −80°C after peeled off from the spinal cord. DRG tissues were collected from rats on the 1st, 3rd, 7th, 14th and 21st day after operation in sham and naive groups. For rats in treatment group, DRG tissues were harvested on the 14th day after operation.

RT-PCR

Total RNA was extracted from spinal cord by TRIzol lysate and RNA extraction kit (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). After reverse transcription into complementary Deoxyribose Nucleic Acid (cDNA), polymerase chain reaction was used to amplify the target gene to detect mRNA expression of each target gene in the spinal cord. The primers were designed by Primer Premier 5.0 (Premier Tech Co, Ltd., Quebec, Canada). Wnt-3a, forward, TGGAAACCCAAGCGTCGGAC and reverse, CTACCTGCGGAACGGATCCG; Frizzled 4, forward, ACTGGTAGATGCCGATGAGC and reverse, GCCGCAATGAATAAAGTTCC; β-catenin, forward. GGCTATACGGACGGGATCGGA and reverse, CCGATTACGTCTGGCTAGGCT; GAPDH, forward, CCCATCTATGAGGGTTACGC and reverse, TTTAATGTCACGCACGATTTC.

Western blotting

The radioimmunoprecipitation assay (RIPA) method (Beyotime Institute of Biotechnology, Shanghai, China) was used to lyse spinal cord tissue, followed by extraction of total proteins. Protein samples were then separated by conventional electrophoresis and incubated with rabbit polyclonal Wnt-3a antibody (dilution, 1:500; cat. no. ab28472), rabbit polyclonal Frizzled 4 antibody (dilution, 1:500; cat no. ab83042) and rabbit monoclonal β-catenin antibody (dilution, 1:500; cat. no. ab32572) overnight at 4°C. After being washed with phosphate-buffered saline (PBS), the membranes were incubated with secondary goat anti-rabbit (HRP) IgG antibody (dilution, 1:2,000; cat. no. ab6721) for 2 h at room temperature. All the antibodies were purchased from Abcam (Cambridge, MA, USA). Enhanced chemiluminescence imaging (ECL; Beyotime Institute of Biotechnology) was performed, and the integral optical density (IOD) value of each band was determined by Gel imaging analysis system. β-actin was taken as the internal reference.

Statistical analysis

Statistical product and service solutions (SPSS) 22.0 software (IBM Corp., Armonk, NY, USA) was used for data analysis. GraphPad Prism 5.0 (Version X; GraphPad Software, Inc., La Jolla, CA, USA) was introduced to edit images. Survival analysis was performed using Kaplan-Meier survival curves. Independent-sample t-test was performed to analyze the difference between the two groups and Chi-square test was performed to analyze the classification data. All data were presented as mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.

Results

Changes of behavior and neuronal synaptic plasticity in rats after CCI

There were no statistically significant differences in the threshold values of mechanical pain threshold, thermal stimulus injury threshold and cold stimulus injury threshold between the hind feet of each rat before and after operation (Fig. 1). Therefore, the average value of left and right foot was taken for analysis. No significant difference was observed between the naive and sham groups (P>0.05). In the CCI group, hind paw mechanical pain threshold and thermal stimulus injury threshold of the CCI group started to decrease on the 7th day compared to the naive and sham groups (P<0.05), which reached the lowest value on the 14th day after operation (Fig. 1A and B). The positive reaction number of cold stimulation threshold in the CCI group was significantly higher than that in the naive and sham groups since the 7th day after operation (P<0.05; Fig. 1C).

Figure 1.

Changes of behavior and neuronal synaptic plasticity in rats after CCI. (A-C) Changes of mechanical threshold, thermal stimulation threshold and cold stimulation threshold in a time-dependent manner (n=8). (D and E) The effect of Wnt-3a inhibitor on synaptic plasticity was detected by western blotting (n=3) (*P<0.05). CCI, chronic constriction injury.

In order to observe the effect of CCI on the synaptic plasticity of spinal dorsal horn neurons, the expression of synaptic plasticity-related molecules was detected by western blotting. The phosphorylation levels of synaptic plasticity of Ca2+/calmodulin-dependent kinase II (CaMK II), glutamatergic receptor NR2B, CREB, PKC and tyrosine kinase Src were significantly altered on the 7th day after operation compared to the Sham group (P<0.05; Fig. 1D), suggesting that CCI leads to the alteration of the neuronal plasticity of spinal dorsal horn, sensitization of the central nervous system, thus eventually resulting in the decrease of mechanical pain sensitivity threshold and cold pain sensitivity threshold in the CCI rats.

Wnt signaling pathway was activated in the CCI model

The transcription levels of Wnt-3a, Frizzled 4 and β-catenin at different time-points in the control, sham and CCI groups were detected by RT-PCR. The results demonstrated that compared with the control group, the expression of Wnt-3a, Frizzled 4 and β-catenin in the sham group are not significantly altered, while the expression of Wnt-3a in the CCI group was significantly increased on the 1st day after operation and remained at a high level for 21 days (P<0.05; Fig. 2A). Frizzled 4 was significantly higher in the CCI group during the 21-day observation period than that in the control and sham groups (Fig. 2B). The mRNA level of β-catenin was also markedly increased within 4 weeks after operation (P<0.01; Fig. 2C).

Figure 2.

Wnt signaling pathway was activated in the CCI model. (A-C) The mRNA levels of Wnt-3a, Frizzled 4 and β-catenin in the spinal dorsal horn of Naive, Sham and treatment group were detected by RT-PCR (n=3). (D and E) Western blotting was performed to detect and quantify the expression of Wnt-3a, Frizzled 4 and β-catenin in Naive, Sham and treatment group (n=3) (*P<0.05). CCI, chronic constriction injury.

Western blotting was performed to detect the protein levels of Wnt-3a, Frizzled 4 and β-catenin. Consistent with the mRNA and protein expression of Wnt-3a was significantly increased within 7 days after injury. Moreover, the protein levels of Frizzled 4 and β-catenin significantly increased from the first day after injury and remained at high levels after 14 days (P<0.05; Fig. 2D and E).

Intrathecal injection of IWP-2 relieved CCI-induced neuropathic pain and reduced neuronal synaptic plasticity

No statistically significant differences were shown in baseline values of the mechanical pain threshold, thermal stimulus injury threshold and cold stimulus injury threshold between the treatment and control groups at each time-point (P>0.05; Fig. 3A and C). The mechanical stimulation of rats in the treatment group exerted statistical significance on the 3rd day after operation compared with those in the control group (Fig. 3A), and thermal stimulation threshold and cold stimulation threshold exhibited notable difference on the 5th day (P<0.05; Fig. 3B and C).

Figure 3.

Intrathecal injection of IWP-2 relieved CCI-induced neuropathic pain and reduced neuronal synaptic plasticity. In total, 18 SD rats were randomly divided into treatment group, DMSO group and NC group. Bilateral sciatic nerve ligation was performed in the first two groups, and Wnt-3a inhibitor IWP-2 was intrathecally administered in treatment group. Rats in DMSO group were intrathecally injected with the isodose DMSO. Only intrathecal catheterization was performed in rats of NC group. Behavioral measurements were performed preoperatively, on the day of surgery, 3rd day and 5th day after IWP-2 treatment. (A-C) The changes of mechanical threshold, thermal stimulation threshold and cold stimulation threshold over time were observed (n=6). (D and E) The phosphorylation levels of CaMK II, NR2B, CREB, PKC and Src in each treatment group was detected by western blotting (n=3) (*P<0.05). CCI, chronic constriction injury.

There were no significant differences in the phosphorylation levels of CaMK II, NR2B, CREB, PKC and Src between the treatment and control groups. However, the expression of CaMK II, NR2B, CREB, PKC and Src in the treatment group were significantly different on the 7th day after administration compared with those in the control group (Fig. 3D and E).

Intrathecal injection of IWP-2 inhibits the expression of Wnt-3a, Frizzled 4 and β-catenin

Compared with the rats injected with DMSO, the mRNA and protein levels of Wnt-3a, Frizzled 4 and β-catenin of rats in the treatment group were significantly increased after 7 days of administration (P<0.05). However, no changes of the mRNA and protein levels of Wnt-3a, Frizzled 4 and β-catenin were observed between the treatment and control groups (Fig. 4).

Figure 4.

Intrathecal injection of IWP-2 inhibits the expression of Wnt-3a, Frizzled 4 and β-catenin. (A-C) The effects of IWP-2 on the mRNA levels of Wnt-3a, Frizzled 4 and β-catenin (n=3) (*P<0.05). (D and E) The effects of IWP-2 on the protein levels of Wnt-3a, Frizzled 4 and β-catenin (n=3) (*P<0.05).

Discussion

NP is caused by nervous system injury or inflammation, accompanied by dysfunction and pain signal generation and conduction disorder. The main symptom of NP is hyperalgesia and spontaneous pain NP, which is independent of the persistence of tissue damage and noxious stimuli and considered as a nervous system disease (29–31). In recent years, studies have found that the nociceptive sensitization of the peripheral and spinal cord in the pathological state of neuropathic pain is characterized by abnormal neuronal discharge, abnormal activation of the sympathetic nervous system, dysfunction of the central down descending system, the activity modification of the ion channel and the activation of microglia.

Wnt is a secreted protein related to development of various biological processes, including proliferation, cell trafficking, polarization, and cell migration (32,33). The Wnt protein specifically binds to the N-terminal cysteine-rich region of the Frizzled (Fz) receptor and functions through the classical Wnt/β-catenin pathway as well as non-classical Wnt/PCP or Wnt/Ca pathway (2,34,35). Studies have shown that Wnt signaling abnormalities might be related to axonal injury after aplastic failure and the occurrence of certain mental diseases (36–38). In a chronic pain model induced by multiple sclerosis, Wnt expression was upregulated in the spinal dorsal horn, which caused disease progression (39). Zhang et al (40) found that aberrant activation of Wnt signaling pathway is correlated with the pathological process of NP in rodents. Wnt signaling pathway played a role in NP by activating the proinflammatory cytokines IL-18 and TNF-α, as well as glutamatergic receptor NR2B and its downstream Ca2+ signaling pathway.

So far, the CCI and spinal nerve ligation (SNL) models are still the two most commonly used animal models for the study of neuropathic chronic pain. The CCI model cleverly combines neuropathic and inflammatory pain. Precisely, ectopic discharges caused by axonal injury promotes the immune cells to release inflammatory mediators, which leads to the pain induced by peripheral and central sensitization. Our study found that CCI alters the behavioral parameters of neuropathic pain in rats. At the same time, the phosphorylation level of glutamate receptor (NMDR) subtype NR2B, a synaptic plasticity-related protein, was significantly increased, as well as the phosphorylation level of tyrosine kinase Src, which increased the receptor current. All of these indicated that CCI alters synaptic plasticity by regulating the phosphorylation and current of synaptic receptors, while increased synaptic plasticity results in central sensitization and reduced pain threshold. The expression of Wnt signaling molecules were also significantly increased after CCI treatment in our study, suggesting that the Wnt signaling pathway might be involved in CCI-induced neuropathic pain in rats.

Application of IWP-2, the Wnt-3a inhibitor, significantly increased PWMT in SD rats treated with IWP-2 compared to those in the control group, indicating that IWP-2 might become a new type of analgesic. We proposed the possible mechanism underlying the pain regulated by the Wnt signaling pathway. That was, the activation of Wnt signal molecules is involved in the production of neuropathic pain. Wnt-3a phosphorylated the β-catenin via the combination with Frizzled 4, a postsynaptic membrane-specific receptor, which resulted in the accumulation of β-catenin to the nucleus and then initiated the transcription of downstream target genes. The activation of target genes led to increased expression of glutamate receptors and the increased activity of their corresponding phosphorylase, resulting in synaptic plasticity. Increased synaptic plasticity resulted in central sensitization and reduced pain threshold.

In conclusion, our data showed that intrathecal injection of IWP-2 improved neuropathic pain by inhibiting the Wnt/β-catenin pathway in CCI rats, which may provide a new target for the treatment of neuropathic pain.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Authors' contributions

YZ and ZY designed the study, performed the experiments, established the animal models, collected and analyzed the data. YZ prepared the manuscript. Both authors have read and approved the final study.

Ethics approval and consent to participate

This study was approved by the Animal Ethics Committee of Jining No. 1 People's Hospital Animal Center (Jining, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Haanpää M, Attal N, Backonja M, Baron R, Bennett M, Bouhassira D, Cruccu G, Hansson P, Haythornthwaite JA, Iannetti GD, et al: NeuPSIG guidelines on neuropathic pain assessment. Pain. 152:14–27. 2011. View Article : Google Scholar : PubMed/NCBI

2 

Jensen TS, Baron R, Haanpää M, Kalso E, Loeser JD, Rice AS and Treede RD: A new definition of neuropathic pain. Pain. 152:2204–2205. 2011. View Article : Google Scholar : PubMed/NCBI

3 

Cruccu G and Truini A: A review of neuropathic pain: From guidelines to clinical practice. Pain Ther. 6 Suppl 1:35–42. 2017. View Article : Google Scholar : PubMed/NCBI

4 

Amato F, Duse G, Consoletti L, Lo Presti C, Firetto V, Ciliberto G, Parigi LA, Palmieri V and Mazza M: Efficacy and safety of 5% lidocaine-medicated plasters in localized pain with neuropathic and/or inflammatory characteristics: An observational, real-world study. Eur Rev Med Pharmacol Sci. 21:4228–4235. 2017.PubMed/NCBI

5 

O'Connor AB and Dworkin RH: Treatment of neuropathic pain: An overview of recent guidelines. Am J Med. 122 Suppl:S22–S32. 2009. View Article : Google Scholar

6 

Horváth G, Gölöncsér F, Csölle C, Király K, Andó RD, Baranyi M, Koványi B, Máté Z, Hoffmann K, Algaier I, et al: Central P2Y12 receptor blockade alleviates inflammatory and neuropathic pain and cytokine production in rodents. Neurobiol Dis. 70:162–178. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Ishikawa T, Miyagi M, Kamoda H, Orita S, Eguchi Y, Arai G, Suzuki M, Sakuma Y, Oikawa Y, Inoue G, et al: Differences between tumor necrosis factor-α receptors types 1 and 2 in the modulation of spinal glial cell activation and mechanical allodynia in a rat sciatic nerve injury model. Spine. 38:11–16. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Lefèvre Y, Amadio A, Vincent P, Descheemaeker A, Oliet SH, Dallel R and Voisin DL: Neuropathic pain depends upon D-serine co-activation of spinal NMDA receptors in rats. Neurosci Lett. 603:42–47. 2015. View Article : Google Scholar : PubMed/NCBI

9 

Tiwari V, Guan Y and Raja SN: Modulating the delicate glial-neuronal interactions in neuropathic pain: Promises and potential caveats. Neurosci Biobehav Rev. 45:19–27. 2014. View Article : Google Scholar : PubMed/NCBI

10 

Bolay H and Moskowitz MA: Mechanisms of pain modulation in chronic syndromes. Neurology. 59 Suppl 2:S2–S7. 2002. View Article : Google Scholar : PubMed/NCBI

11 

Kawasaki Y, Zhang L, Cheng JK and Ji RR: Cytokine mechanisms of central sensitization: Distinct and overlapping role of interleukin-1beta, interleukin-6, and tumor necrosis factor-alpha in regulating synaptic and neuronal activity in the superficial spinal cord. J Neurosci. 28:5189–5194. 2008. View Article : Google Scholar : PubMed/NCBI

12 

Finnerup NB, Attal N, Haroutounian S, McNicol E, Baron R, Dworkin RH, Gilron I, Haanpää M, Hansson P, Jensen TS, et al: Pharmacotherapy for neuropathic pain in adults: A systematic review and meta-analysis. Lancet Neurol. 14:162–173. 2015. View Article : Google Scholar : PubMed/NCBI

13 

Jia HB, Jin Y, Ji Q, Hu YF, Zhou ZQ, Xu JG and Yang JJ: Effects of recombinant human erythropoietin on neuropathic pain and cerebral expressions of cytokines and nuclear factor-kappa B. Can J Anaesth. 56:597–603. 2009. View Article : Google Scholar : PubMed/NCBI

14 

Zhang L, Fu ZJ, Sun T, Zhao XL, Song WG, Jia MR and Wei GF: Expression of NF-kappaB and TNF-alpha in spinal dorsal horn in a rat model of neuropathic pain. Zhonghua Yi Xue Za Zhi. 90:1067–1071. 2010.(In Chinese). PubMed/NCBI

15 

Song XJ, Wang ZB, Gan Q and Walters ET: cAMP and cGMP contribute to sensory neuron hyperexcitability and hyperalgesia in rats with dorsal root ganglia compression. J Neurophysiol. 95:479–492. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Cenac N, Altier C, Chapman K, Liedtke W, Zamponi G and Vergnolle N: Transient receptor potential vanilloid-4 has a major role in visceral hypersensitivity symptoms. Gastroenterology. 135:937–946. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Cenac N, Altier C, Motta JP, d'Aldebert E, Galeano S, Zamponi GW and Vergnolle N: Potentiation of TRPV4 signalling by histamine and serotonin: An important mechanism for visceral hypersensitivity. Gut. 59:481–488. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Facer P, Casula MA, Smith GD, Benham CD, Chessell IP, Bountra C, Sinisi M, Birch R and Anand P: Differential expression of the capsaicin receptor TRPV1 and related novel receptors TRPV3, TRPV4 and TRPM8 in normal human tissues and changes in traumatic and diabetic neuropathy. BMC Neurol. 7:112007. View Article : Google Scholar : PubMed/NCBI

19 

Tung KW, Behera D and Biswal S: Neuropathic pain mechanisms and imaging. Semin Musculoskelet Radiol. 19:103–111. 2015. View Article : Google Scholar : PubMed/NCBI

20 

Cervantes-Durán C, Vidal-Cantú GC, Godínez-Chaparro B and Granados-Soto V: Role of spinal 5-HT2 receptors subtypes in formalin-induced long-lasting hypersensitivity. Pharmacol Rep. 68:434–442. 2016. View Article : Google Scholar : PubMed/NCBI

21 

Madishetti S, Schneble N, König C, Hirsch E, Schulz S, Müller JP and Wetzker R: PI3Kγ integrates cAMP and Akt signalling of the μ-opioid receptor. Br J Pharmacol. 171:3328–3337. 2014. View Article : Google Scholar : PubMed/NCBI

22 

Manet R, Fabre N, Moyse E, Laurent B and Schmidt EA: Intracranial hypertension is painless! Acta Neurochir Suppl (Wien). 122:275–277. 2016. View Article : Google Scholar

23 

Wu J, Xu Y, Pu S, Jiang W and Du D: p38/MAPK inhibitor modulates the expression of dorsal horn GABA(B) receptors in the spinal nerve ligation model of neuropathic pain. Neuroimmunomodulation. 18:150–155. 2011. View Article : Google Scholar : PubMed/NCBI

24 

Zhang X, Zheng H, Zhu HY, Hu S, Wang S, Jiang X and Xu GY: Acute effects of transforming growth factor-beta1 on neuronal excitability and involvement in the pain of rats with chronic pancreatitis. J Neurogastroenterol Motil. 22:333–343. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Komiya Y and Habas R: Wnt signal transduction pathways. Organogenesis. 4:68–75. 2008. View Article : Google Scholar : PubMed/NCBI

26 

Davis EK, Zou Y and Ghosh A: Wnts acting through canonical and noncanonical signaling pathways exert opposite effects on hippocampal synapse formation. Neural Dev. 3:322008. View Article : Google Scholar : PubMed/NCBI

27 

Chen J, Park CS and Tang SJ: Activity-dependent synaptic Wnt release regulates hippocampal long term potentiation. J Biol Chem. 281:11910–11916. 2006. View Article : Google Scholar : PubMed/NCBI

28 

Logan CY and Nusse R: The Wnt signaling pathway in development and disease. Annu Rev Cell Dev Biol. 20:781–810. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Datta S, Chatterjee K, Kline RH IV and Wiley RG: Behavioral and anatomical characterization of the bilateral sciatic nerve chronic constriction (bCCI) injury: Correlation of anatomic changes and responses to cold stimuli. Mol Pain. 6:72010. View Article : Google Scholar : PubMed/NCBI

30 

Hargreaves K, Dubner R, Brown F, Flores C and Joris J: A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain. 32:77–88. 1988. View Article : Google Scholar : PubMed/NCBI

31 

Gangadhar M, Mishra RK, Sriram D and Yogeeswari P: Future directions in the treatment of neuropathic pain: A review on various therapeutic targets. CNS Neurol Disord Drug Targets. 13:63–81. 2014. View Article : Google Scholar : PubMed/NCBI

32 

Mohammed MK, Shao C, Wang J, Wei Q, Wang X, Collier Z, Tang S, Liu H, Zhang F, Huang J, et al: Wnt/β-catenin signaling plays an ever-expanding role in stem cell self-renewal, tumorigenesis and cancer chemoresistance. Genes Dis. 3:11–40. 2016. View Article : Google Scholar : PubMed/NCBI

33 

Moon RT, Kohn AD, De Ferrari GV and Kaykas A: WNT and beta-catenin signalling: Diseases and therapies. Nat Rev Genet. 5:691–701. 2004. View Article : Google Scholar : PubMed/NCBI

34 

Hering H and Sheng M: Direct interaction of Frizzled-1, −2, −4, and −7 with PDZ domains of PSD-95. FEBS Lett. 521:185–189. 2002. View Article : Google Scholar : PubMed/NCBI

35 

Verkaar F and Zaman GJ: New avenues to target Wnt/β-catenin signaling. Drug Discov Today. 16:35–41. 2011. View Article : Google Scholar : PubMed/NCBI

36 

Cerpa W, Toledo EM, Varela-Nallar L and Inestrosa NC: The role of Wnt signaling in neuroprotection. Drug News Perspect. 22:579–591. 2009. View Article : Google Scholar : PubMed/NCBI

37 

Liu Y, Wang X, Lu CC, Kerman R, Steward O, Xu XM and Zou Y: Repulsive Wnt signaling inhibits axon regeneration after CNS injury. J Neurosci. 28:8376–8382. 2008. View Article : Google Scholar : PubMed/NCBI

38 

Suh HI, Min J, Choi KH, Kim SW, Kim KS and Jeon SR: Axonal regeneration effects of Wnt3a-secreting fibroblast transplantation in spinal cord-injured rats. Acta Neurochir (Wien). 153:1003–1010. 2011. View Article : Google Scholar : PubMed/NCBI

39 

Yuan S, Shi Y and Tang SJ: Wnt signaling in the pathogenesis of multiple sclerosis-associated chronic pain. J Neuroimmune Pharmacol. 7:904–913. 2012. View Article : Google Scholar : PubMed/NCBI

40 

Zhang YK, Huang ZJ, Liu S, Liu YP, Song AA and Song XJ: WNT signaling underlies the pathogenesis of neuropathic pain in rodents. J Clin Invest. 123:2268–2286. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Zhao Y and Yang Z: Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain. Exp Ther Med 16: 3082-3088, 2018.
APA
Zhao, Y., & Yang, Z. (2018). Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain. Experimental and Therapeutic Medicine, 16, 3082-3088. https://doi.org/10.3892/etm.2018.6512
MLA
Zhao, Y., Yang, Z."Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain". Experimental and Therapeutic Medicine 16.4 (2018): 3082-3088.
Chicago
Zhao, Y., Yang, Z."Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain". Experimental and Therapeutic Medicine 16, no. 4 (2018): 3082-3088. https://doi.org/10.3892/etm.2018.6512
Copy and paste a formatted citation
x
Spandidos Publications style
Zhao Y and Yang Z: Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain. Exp Ther Med 16: 3082-3088, 2018.
APA
Zhao, Y., & Yang, Z. (2018). Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain. Experimental and Therapeutic Medicine, 16, 3082-3088. https://doi.org/10.3892/etm.2018.6512
MLA
Zhao, Y., Yang, Z."Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain". Experimental and Therapeutic Medicine 16.4 (2018): 3082-3088.
Chicago
Zhao, Y., Yang, Z."Effect of Wnt signaling pathway on pathogenesis and intervention of neuropathic pain". Experimental and Therapeutic Medicine 16, no. 4 (2018): 3082-3088. https://doi.org/10.3892/etm.2018.6512
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team