Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
October-2018 Volume 16 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population

  • Authors:
    • Wei Chen
    • Xiaohui Zhou
    • Yali Duan
    • Ting Zou
    • Guili Liu
    • Xiuru Ying
    • Qinwen Wang
    • Shiwei Duan
  • View Affiliations / Copyright

    Affiliations: Department of Internal Medicine for Cadres, The First Affiliated Hospital of Xinjiang Medical University, Ürümqi, Xinjiang 830000, P.R. China, Ningbo Key Lab of Behavior Neuroscience, Zhejiang Provincial Key Laboratory of Pathophysiology, School of Medicine, Ningbo University, Ningbo, Zhejiang 315211, P.R. China
  • Pages: 3135-3142
    |
    Published online on: July 26, 2018
       https://doi.org/10.3892/etm.2018.6524
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Alzheimer's disease (AD) is a neurodegenerative disorder leading to progressive memory and cognitive impairment. Previous studies have identified multiple genes associated with AD. The aim of the present study was to validate the association of the five AD‑associated variants, 8‑oxoguanine DNA glycosylase 1 (OGG1) rs1052133, bridging integrator 1 rs744373, sortilin-related receptor 1, rs1133174, presenilin 2 rs8383, and nerve growth factor rs6330, in the Xinjiang Chinese population. In addition, the present study evaluated the contribution of the promoter methylation of two genes, OGG1 and dihydrolipoamide succinyltransferase (DLST) to the risk of AD. A total of 17 AD cases and 34 controls were recruited from Xinjiang province in China. Genotyping was done by Sanger sequencing. DNA methylation assay was performed using quantitative methylation specific polymerase chain reaction. The study was unable to repeat the previous association of the five genetic polymorphisms with AD. However, DLST methylation levels were demonstrated to be significantly decreased in AD patients (P=0.027), particularly in female AD patients (P=0.025). Subgroup analysis by apolipoprotein E (APOE ε4) genotype demonstrated that OGG1 methylation levels were significantly increased in APOE non‑ε4 carriers compared with APOE ε4 carriers (P=0.027). In summary, the present study reported that DLST hypomethylation was significantly associated with AD in females, and that OGG1 promoter methylation may interact with APOE ε4 genotype.

Introduction

Alzheimer's disease (AD) is a progressive neurodegenerative disorder which has become a worldwide public health problem (1). The pathogenesis of AD is complex, and it may be contributed by genetic and environmental factors. The external environment can affect DNA methylation to change phenotype and gene expression (2). DNA methylation is an important epigenetic mechanism regulating the expression of aging genes in brain (3). The expression and closure of methylation regulatory genes are closely related to the human nervous system (4) and cognitive function (5).

The major challenge of AD is to identify new therapeutic targets and to develop new therapies for this disease (6). AD is closely related to tau hyperphosphorylation, oxidative stress, amyloid-β (Aβ) production, neuronal apoptosis, gene mutation, apolipoprotein E (APOE). Bridging integrator 1 (BIN1) is an important gene in the modulation of tau pathology, and BIN1 knockdown was shown to significantly suppress tau-mediated neurotoxicity (7). Sortilin-related receptor 1 (SORL1) is a member of the low-density lipoprotein receptor family that reduces amyloid-β (Aβ) production by regulating the intracellular transport and processing of APP (8). Nerve growth factor (NGF) contributes to the survival, regeneration and death of neurons during aging and in neurodegenerative diseases (9). PSEN2 is a transmembrane protein and AD-related presenilin mutations can alter intracellular calcium signaling, which leads to Aβ aggregation to form brain plaques and neuronal cell death (10). Genetic variation within these genes is associated with an increased risk of AD (9,11–14). The 8-oxoguanine DNA glycosylase 1 (OGG1) is a bifunctional enzyme with both glycosylase and AP lyase activities (15). Decreased OGG1 activity occurs early in the progression of AD (16). OGG1 was largely hypomethylated in LOAD and control blood DNA, and they do not support an increased promoter methylation of OGG1 in blood DNA of AD patients (17). Dihydrolipoamide succinyltransferase (DLST) is a subunit enzyme of the a-ketoglutarate dehydrogenase complex in the Krebs cycle. Polymorphisms of DLST were associated with AD in both Japanese and Caucasian populations (18–20).

In the present study, we aimed to validate the association of the five AD-associated variants (OGG1 rs1052133, BIN1 rs744373, SORL1 rs1133174, PSEN2 rs8383, and NGF rs6330) with AD in Xinjiang population. We also tested the association of OGG1 and DLST promoter methylation with AD.

Materials and methods

Epidemiological investigation was carried out in Xinjiang province of China between 2014 and 2015. A total of 17 AD patients (75.65±5.86 years) and 34 well-matched controls (77.59±7.41 years) were selected for the present study (Table I). This study was approved by the First Affiliated Hospital of Xinjiang Medical University Ethics Committee. All the patients gave their written informed consent forms for the current study. The clinical diagnosis of AD was done according to the criteria of the Diagnostic and Statistical Manual-IV (DSM-IV). The details were the same as previously described (21). Whole blood was stored in EDTA tube at −80°C. Genomic DNA was extracted and dissolved in TE buffer, and then it was stored at −20°C. Polymerase chain reaction (PCR) was carried out in 40 µl volume containing 2 µl of each primer, 4 µl genomic DNA, 12 µl ddH2O and 20 µl 2X HotTaq Master Mix. PCR was performed in a Veriti 96-well thermal cycler (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Genotyping was done using the Sanger sequencing. The primer sequences were TTACTTCTCCACGGACAAC and CAAGATTCTAACAGGACTCATC for the forward and the reverse primers of PSEN2 rs8383 genotyping, GCCAGTCCATCTTCTTCT and ACCACATCTTAGCCACAG for the forward and the reverse primers of BIN1 rs744373 genotyping, CATCCATACTGCCTGAGTC and CCTGTGAGTCCTGTTGAAG for the forward and the reverse primers of NGF rs6330 genotyping, GTGGATTCTCATTGCCTTC and AAACTGACTGCTTGATTTGG for the forward and the reverse primers of OGG1 rs1052133 genotyping, and TGTGACTTGTGCTGTATGAT and ACGCTAGAAGAAGGCTTATC for the forward and the reverse primers of SORL1 rs1133174 genotyping. PCR consisted of an initial melting step at 95°C for 10 min, 35 cycles (NGF, BIN1, and OGG1) or 37 cycles (PSEN2) or 40 cycles (SORL1), and a final extension step at 72°C for 2 min. The cycling program was 95°C for 30 sec, 58°C (NGF and BIN1) or 54°C (OGG1) or 57°C (PSEN2) or 53°C (SORL1) for 45 sec for annealing, and 72°C for 30 sec. DNA bisulphite conversion was done using the EZ DNA Methylation-Gold™ Kit (Zymo Research Corp., Irvine, CA, USA). The details of bisulphite conversion were the same as previously described (22). Promoter methylation status of OGG1 and DLST were examined utilizing quantitative methylation-specific PCR (qMSP). The primer sequences were CGGTGGTTGAGTTTTATTTTC and CTCCTTACGACTTATCTTCTC for the upstream and the downstream primers of OGG1, respectively. And the upstream and the downstream primer sequences of DLST were GTTGTAGTCGGGATATTGG and CGAAACGAACCACTAACA, respectively.

Table I.

Baseline clinical data of included subjects.

Table I.

Baseline clinical data of included subjects.

CharacteristicsCases (n=17)Controls (n=34)P-value
Age (years)75.65±5.8677.59±7.410.35
SBP (mmHg)132.94±16.40136.24±20.050.56
DBP (mmHg)75.35±9.6677.21±11.130.56
TG (mmol/l)2.03±1.531.52±1.270.31
TC (mmol/l)3.94±1.654.37±1.600.38
HDL (mmol/l)1.41±0.301.29±0.450.33
LDL (mmol/l)2.71±0.682.75±1.050.88
FBG (mmol/l)4.85±0.805.15±1.100.33
Male/Female7/1017/170.55
Diabetes/Non-diabetes1/167/270.34
Hypertension/Non-hypertension9/820/140.69
Smoking/Non-smoking2/154/301.00
Drinking/No drinking1/162/321.00
APOE ε4/Not APOE ε48/92/310.002

[i] SBP, systolic blood pressure; DBP, diastolic blood pressure; TG, triglyceride; TC, total cholesterol; HDL, high density lipoprotein; LDL, low density lipoprotein; FBG, fasting plasma glucose.

Statistical analysis

SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA) was used for the statistical analysis. Comparison of demographical parameters between cases and controls was performed using the Student's t test for continuous variables and the χ2 test for categorical data. Spearman rank correlation test was used to analyze the associations between gene methylation and metabolic characteristics. P<0.05 was considered to indicate a statistically significant difference.

Results

The characteristics of AD and control groups were presented in Table I. Our results showed the two groups were well paired according to the facts that there were no significant difference on gender, age, hypertension, diabetes, lipid levels, smoking and drinking status between the AD group and control group (P>0.05). As shown in Table II, there were no associations of the five genetic polymorphisms with AD. Further APOE ε4 based subgroup analysis indicated there were no significant interaction of APOE ε4 with the five genetic variants (Table III, P>0.05).

Table II.

Genotype and allele frequencies between cases and controls.

Table II.

Genotype and allele frequencies between cases and controls.

SNPCase; control (MM/Mm/mm)P-valueCase; control (M/m)P-value
PSEN2 (rs8383, C>T)6/6/5; 7/22/50.1218/16; 36/321.00
NGF (rs6330, C>T)13/4/0; 23/10/10.8330/4; 56/120.44
SORL1 (rs1133174, A>G)9/2/6; 19/7/80.5720/14; 45/230.47
OGG1 (rs1052133, G>C)5/8/4; 6/20/80.6018/16; 32/360.58
BIN1 (rs744373, T>C)5/7/5; 4/19/110.2917/17; 27/410.32

[i] NGF, nerve growth factor; SORL1, sortilin-related receptor 1; OGG1, 8-oxoguanine DNA glycosylase 1; BIN1, bridging integrator 1.

Table III.

Analysis of the interaction between APOE ε4 and other variants.

Table III.

Analysis of the interaction between APOE ε4 and other variants.

GenotypeAPOE ε4 Non-APOE ε4



SNPAlleleCaseControlP-valueCaseControlP-value
NGFCC/CT/TT6/2/02/0/01.0007/2/020/10/10.763
rs6330C/T14/24/01.00016/250/120.647
PSEN2CC/CT/TT3/3/20/1/11.0003/3/36/21/40.156
rs8383C/T9/71/30.5829/933/290.809
SORL1AA/AG/GG3/4/10/1/10.6676/2/120/6/51.000
rs1133174A/G10/61/30.28514/446/161.000
OGG1CC/CG/GG2/3/30/2/00.6673/5/16/18/70.677
rs1052133C/G7/92/21.00011/730/320.342
BIN1CC/CT/TT2/5/10/2/01.0003/2/23/17/110.144
rs744373C/T9/72/21.0008/623/390.168

[i] NGF, nerve growth factor; SORL1, sortilin-related receptor 1; OGG1, 8-oxoguanine DNA glycosylase 1; BIN1, bridging integrator 1.

The promoter regions of OGG1 and DLST were selected for the current methylation study (Fig. 1). In this study, we investigated the association of the methylation levels of OGG1 and DLST genes with AD (Fig. 2). Although OGG1 methylation was not associated with AD, our results showed that OGG1 methylation was significantly lower in AD patients with APOE ε4 allele than AD patients with APOE non-ε4 allele (P=0.027). Among AD patients older than 75 years old, the levels of OGG1 methylation were significantly lower in AD patients carrying APOE ε4 allele than AD patients who did not carry APOE ε4 allele (P=0.046).

Figure 1.

Locations of OGG1 and DLST promoter CpG sites. The CpG island is represented by a green box. The qMSP primers are underlined and CpG site on primers is in gray. OGG1, 8-oxoguanine DNA glycosylase 1; DLST, dihydrolipoamide succinyltransferase; F, forwards primer; R, reverse primer.

Figure 2.

Comparisons of OGG1 and DLST methylation levels between AD group and control group. The methylation levels in the case group and the control group were compared and stratified by gender, age, and whether or not they carried APOE ε4 allele. P<0.05 was marked, indicating that the corresponding difference between the two groups was statistically significant. OGG1, 8-oxoguanine DNA glycosylase 1; DLST, dihydrolipoamide succinyltransferase; AD, Alzheimer's disease; APOE ε4, subjects with at least one APOE ε4 allele; APOE non-ε4, subjects with APOE non-ε4 allele.

As shown in Fig. 2, DLST methylation levels were significantly lower in AD patients (P=0.027). Further subgroup analysis by gender showed that the association of DLST methylation with AD was specific in females (P=0.025). Further subgroup analysis by APOE ε4 locus showed that DLST methylation was associated with AD in the APOE non-ε4 individuals (P=0.029). In the control group, the level of DLST methylation was positively correlated with TC (r=0.401, P=0.019; Table IV, Fig. 3). Further stratification by gender showed age and OGG1 methylation levels were significantly correlated in AD group (male: r=0.762, P=0.046; female: r=−0.753, P=0.012; Table V, Fig. 4). In control group, the level of DLST methylation was inversely correlated with age (r=−0.414, P=0.015), and further stratified by gender showed that there was an inverse correlation between age and DLST methylation in males (r=−0.607, P=0.010).

Figure 3.

Pearson correlation between DLST methylation and TC. The upper panel shows the correlation between DLST methylation and TC in the control group. DLST, dihydrolipoamide succinyltransferase; TC, total cholesterol.

Table IV.

Correlation tests between the DNA methylation and important parameters.

Table IV.

Correlation tests between the DNA methylation and important parameters.

OGG1DLST


CaseControlCaseControl




Variablerprprprp
Total
  FBG0.3090.228−0.2850.113−0.3360.187−0.0810.648
  TG−0.1780.4940.2740.116−0.0200.9390.0090.962
  TC0.2590.3150.0390.8250.4400.0770.4010.019
  HDL0.0080.9770.1980.2610.3220.2070.2170.218
  LDL0.2830.271−0.0190.9140.3220.2070.2170.218
Female
  FBG0.3470.326−0.4580.064−0.6230.0550.1560.550
  TG−0.1970.5860.1980.4470.1970.586−0.0140.957
  TC0.2820.430−0.0330.8990.2410.5520.4440.074
  HDL−0.3570.3120.2470.3380.4630.1780.1630.533
  LDL0.4640.1770.0510.8450.1110.7600.1450.579
Male
  FBG0.6350.1250.0060.9830.2080.654−0.2940.252
  TG−0.2470.5930.3250.203−0.1940.676−0.0910.730
  TC0.3820.3980.2790.2780.6750.0960.3960.116
  HDL0.1100.8140.0930.7210.6620.1050.2520.328
  LDL0.2550.628−0.1200.6450.5110.2410.2420.349

[i] OGG1, 8-oxoguanine DNA glycosylase 1; DLST, dihydrolipoamide succinyltransferase; FBG, fasting plasma glucose; TG, triglyceride; TC, total cholesterol; HDL, high density lipoprotein; LDL, low density lipoprotein.

Table V.

Correlation tests between age and methylation levels of OGG1 and DLST.

Table V.

Correlation tests between age and methylation levels of OGG1 and DLST.

OGG1DLST


CaseControlCaseControl




Agerprprprp
Total
  Methylation level−0.0790.763−0.0180.9210.1870.472−0.4140.015
Female
  Methylation level−0.7530.0120.2360.3620.2030.574−0.0760.771
Male
  Methylation level0.7620.046−0.2820.2730.2460.595−0.6070.010

[i] Bold font represents positive results (P<0.05). OGG1, 8-oxoguanine DNA glycosylase 1; DLST, dihydrolipoamide succinyltransferase

Discussion

Previous studies have revealed the association of five variants with AD, including OGG1 rs1052133, BIN1 rs744373, SORL1 rs1133174, PSEN2 rs8383, and NGF rs6330 (15,23–27). And BIN1 rs744373 was found to have no interaction with APOE ε4 genotype (28). In the present study, we were unable to repeat the association of the above five variants with AD. And further APOE ε4 based subgroup analysis indicated that APOE ε4 did not have significant effects on five genetic polymorphisms. This might be explained by the moderate power and different ethnic background in the present pilot study. Future validation is needed in cohort with more samples.

DLST is a core component of KGDHC which is essential in the citric acid cycle (29). Deficiency of DLST will increase production of free radicals thereby inducing mitochondrial damage (29), which leads to an increase in the generation of reactive oxygen species (ROS). ROS damage various molecules, including DNA, protein and lipid, and induce apoptosis (30), eventually leading to the occurrence of AD (31). The results of this study suggest that DLST hypomethylation may contribute to the pathogenesis of AD in females. Women are more likely to have AD than men because women tend live longer than men (32–34). This finding might also help explain the sex differences in the risk of AD (35).

There were several limitations in the current study. Firstly, our pilot study only involved a moderate number of subjects (17 AD cases and 34 controls). This was due to the incidence rate of AD being low in Xinjiang. However, we chose a total of 51 well preserved samples, for which the transport process was reasonable and the basic informations were completed and matched. We were unable to validate the association of five gene polymorphisms (OGG1 rs1052133, BIN1 rs744373, SORL1 rs1133174, PSEN2 rs8383, and NGF rs6330) with AD in the Xinjiang population. This might be due to the limited number of samples in this study. Secondly, we only selected a fragment in the promoter CpG rich region to represent the methylation of OGG1 and DLST. The methylation of other regions of the two genes might be explored in the future. Thirdly, Xinjiang Uygur Autonomous Region is a multi-ethnic area. Future research with larger sample sets and more ethnic populations are required to confirm the present findings.

In summary, we found that the levels of DLST methylation were decreased in AD patients, especially in female AD patients. The results showed that the level of OGG1 promoter methylation might be interacted with APOE ε4 genotype.

Acknowledgements

The authors would like to thank Professor Xiaohui Zhou for providing guidance on the implementation of this project, and thank Professor Shiwei Duan of the Basic Medical College of Ningbo University in Zhejiang Province for supporting the experiment and thesis writing.

Funding

This research was supported by the grants from the National Natural Science Foundation of China (grant no. U1503223).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

SD, XZ and QW conceived and designed the experiments. WC, TZ, YD, GL and XY performed the experiments. WC and GL analyzed the data. GL and XY contributed reagents/materials/analysis tools. WC, TZ and YD wrote the manuscript.

Ethics approval and consent to participate

The present study was approved by the First Affiliated Hospital of Xinjiang Medical University Ethics Committee. All the patients gave their written informed consent forms for the present study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Mancuso C, Bates TE, Butterfield DA, Calafato S, Cornelius C, De Lorenzo A, Kostova Dinkova AT and Calabrese V: Natural antioxidants in Alzheimer's disease. Expert Opin Investig Drugs. 16:1921–1931. 2007. View Article : Google Scholar : PubMed/NCBI

2 

Feil R and Fraga MF: Epigenetics and the environment: Emerging patterns and implications. Nat Rev Genet. 13:97–109. 2012. View Article : Google Scholar : PubMed/NCBI

3 

Xiaoping L, Zhibin Y, Wenjuan L, Zeyou W, Gang X, Zhaohui L, Ying Z, Minghua W and Guiyuan L: CPEB1, a histone-modified hypomethylated gene, is regulated by miR-101 and involved in cell senescence in glioma. Cell Death Dis. 4:e6752013. View Article : Google Scholar : PubMed/NCBI

4 

Fabi E, Fusco A, Valiante M and Celli R: Genetics and epigenetics of schizophrenia. Clin Ter. 164:e319–e324. 2013.(In Italian). PubMed/NCBI

5 

Bian JT, Zhang JW, Zhang ZX and Zhao HL: Association analysis of brain-derived neurotrophic factor (BDNF) gene 196 A/G polymorphism with Alzheimer's disease (AD) in mainland Chinese. Neurosci Lett. 387:11–16. 2005. View Article : Google Scholar : PubMed/NCBI

6 

Singh SK, Srivastav S, Yadav AK, Srikrishna S and Perry G: Overview of Alzheimer's disease and some therapeutic approaches targeting Aβ by using several synthetic and herbal compounds. Oxid Med Cell Longev. 2016:73616132016. View Article : Google Scholar : PubMed/NCBI

7 

Chapuis J, Hansmannel F, Gistelinck M, Mounier A, Van Cauwenberghe C, Kolen KV, Geller F, Sottejeau Y, Harold D, Dourlen P, et al: Increased expression of BIN1 mediates Alzheimer genetic risk by modulating tau pathology. Mol Psychiatry. 18:1225–1234. 2013. View Article : Google Scholar : PubMed/NCBI

8 

Zhang F, Liu X, Wang B, Cheng Z, Zhao X, Zhu J, Wang D, Wang Y, Dong A, Li P and Jin C: An exploratory study of the association between SORL1 polymorphisms and sporadic Alzheimer's disease in the Han Chinese population. Neuropsychiatr Dis Treat. 11:1443–1448. 2014.

9 

Xu CJ, Wang JL and Jin WL: The emerging therapeutic role of NGF in Alzheimer's disease. Neurochem Res. 41:1211–1218. 2016. View Article : Google Scholar : PubMed/NCBI

10 

Cai Y, An SS and Kim S: Mutations in presenilin 2 and its implications in Alzheimer's disease and other dementia-associated disorders. Clin Interv Aging. 10:1163–1172. 2015.PubMed/NCBI

11 

Schellenberg GD and Montine TJ: The genetics and neuropathology of Alzheimer's disease. Acta Neuropathol. 124:305–323. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Tan L, Yu JT, Zhang W, Wu ZC, Zhang Q, Liu QY, Wang W, Wang HF, Ma XY and Cui WZ: Association of GWAS-linked loci with late-onset Alzheimer's disease in a northern Han Chinese population. Alzheimers Dement. 9:546–553. 2013. View Article : Google Scholar : PubMed/NCBI

13 

Rogaeva E, Meng Y, Lee JH, Gu Y, Kawarai T, Zou F, Katayama T, Baldwin CT, Cheng R, Hasegawa H, et al: The neuronal sortilin-related receptor SORL1 is genetically associated with Alzheimer disease. Nat Genet. 39:168–177. 2007. View Article : Google Scholar : PubMed/NCBI

14 

Chen C, Zhou Z, Li M, Qu M, Ma Q, Zhong M, Zhang Y and Yu Z: Presenilin-2 polymorphisms and risk of sporadic AD: Evidence from a meta-analysis. Gene. 503:194–199. 2012. View Article : Google Scholar : PubMed/NCBI

15 

Jacob KD, Hooten Noren N, Tadokoro T, Lohani A, Barnes J and Evans MK: Alzheimer's disease-associated polymorphisms in human OGG1 alter catalytic activity and sensitize cells to DNA damage. Free Radic Biol Med. 63:115–125. 2013. View Article : Google Scholar : PubMed/NCBI

16 

Shao C, Xiong S, Li GM, Gu L, Mao G, Markesbery WR and Lovell MA: Altered 8-oxoguanine glycosylase in mild cognitive impairment and late-stage Alzheimer's disease brain. Free Radic Biol Med. 45:813–819. 2008. View Article : Google Scholar : PubMed/NCBI

17 

Coppedè F, Tannorella P, Stoccoro A, Chico L, Siciliano G, Bonuccelli U and Migliore L: Methylation analysis of DNA repair genes in Alzheimer's disease. Mech Ageing Dev. 161:105–111. 2017. View Article : Google Scholar : PubMed/NCBI

18 

Nakano K, Ohta S, Nishimaki K, Miki T and Matuda S: Alzheimer's disease and DLST genotype. Lancet. 350:1367–1368. 1997. View Article : Google Scholar : PubMed/NCBI

19 

Sheu KF, Brown AM, Haroutunian V, Kristal BS, Thaler H, Lesser M, Kalaria RN, Relkin NR, Mohs RC, Lilius L, et al: Modulation by DLST of the genetic risk of Alzheimer's disease in a very elderly population. Ann Neurol. 45:48–53. 1999. View Article : Google Scholar : PubMed/NCBI

20 

Sheu KF, Brown AM, Kristal BS, Kalaria RN, Lilius L, Lannfelt L and Blass JP: A DLST genotype associated with reduced risk for Alzheimer's disease. Neurology. 52:1505–1507. 1999. View Article : Google Scholar : PubMed/NCBI

21 

Fischer BA: A review of American psychiatry through its diagnoses: The history and development of the diagnostic and statistical manual of mental disorders. J Nerv Ment Dis. 200:1022–1030. 2012. View Article : Google Scholar : PubMed/NCBI

22 

Ma W, Zhou X, Ji H, Luo M, Liu G, Li J, Wang Q and Duan S: Population difference in the association of BDNF promoter methylation with mild cognitive impairment in the Xinjiang Uygur and Han populations. Psychiatry Res. 229:926–932. 2015. View Article : Google Scholar : PubMed/NCBI

23 

Kwiatkowski D, Czarny P, Toma M, Jurkowska N, Sliwinska A, Drzewoski J, Bachurska A, Szemraj J, Maes M, Berk M, et al: Associations between DNA damage, DNA base excision repair gene variability and Alzheimer's disease risk. Dement Geriatr Cogn Disord. 41:152–171. 2016. View Article : Google Scholar : PubMed/NCBI

24 

Zhu R, Xu L and He Z: The bridging integrator 1 gene polymorphism rs744373 and the risk of Alzheimer's disease in caucasian and Asian populations: An updated meta-analysis. Mol Neurobiol. 54:1419–1428. 2017. View Article : Google Scholar : PubMed/NCBI

25 

Feng X, Hou D, Deng Y, Li W, Tian M and Yu Z: SORL1 gene polymorphism association with late-onset Alzheimer's disease. Neurosci Lett. 584:382–389. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Xue X, Zhang M, Lin Y, Xu E and Jia J: Association between the SORL1 rs2070045 polymorphism and late-onset Alzheimer's disease: Interaction with the ApoE genotype in the Chinese Han population. Neurosci Lett. 559:94–98. 2014. View Article : Google Scholar : PubMed/NCBI

27 

Di Maria E, Giorgio E, Uliana V, Bonvicini C, Faravelli F, Cammarata S, Novello MC, Galimberti D, Scarpini E, Zanetti O, et al: Possible influence of a non-synonymous polymorphism located in the NGF precursor on susceptibility to late-onset Alzheimer's disease and mild cognitive impairment. J Alzheimers Dis. 29:699–705. 2012. View Article : Google Scholar : PubMed/NCBI

28 

Gharesouran J, Rezazadeh M, Khorrami A, Ghojazadeh M and Talebi M: Genetic evidence for the involvement of variants at APOE, BIN1, CR1, and PICALM loci in risk of late-onset Alzheimer's disease and evaluation for interactions with APOE genotypes. J Mol Neurosci. 54:780–786. 2014. View Article : Google Scholar : PubMed/NCBI

29 

Keßler M, Berger IM, Just S and Rottbauer W: Loss of dihydrolipoyl succinyltransferase (DLST) leads to reduced resting heart rate in the zebrafish. Basic Res Cardiol. 110:142015. View Article : Google Scholar : PubMed/NCBI

30 

Kanamori T, Nishimaki K, Asoh S, Ishibashi Y, Takata I, Kuwabara T, Taira K, Yamaguchi H, Sugihara S, Yamazaki T, et al: Truncated product of the bifunctional DLST gene involved in biogenesis of the respiratory chain. EMBO J. 22:2913–2923. 2003. View Article : Google Scholar : PubMed/NCBI

31 

Schulz JB, Lindenau J, Seyfried J and Dichgans J: Glutathione, oxidative stress and neurodegeneration. Eur J Biochem. 267:4904–4911. 2000. View Article : Google Scholar : PubMed/NCBI

32 

Alzheimer's Association: 2014 Alzheimer's disease facts and figures. Alzheimers Dement. 10:e47–e92. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Mangialasche F, Kivipelto M, Solomon A and Fratiglioni L: Dementia prevention: Current epidemiological evidence and future perspective. Alzheimers Res Ther. 4:62012. View Article : Google Scholar : PubMed/NCBI

34 

Solomon A, Kivipelto M and Soininen H: Prevention of Alzheimer's disease: Moving backward through the lifespan. J Alzheimers Dis. 33 Suppl 1:S465–S469. 2013. View Article : Google Scholar : PubMed/NCBI

35 

Chen R, Hu Z, Wei L, Ma Y, Liu Z and Copeland JR: Incident dementia in a defined older Chinese population. PLoS One. 6:e248172011. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen W, Zhou X, Duan Y, Zou T, Liu G, Ying X, Wang Q and Duan S: Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population. Exp Ther Med 16: 3135-3142, 2018.
APA
Chen, W., Zhou, X., Duan, Y., Zou, T., Liu, G., Ying, X. ... Duan, S. (2018). Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population. Experimental and Therapeutic Medicine, 16, 3135-3142. https://doi.org/10.3892/etm.2018.6524
MLA
Chen, W., Zhou, X., Duan, Y., Zou, T., Liu, G., Ying, X., Wang, Q., Duan, S."Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population". Experimental and Therapeutic Medicine 16.4 (2018): 3135-3142.
Chicago
Chen, W., Zhou, X., Duan, Y., Zou, T., Liu, G., Ying, X., Wang, Q., Duan, S."Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population". Experimental and Therapeutic Medicine 16, no. 4 (2018): 3135-3142. https://doi.org/10.3892/etm.2018.6524
Copy and paste a formatted citation
x
Spandidos Publications style
Chen W, Zhou X, Duan Y, Zou T, Liu G, Ying X, Wang Q and Duan S: Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population. Exp Ther Med 16: 3135-3142, 2018.
APA
Chen, W., Zhou, X., Duan, Y., Zou, T., Liu, G., Ying, X. ... Duan, S. (2018). Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population. Experimental and Therapeutic Medicine, 16, 3135-3142. https://doi.org/10.3892/etm.2018.6524
MLA
Chen, W., Zhou, X., Duan, Y., Zou, T., Liu, G., Ying, X., Wang, Q., Duan, S."Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population". Experimental and Therapeutic Medicine 16.4 (2018): 3135-3142.
Chicago
Chen, W., Zhou, X., Duan, Y., Zou, T., Liu, G., Ying, X., Wang, Q., Duan, S."Association of OGG1 and DLST promoter methylation with Alzheimer's disease in Xinjiang population". Experimental and Therapeutic Medicine 16, no. 4 (2018): 3135-3142. https://doi.org/10.3892/etm.2018.6524
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team