Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
September-2018 Volume 16 Issue 3

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway

  • Authors:
    • Guangfeng Li
    • Xianye Tang
    • Hongliang Chen
    • Wei Sun
    • Feng Yuan
  • View Affiliations / Copyright

    Affiliations: Graduate School of Xuzhou Medical College, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu 221000, P.R. China, Department of Spinal Surgery, Affiliated Hospital of Xuzhou Medical College, Xuzhou, Jiangsu 221000, P.R. China
  • Pages: 2665-2669
    |
    Published online on: July 24, 2018
       https://doi.org/10.3892/etm.2018.6516
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The present study aimed to verify the expression and investigate the role of microRNA (miR)‑148a in intervertebral disc degeneration (IDD) and explore the associated underlying mechanisms. Reverse transcription‑quantitative polymerase chain reaction (RT‑qPCR) was performed to investigate levels of miR‑148a in the peripheral blood mononuclear cells (PBMCs) of patients with IDD. To investigate the role of miR‑148a in IDD, a stable miR‑148a‑overexpression/underexpression human nucleus pulposus (NP) cell line was generated by transfection with miR‑148a mimic/inhibitor. Then, NP cells were treated with LPS (10 µM) to induce inflammation. The mRNA expression level of miR‑148a in NP cells was determined by RT‑qPCR and the expression levels of p38 and p‑p38 were measured using western blotting. The mRNA expression and supernatant level of pro‑inflammatory cytokines, tumor necrosis factor (TNF‑α), interleukin (IL)‑1β and IL‑6, was evaluated by RT‑qPCR and ELISA, respectively. The results indicated that miR‑148a was significantly downregulated in the PBMCs of IDD patients compared with healthy controls. In vitro upregulation of miR‑148a in LPS‑stimulated NP cells, by transfection with miR‑148a mimic, resulted in inhibition of p‑p38 expression; however, inhibition of miR‑148a led to overexpression of p‑p38. Meanwhile, the production of pro‑inflammatory cytokines (TNF‑α, IL‑1β and IL‑6) was significantly reduced in miR‑148a‑overexpressing LPS‑stimulated NP cells and significantly increased in miR‑148a‑underexpressing NP cells. In conclusion, miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells via regulation of the p38/mitogen‑activated protein kinase pathway.

Introduction

Intervertebral disc degeneration (IDD) is a major risk factor for lower back pain that is a worldwide problem. It badly affects human life and causes a serious socioeconomic burden (1–4). An imbalance between anabolic and catabolic genes expressed by chondrocytes that belong to the nucleus pulposus (NP) result in IDD. The etiology of IDD is very complicated. Numerous cellular events, including cell apoptosis, inflammation, autophagy and increased matrix catabolism, have been confirmed to be involved in the progress of IDD (5,6). It has previously been reported that NP cells, which share the common features of chondrocytes, play critical roles in maintaining integrity of intervertebral discs (IVDs) (7,8). One of the major features of IDD is the loss of proteoglycan (PG) content from IVDs. Lipopolysaccharide (LPS), a strong promoter of inflammation, can reduce PG content and cause the occurrence of IDD (9,10). Furthermore, pro-inflammatory factors such as interleukin (IL)-1β, IL-6 and tumor necrosis factor (TNF)-α also serve critical functions in IDD. However, the underlying molecular and cellular mechanisms of IDD remain unclear.

MicroRNAs (miRs) are small (20–22 nucleotides in length), non-coding, single-stranded RNAs that serve important functions in post-transcriptionally regulating gene expression (11,12). Previous studies have demonstrated that miRs are critical in cancer progress, as well as in inflammatory, neurodegenerative and most degenerative disorders (7,8). Previous reports have demonstrated that miRs serve important functions in degenerative disc diseases, such as IDD (13–16). It has also been indicated that miR-148a is downregulated in IDD compared with spinal cord injury (17), but the underlying mechanisms are still unknown.

Thus, the aim of the present study was to verify the expression and investigate the role of miR-148a in IDD and explore the underlying mechanisms.

Materials and methods

Materials

LPS was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). ELISA kits for TNF-α (cat no. E-CL-M0047c), IL-1β (cat no. E-EL-M0037c) and IL-6 (cat no. E-EL-M0044c) were obtained from Elabscience Biotechnology Co., Ltd. (Wuhan, China). Antibodies against p38 (cat no. 9212)/p-p38 (cat no. 4631) and GAPDH (cat no. 97166) and secondary antibodies (anti-rabbit IgG, horseradish peroxidase (HRP)-linked antibody; cat no. 7074; anti-mouse IgG HRP-linked antibody; cat no. 7076) were supplied by Cell Signaling Technology, Inc. (Danvers, MA, USA). miR-148a mimic (cat no. miR10000243-1-5)/inhibitor (cat no. miR20000243-1-5) were purchased from Guangzhou Ribobio Co., Ltd. (Guangzhou, China); all other chemicals and reagents were purchased from Sinopharm Chemical Reagent Co., Ltd. (Shanghai, China).

Patients

The study was approved by the Human Ethics Committees Review Board at the Affiliated Hospital of Xuzhou Medical College (Xuzhou, China) and written informed consent was obtained from each patient prior to enrollment. A total of 30 patients with IDD and 30 healthy volunteers were enrolled from the Department of Spinal Surgery at the Affiliated Hospital of Xuzhou Medical College (Xuzhou, China) from January 2014 to January 2015. Peripheral blood mononuclear cells (PBMCs) were obtained from the peripheral blood of patients and healthy volunteers as described previously (18). Peripheral blood was centrifuged at 650 × g for 25 min at room temperature. Middle phases containing Human PBMCs were further centrifuged (650 × g for 10 min at room temperature) by density using Lymphoprep (Stemcell Technologies, Inc., Beijing, China) (19).

Cell culture

Human NP cells were purchased from ScienCell Research Laboratories, Inc. (San Diego, CA, USA; cat. no. 4800) and cultured in Dulbecco's Modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% fetal bovine serum (Gibco), 1% L-glutamine (Gibco), 100 mg/ml streptomycin and 100 U/ml penicillin and then incubated in a 5% CO2 incubator at 37°C. The culture medium was changed every 2 days and cells were passaged until they reached 90% confluence.

Cell treatment

Human NP cells (5×104 cells per well) were added to a 6-well plate and transiently transfected with miR-148a mimic (50 nM)/inhibitor (100 nM) using Lipofectamine with Plus reagent (Thermo Fisher Scientific, Inc.) and control transfections were performed lacking miR-148a. The nucleotide sequences used were as follows: miR-148a mimic forward, 5′-UCAGUGCAUGACAGAACUUGG-3′ and reverse, 5′-AAGTTCUGUCAUGCACUGAUU-3′; NC forward, 5′-UUCUCCGAACGUGUCACGUTT-3′ and reverse, 5′-ACGUGACACGUUCGGAGAATT-3′; and miR-148a inhibitor, 5′-ACAAAGUUCUGUAGUGCACUGA-3′. At 24 h following the transfection, 5×104 cells were stimulated with LPS (10 µM) in serum-free medium (DMEM) for 24 h at 37°C under 5% CO2. The suspensions were then centrifuged at 1,000 × g for 10 min at 4°C and collected 24 h after the initiation of each treatment. Cells were then harvested for subsequent experimentation. The groups were divided into the following: A control group (NP cells without any treatment); an NC group (NP cells transfected with NC oligonucleotides and stimulated with LPS); a mimic group (NP cells transfected with miR148a mimic and then stimulated with LPS) and an inhibitor group (NP cells transfected with miR148a inhibitor and then stimulated with LPS).

RNA isolation and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)

Total RNA was extracted from human PBMCs and human NP cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Each sample (1 µg RNA) was then reverse-transcribed to cDNA using a reverse-transcription (RT) reagent kit (Takara Biotechnology Co., Ltd., Dalian, China). A 7500 real-time PCR instrument (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used to quantify miR-148a, TNF-α, IL-1β and IL-6 mRNA levels. Amplification conditions were as follows: 16°C for 30 min, 42°C for 30 min, 85°C for 5 min and hold at 4°C. qPCR was performed using the QuantiTect SYBR-Green PCR kit (Takara Biotechnology Co., Ltd.). All reactions were performed in triplicate with the following conditions: 95°C for 10 min, followed by 37 cycles at 95°C for 15 sec and 72°C for 30 sec. All quantitative miRNA data were normalized to U6 expression and quantitative mRNA data were normalized to GAPDH. The comparative Cq method was used for the relative amounts of each transcript (20). The primers for qPCR were as presented in Table I.

Table I.

Primer sequences for polymerase chain reaction analysis.

Table I.

Primer sequences for polymerase chain reaction analysis.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
TNF-α CCTGTCTCTTCCTACCCAACC GCAGGAGTGTCCGTGTCTTC
IL-1β CTGTGACTCGTGGGATGATG AGGGATTTTGTCGTTGCTTG
IL-6 GTGCTCCTGGTATTGCTGGT GGCTCCTCGTTTTCCTTCTT
miR-148a ATGCTCAGTGCACTACAGAAGTGCAGGGTCCGAGGT
U6 CTCGCTTCGGCAGCACA AACGCTTCACGAATTTGCGT
GAPDH CTTTGGTATCGTGGAAGGACTC GTAGAGGCAGGGATGATGTTCT

[i] TNF, tumor necrosis factor; IL, interleukin; miR, microRNA.

Western blot analysis

In brief, total cellular protein from NP cells was extracted using RIPA buffer (Cell Signaling Technology, Inc.) and separated by SDS-PAGE analysis. Sample protein concentrations were determined using the BCA protein assay (Thermo Fisher Scientific, Inc.). Each lane was loaded with 25 µg protein and resolved using a 10% SDS-PAGE gel and transferred to a polyvinylidene fluoride membrane. Membranes were then blocked using Tris-buffered saline with 0.1% Tween-20 (TBST) containing 5% non-fat milk for 1 h at room temperature. Membranes were subsequently incubated overnight at 4°C with primary antibodies against p-p38 and p38 (1:1,000) or GAPDH (1:2,000). Membranes were incubated with the correspondent secondary antibody (1:5,000) at room temperature for 2 h. Protein bands were observed with enhanced chemiluminescence and imaged.

ELISA assay

In order to determine levels of TNF-α, IL-1β and IL-6 in the NP cellular supernatant, ELISA was performed with ELISA kits, following the manufacturer's protocol.

Statistical analysis

Data are presented as the mean ± SD. All statistical analyses were performed using SPSS 17.0 statistical software (SPSS, Inc., Chicago, IL, USA). A t-test or one-way analysis of variance followed by Tukey's test was used to evaluate differences between groups. P<0.05 was considered to indicate a statistically significant difference.

Results

Downregulation of miR-148a in IDD

To investigate the potential role of miR-148a in IDD, the relative expression of miR-148a in PBMCs separated from IDD patients and control subjects was compared. miR-148a expression level was also detected in NP cells with or without LPS stimulation. As shown in Fig. 1A, the expression level of miR-148a was significantly decreased in PBMCs of patients with IDD compared with control subjects. Furthermore, miR-148a expression level in LPS-stimulated NP cells was significantly lower compared with the untreated NP cells (Fig. 1B). These data suggested that miR-148a is downregulated in IDD.

Figure 1.

miR-148a expression detection. miR-148a expression level was measured by reverse transcription-quantitative polymerase chain reaction and data were normalized to U6 expression. (A) Expression level of miR-148a in peripheral blood mononuclear cells of patients with IDD and healthy controls. **P<0.01 vs. Con. (B) Expression level of miR-148a in LPS-stimulated NP cells. Experiments were performed in triplicate. *P<0.05 vs. Con; #P<0.05 vs. NC. Con, control (normal NP cells); NC, negative control (NP cells transfected with NC oligonucleotides and stimulated with LPS); mimic, NP cells transfected with miR-148a mimic and stimulated with LPS; inhibitor, NP cells transfected with miR-148a inhibitor and stimulated with LPS; NP, nucleus pulposus; LPS, lipopolysaccharide; miR, microRNA; IDD, intervertebral disc degeneration.

miR-148a affects pro-inflammatory cytokines levels in LPS-stimulated NP cells

In order to evaluate the effects of miR-148a in IDD, miR-148a expression was induced in LPS-stimulated NP cells using miR-148a mimic and inhibited using miR-148a inhibitor, while negative control (NC) oligonucleotides were used as the control. As shown in Fig. 1B, compared with the NP cells transfected with NC oligonucleotides, miR-148a expression was significantly upregulated by miR-148a mimic transfection and significantly inhibited by miR-148a inhibitor transfection. Then, the mRNA expression level and quantity of pro-inflammatory cytokines TNF-α, IL-1β and IL-6 was measured by RT-qPCR and ELISA, respectively. The results indicated that, compared with the NC group, the mRNA expression level of TNF-α, IL-1β and IL-6 significantly decreased in NP cells transfected with miR-148a mimic (Fig. 2A) and significantly increased in NP cells transfected with miR-148a inhibitor (Fig. 2B). In addition, the ELISA results indicated that, compared with the NC group, cellular supernatant TNF-α, IL-1β and IL-6 levels significantly decreased in NP cells transfected with miR-148a mimic and significantly increased in NP cells transfected with miR-148a inhibitor (Fig. 3). These results indicated that miR-148a inhibits pro-inflammatory cytokine levels in LPS-stimulated NP cells. This suggests that miR-148a may inhibit pro-inflammatory factors released by IVD cells.

Figure 2.

mRNA expression level of pro-inflammatory cytokines. The mRNA expression level of TNF-α, IL-1β and IL-6 was measured by reverse transcription-quantitative polymerase chain reaction and data were normalized to GAPDH expression. (A) mRNA expression level of TNF-α, IL-1β and IL-6 in NP cells transfected with miR-148a mimic and stimulated with LPS. (B) mRNA expression level of TNF-α, IL-1β and IL-6 in NP cells transfected with miR-148a inhibitor and stimulated with LPS. Experiments were performed in triplicate. *P<0.05 vs. NC. NC, negative control (NP cells transfected with NC oligonucleotides and stimulated with LPS); TNF, tumor necrosis factor; IL, interleukin; NP, nucleus pulposus; miR, microRNA; LPS, lipopolysaccharide.

Figure 3.

Levels of pro-inflammatory cytokines in NP cellular supernatant. ELISA was performed to detect the expression level of TNF-α, IL-1β and IL-6 in the cellular supernatant of NP cells stimulated with LPS and transfected with miR-148a mimic or inhibitor. Experiments were performed in triplicate. *P<0.05 vs. NC. NC, negative control (NP cells transfected with NC oligonucleotides and stimulated with LPS); TNF, tumor necrosis factor; IL, interleukin; NP, nucleus pulposus; miR, microRNA; LPS, lipopolysaccharide.

miR-148a affects activation of the p38/mitogen-activated protein kinase (MAPK) pathway in LPS-stimulated NP cells

To investigate the underlying mechanism by which miR-148a affects the inflammatory response, the involvement of the p38/MAPK pathway was evaluated. As shown in Fig. 4, compared with the NC group, overexpression of miR-148a markedly reduced the protein expression level of p-p38 in LPS-stimulated NP cells transfected with miR-148a mimic. Furthermore, transfection with miR-148a inhibitor resulted in a marked increase in the expression of p-p38 in LPS-stimulated NP cells compared with the NC group. These results indicated that miR-148a overexpression inhibits activation of the p38/MAPK pathway in LPS-stimulated NP cells.

Figure 4.

Expression level of p38 and p-p38 in NP cells stimulated with LPS. NP cells were transfected with miR-148a mimic, miR-148a inhibitor or NC. At 24 h after the transfection, the cells were stimulated with LPS for 24 h. Then, western blot analysis was performed to detect protein expression levels. NC, negative control (NP cells transfected with NC oligonucleotides and stimulated with LPS); NP, nucleus pulposus; miR, microRNA; LPS, lipopolysaccharide.

Discussion

Numerous studies have indicated that miRs serve key functions in the development of IDD (13,14,16,21). However the expression and role of miR-148a in IDD remains unknown. In the present study, the role of miR-148a in IDD was investigated and the pathological links between miR-148a, IDD and inflammatory pathways were investigated.

In order to evaluate the role of miR-148a in IDD, the expression level of miR-148a was measured in PBMCs isolated from IDD patients and control subjects. miR-148a expression level was also detected in NP cells with or without LPS stimulation. The findings suggested that miR-148a was significantly downregulated in IDD patients compared with the healthy controls, as well as in the LPS-stimulated NP cells compared with non-stimulated cells. Similar to these results, previous studies on miRNA expression in degenerative discs have reported that numerous miRNAs are abnormally expressed in IDD (22–25).

To investigate the underlying mechanism of the role of miR-148a in IDD, a stable miR-148a-overexpression/underexpression human NP cell line was established by transfection with miR-148a mimic/inhibitor and an IDD cell model was established by LPS stimulation. A previous study confirmed that inflammation drives the degeneration of IVD (26). The increased expression level of pro-inflammatory cytokines secreted by IVD cells is the major characteristic of IDD and these cytokines promote extracellular matrix degradation, chemokine production and changes in IVD cell phenotype (27). Thus, in the present study, the mRNA expression level of pro-inflammatory cytokines (TNF-α, IL-1β and IL-6) was evaluated in NP cells. The results revealed that miR-148a mimic reduced the mRNA expression level of pro-inflammatory cytokines in LPS-stimulated NP cells and miR-148a inhibitor presented the opposite effect. Furthermore, the cellular supernatant levels of TNF-α, IL-1β and IL-6 were detected by ELISA and the results indicated the same trends as mRNA expression levels.

Finally, in order to investigate whether the p38/MAPK pathway is involved in the regulation of inflammatory responses by miR-148a in IDD, activation of the p38/MAPK pathway was evaluated in the present study. It was identified that upregulation of miR-148a in LPS-stimulated NP cells decreased the phosphorylation of p38, while miR-148a inhibitor increased the phosphorylation of p38. These results indicated that activation of the p38/MAPK pathway is associated with the function of miR-148a in regulating inflammatory response in LPS-stimulated NP cells.

In conclusion, the present findings suggest that miR-148a serves a function in IDD progress and miR-148a overexpression suppresses pro-inflammatory factors released by IVD cells though regulating the p38/MAPK pathway. Thus, miR-148a may have potential therapeutic applications in the treatment of IDD.

Competing interests

The authors declare that they have no competing interests.

References

1 

Millecamps M, Tajerian M, Naso L, Sage EH and Stone LS: Lumbar intervertebral disc degeneration associated with axial and radiating low back pain in ageing SPARC-null mice. Pain. 153:1167–1179. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Vos T, Flaxman AD, Naghavi M, Lozano R, Michaud C, Ezzati M, Shibuya K, Salomon JA, Abdalla S, Aboyans V, et al: Years lived with disability (YLDs) for 1160 sequelae of 289 diseases and injuries 1990–2010: A systematic analysis for the global burden of disease study 2010. Lancet. 380:2163–2196. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Gore M, Sadosky A, Stacey BR, Tai KS and Leslie D: The burden of chronic low back pain: Clinical comorbidities, treatment patterns and health care costs in usual care settings. Spine (Phila Pa 1976). 37:E668–E677. 2012. View Article : Google Scholar : PubMed/NCBI

4 

Takatalo J, Karppinen J, Taimela S, Niinimäki J, Laitinen J, Sequeiros RB, Samartzis D, Korpelainen R, Näyhä S, Remes J and Tervonen O: Association of abdominal obesity with lumbar disc degeneration-a magnetic resonance imaging study. PLoS One. 8:e562442013. View Article : Google Scholar : PubMed/NCBI

5 

Kepler CK, Ponnappan RK, Tannoury CA, Risbud MV and Anderson DG: The molecular basis of intervertebral disc degeneration. Spine J. 13:318–330. 2013. View Article : Google Scholar : PubMed/NCBI

6 

Risbud MV and Shapiro IM: Role of cytokines in intervertebral disc degeneration: Pain and disc content. Nat Rev Rheumatol. 10:44–56. 2014. View Article : Google Scholar : PubMed/NCBI

7 

Teague EM, Print CG and Hull ML: The role of microRNAs in endometriosis and associated reproductive conditions. Hum Reprod Update. 16:142–165. 2010. View Article : Google Scholar : PubMed/NCBI

8 

Croce CM: Causes and consequences of microRNA dysregulation in cancer. Nat Rev Genet. 10:704–714. 2009. View Article : Google Scholar : PubMed/NCBI

9 

Ellman MB, Kim JS, An HS, Chen D, KC R, An J, Dittakavi T, van Wijnen AJ, Cs-Szabo G, Li X, et al: Toll-like receptor adaptor signaling molecule MyD88 on intervertebral disk homeostasis: In vitro, ex vivo studies. Gene. 505:283–290. 2012. View Article : Google Scholar : PubMed/NCBI

10 

Iwata M, Ochi H, Asou Y, Haro H, Aikawa T, Harada Y, Nezu Y, Yogo T, Tagawa M and Hara Y: Variations in gene and protein expression in canine chondrodystrophic nucleus pulposus cells following long-term three-dimensional culture. PLoS One. 8:e631202013. View Article : Google Scholar : PubMed/NCBI

11 

Lee RC, Feinbaum RL and Ambros V: The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell. 75:843–854. 1993. View Article : Google Scholar : PubMed/NCBI

12 

Bartel DP: MicroRNAs: Genomics, biogenesis, mechanism and function. Cell. 116:281–297. 2004. View Article : Google Scholar : PubMed/NCBI

13 

Yu X, Li Z, Shen J, Wu WK, Liang J, Weng X and Qiu G: MicroRNA-10b promotes nucleus pulposus cell proliferation through RhoC-Akt pathway by targeting HOXD10 in intervetebral disc degeneration. PLoS One. 8:e830802013. View Article : Google Scholar : PubMed/NCBI

14 

Ohrt-Nissen S, Døssing KB, Rossing M, Lajer C, Vikeså J, Nielsen FC, Friis-Hansen L and Dahl B: Characterization of miRNA expression in human degenerative lumbar disks. Connect Tissue Res. 54:197–203. 2013. View Article : Google Scholar : PubMed/NCBI

15 

Liu G, Cao P, Chen H, Yuan W, Wang J and Tang X: MiR-27a regulates apoptosis in nucleus pulposus cells by targeting PI3K. PLoS One. 8:e752512013. View Article : Google Scholar : PubMed/NCBI

16 

Liu H, Huang X, Liu X, Xiao S, Zhang Y, Xiang T, Shen X, Wang G and Sheng B: miR-21 promotes human nucleus pulposus cell proliferation through PTEN/AKT signaling. Int J Mol Sci. 15:4007–4018. 2014. View Article : Google Scholar : PubMed/NCBI

17 

Zhao B, Yu Q, Li H, Guo X and He X: Characterization of microRNA expression profiles in patients with intervertebral disc degeneration. Int J Mol Med. 33:43–50. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Diaz-Morales N, Iannantuoni F, Escribano-Lopez I, Bañuls C, Rovira-Llopis S, Sola E, Rocha M, Hernandez-Mijares A and Victor VM: Does metformin modulate endoplasmic reticulum stress and autophagy in type 2 diabetic peripheral blood mononuclear cells? Antioxid Redox Signal. 2017.(Epub ahead of print).

19 

Nakanishi R, Kitao H, Kiniwa M, Morodomi Y, Iimori M, Kurashige J, Sugiyama M, Nakashima Y, Saeki H, Oki E and Maehara Y: Monitoring trifluridine incorporation in the peripheral blood mononuclear cells of colorectal cancer patients under trifluridine/tipiracil medication. Sci Rep. 7:169692017. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Wang HQ, Yu XD, Liu ZH, Cheng X, Samartzis D, Jia LT, Wu SX, Huang J, Chen J and Luo ZJ: Deregulated miR-155 promotes Fas-mediated apoptosis in human intervertebral disc degeneration by targeting FADD and caspase-3. J Pathol. 225:232–242. 2011. View Article : Google Scholar : PubMed/NCBI

22 

Gruber HE, Hoelscher GL, Ingram JA and Hanley EN Jr: Genome-wide analysis of pain-, nerve- and neurotrophin-related gene expression in the degenerating human annulus. Mol Pain. 8:632012. View Article : Google Scholar : PubMed/NCBI

23 

Xu YQ, Zhang ZH, Zheng YF and Feng SQ: Dysregulated miR-133a mediates loss of typeII collagen by directly targeting matrix metalloproteinase 9 (MMP9) in human intervertebral disc degeneration. Spine (Phila Pa 1976). 41:E714–E724. 2016. View Article : Google Scholar

24 

Wang B, Wang D, Yan T and Yuan H: MiR-138-5p promotes TNF-α-induced apoptosis in human intervertebral disc degeneration by targeting SIRT1 through PTEN/PI3K/Akt signaling. Exp Cell Res. 345:199–205. 2016. View Article : Google Scholar : PubMed/NCBI

25 

Ma JF, Zang LN, Xi YM, Yang WJ and Zou D: MiR-125a Rs12976445 Polymorphism is associated with the apoptosis status of nucleus pulposus cells and the risk of intervertebral dis degeneration. Cell Physiol Biochem. 38:295–305. 2016. View Article : Google Scholar : PubMed/NCBI

26 

Teixeira GQ, Pereira CL, Ferreira JR, Maia AF, Gomez-Lazaro M, Barbosa MA, Neidlinger-Wilke C and Goncalves RM: Immunomodulation of human mesenchymal stem/stromal cells in intervertebral disc degeneration: insights from a proinflammatory/degenerative ex vivo model. Spine (Phila Pa 1976). 2017.(Epub ahead of print).

27 

Maidhof R, Jacobsen T, Papatheodorou A and Chahine NO: Inflammation induces irreversible biophysical changes in isolated nucleus pulposus cells. PLoS One. 9:e996212014. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Li G, Tang X, Chen H, Sun W and Yuan F: miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway. Exp Ther Med 16: 2665-2669, 2018.
APA
Li, G., Tang, X., Chen, H., Sun, W., & Yuan, F. (2018). miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway. Experimental and Therapeutic Medicine, 16, 2665-2669. https://doi.org/10.3892/etm.2018.6516
MLA
Li, G., Tang, X., Chen, H., Sun, W., Yuan, F."miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway". Experimental and Therapeutic Medicine 16.3 (2018): 2665-2669.
Chicago
Li, G., Tang, X., Chen, H., Sun, W., Yuan, F."miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2665-2669. https://doi.org/10.3892/etm.2018.6516
Copy and paste a formatted citation
x
Spandidos Publications style
Li G, Tang X, Chen H, Sun W and Yuan F: miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway. Exp Ther Med 16: 2665-2669, 2018.
APA
Li, G., Tang, X., Chen, H., Sun, W., & Yuan, F. (2018). miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway. Experimental and Therapeutic Medicine, 16, 2665-2669. https://doi.org/10.3892/etm.2018.6516
MLA
Li, G., Tang, X., Chen, H., Sun, W., Yuan, F."miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway". Experimental and Therapeutic Medicine 16.3 (2018): 2665-2669.
Chicago
Li, G., Tang, X., Chen, H., Sun, W., Yuan, F."miR‑148a inhibits pro‑inflammatory cytokines released by intervertebral disc cells by regulating the p38/MAPK pathway". Experimental and Therapeutic Medicine 16, no. 3 (2018): 2665-2669. https://doi.org/10.3892/etm.2018.6516
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team