Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
December-2018 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
December-2018 Volume 16 Issue 6

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article Open Access

Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke

  • Authors:
    • Lei Chen
    • Feng Lu
    • Zhan Wang
    • Liwei Liu
    • Lizhi Yin
    • Jing Zhang
    • Qiang Meng
  • View Affiliations / Copyright

    Affiliations: Department of Cardiothoracic Surgery, The People's Hospital of Zhangqiu District, Jinan, Shandong 250000, P.R. China, ECG Room, Yantaishan Hospital, Yantai, Shandong 264000, P.R. China, Endoscopy Center, The Affiliated Central Hospital of Qingdao University, Qingdao, Shandong 266000, P.R. China, Health Management Center, The People's Hospital of Zhangqiu District, Jinan, Shandong 250000, P.R. China, Department of Cardiovascular Surgery, The People's Hospital of Rizhao,Rizhao, Shandong 276800, P.R. China, Ward 2, ICU, Jining No. 1 People's Hospital, Jining Medical University, Jining, Shandong 272100, P.R. China
    Copyright: © Chen et al. This is an open access article distributed under the terms of Creative Commons Attribution License.
  • Pages: 5166-5170
    |
    Published online on: October 9, 2018
       https://doi.org/10.3892/etm.2018.6842
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

This study investigated the correlation between interleukin (IL)-1β-511C/T gene polymorphism and myocardial infarction (MI) complicated with ischemic stroke (IS). A total of 251 MI patients complicated with IS (observation group) and 200 healthy people (control group) were selected for the case-control study. IL-1β‑511C/T gene polymorphism was detected via polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). The genotype distribution and allele frequency were compared between the two groups, and the correlation between gene polymorphism and MI complicated with IS, was analyzed after traditional risk factors were adjusted by using logistic regression method. The frequencies of CT and TT genotypes in the observation group were higher than those in the control group (P<0.05). The frequency of T allele in the observation group was significantly higher than that in the control group (P<0.05), but the frequency of C allele was obviously lower than that in the control group (P<0.05). According to results of logistic regression analysis, arrhythmia and high-density lipoprotein cholesterol (HDL-C) were associated with MI complicated with IS. In patients with arrhythmia, the risk of disease in carriers with IL-1β‑511T gene was 1.7-1.8 times that in non-carriers [odds ratio (OR) = 1.742 and 1.839, P<0.05]. In patients with abnormal HDL-C, the risk of disease in carriers with IL-1β‑511T gene was 2.0-2.2 times that in non-carriers (OR = 2.011 and 2.249, P<0.05). Besides, the risk of MI complicated with IS in carriers with CC genotype had no significant difference in patients with arrhythmia and abnormal HDL-C (P>0.05). IL-1β-511C/T gene polymorphism may be related to the risk of MI complicated with IS.

Introduction

Myocardial infarction (MI) is a severe cardiovascular disease, which is often accompanied with increased activity of serum myocardial enzyme and progressive changes in electrocardiograms (ECGs), and may lead to arrhythmia, shock and heart failure (1). Ischemic stroke (IS) is a common complication of MI (2), which can be caused by a variety of factors. The incidence rate of IS is high in the elderly, and the disease severely affects the prognosis of MI patients (3). MI patients complicated with IS have a significantly higher mortality rate than patients with MI alone (4,5), which has attracted extensive attention in the clinic. Studies have shown that there are often abnormal ECG changes of patients with acute IS, and ECG changes of these patients are very sensitive with a very low specificity, suggesting that ECGs are insufficient to be used as a diagnostic criterion for IS (6). The major pathological basis of IS is atherosclerosis (7), and the relevant inflammatory response during atherosclerosis is mainly initiated jointly by interleukin (IL) and some other related factors (8,9).

IL is an important pro-inflammatory factor playing an important role in ischemic brain injury (10,11). It has been proved in studies that IL-1 gene polymorphism has a certain correlation with cerebral infarction (12,13). IL-1 family members include IL-1α, IL-1β and IL-1Ra, the first two of which can be involved in the senescence of vascular endothelial cells and inflammatory response of hypoxic-ischemic brain injury, thereby affecting the function of vascular endothelial cells and atherosclerosis process (14). Studies have revealed that there is C/T polymorphism in the IL-1β-511 locus (15), which may be related to the occurrence of IS (16). This study investigated the correlation between IL-1β-511C/T gene polymorphism and MI complicated with IS, so as to provide references for future research.

Materials and methods

General data

A total of 251 MI patients treated in the People's Hospital of Zhangqiu District (Jinan, China) from September 2014 to October 2017 were selected as observation group, including 136 males and 115 females with an average age of 62.8±5.4 years. The diagnostic criteria met the universal definition of MI in 2012. Patients with cerebral hemorrhage and space-occupying lesions were excluded. Another 200 healthy people receiving physical examination in People's Hospital of Zhangqiu District during the same period were selected as control group, including 101 males and 99 females with an average age of 61.2±6.8 years, and they had no recent inflammation. The study was approved by the Ethics Committee of People's Hospital of Zhangqiu District. Patients who participated in this research, signed an informed consent and had complete clinical data.

Research methods
Main reagents

Wizard whole blood deoxyribonucleic acid (DNA) extraction kit, Taq DNA polymerase, polymerase chain reaction (PCR) product purification and recycling kit, and restriction endonuclease NcoI were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Primers used in this study were all synthesized by Nanjing GenScript Biotechnology Corp. (Nanjing, China).

Specimen collection

After 2 ml fasting venous blood was collected, and ethylene diamine tetraacetic acid (EDTA) was added for anticoagulation in accordance with instructions of the Wizard whole blood DNA extraction kit. A total of 300 µl whole blood was added with 900 µl cell lysis solution, shaken fully and mixed evenly, followed by incubation at room temperature for 5 min and centrifugation at 13,000 × g at room temperature for 15 sec. Then the supernatant was discarded. The nuclear lysis solution was added and mixed evenly with the sediment, and the protein precipitation solution was added and mixed evenly, followed by centrifugation at 13,000 × g for 3 min. The supernatant was transferred into a new centrifuge tube, and 30 µl isopropanol was added to precipitate DNA. After centrifugation, the sediment was washed twice with 70% ethanol, and added with DNA dissolving solution to obtain the whole blood DNA.

IL-1β-511C/T amplification

The PCR primers of IL-1β-511C/T gene were designed according to the study of Li et al (17), and synthesized by Nanjing GenScript Biotechnology Corp. Primer sequences are shown in Table I. A total of 20 µl PCR system included 2 µl buffer, 2 µl dNTPs, 0.5 µl forward primers and 0.5 µl reverse primers, 1 µl Taq enzyme, 1 µl DNA, and 20 µl ddH2O. PCR conditions are as follows: 95°C for 5 min, 95°C for 50 sec, 58°C for 50 sec, and 72°C for 1 min for a total of 30 cycles, and 72°C for 10 min. According to instructions of the PCR product purification and recycling kit, the PCR products were purified and recycled for subsequent enzyme digestion assay.

Table I.

Primer sequences of IL-1β-511C/T amplification.

Table I.

Primer sequences of IL-1β-511C/T amplification.

SNPPrimer sequence (5′-3′)Fragment length (bp)Tm value
IL-1β-511C/TF: TGGCATTGATCTGGTTCATC30458°C
R: GTTTAGGAATCTTCCCACTT

[i] IL, interleukin; F, forward; R, reverse.

Enzyme digestion reaction and genotype analysis

Enzyme digestion reaction was performed for the above-mentioned recycled PCR products. A total of 10 µl enzyme digestion reaction systems included 1 µl buffer, 1 µl restriction endonuclease Ava I, and 8 µl recycled PCR products. The reaction was performed at 37°C for 6 h. The products after enzyme digestion were separated via 1.5% agarose gel electrophoresis. The product fragment size was detected by using the GeneSnap software of Syngene gel imaging system, based on which the different genotypes were determined. Each genotype was analyzed by using the fragment content (Table II).

Table II.

Enzyme digestion fragment length and genotyping.

Table II.

Enzyme digestion fragment length and genotyping.

Enzyme digestion fragment (bp)

SNPEnzyme digestion siteCCCTTT
IL-1β-511C/TAva I190114304190114304

[i] IL, interleukin.

Statistical analysis

Statistical Product and Service Solutions (SPSS) 17.0 (SPSS, Inc., Chicago, IL, USA) was used for statistical processing. Measurement data are presented as mean ± standard deviation. t-test was used for the analysis between two groups, and Chi-square test was used for enumeration data. P<0.05 was considered to indicate a statistically significant difference. The correlation between IL-1β-511C/T and MI complicated with IS was detected via logistic regression analysis.

Results

Analysis of clinical data in both groups

All the participants of the study in both groups had complete clinical data (Tables III and IV). There were no significant differences in age, sex, history of hypertension and smoking history between the two groups (P>0.05), but the history of diabetes mellitus and arrhythmia had significant differences (P<0.05). No significant differences were found in the blood routine examination at admission between the two groups (P>0.05). In blood lipid indexes, there was a significant difference in the high-density lipoprotein cholesterol (HDL-C) level between the two groups (P<0.05), and the level was obviously lower in the observation group than that in the control group. Other indexes had no significant differences (P>0.05).

Table III.

Comparison of clinical data between the two groups.

Table III.

Comparison of clinical data between the two groups.

GroupsnAge (years)Male n (%)Hypertension n (%)Diabetes mellitus n (%)Smoking n (%)Arrhythmia n (%)
Control20061.20±6.80101 (50.50)113 (56.50)30 (15.00)62 (31.00)5 (2.50)
Observation25162.80±5.40136 (54.20)140 (55.80)71 (28.30)76 (30.30)176 (70.10)
χ2 0.1020.2940.01910.7860.025211.827
P-value 0.7660.5880.8910.0010.876<0.001

Table IV.

Comparison of blood routine and blood lipid data between the two groups (mean ± SD).

Table IV.

Comparison of blood routine and blood lipid data between the two groups (mean ± SD).

Blood routine (109/l)Blood lipid (mmol/l)


GroupsnRBC countHb (g/l)WBC countNEU countPLT countHDL-CLDL-CTCTG
Control2004.05±0.53115.54±18.8510.35±4.538.03±4.85235.41±68.331.45±0.252.78±0.574.78±0.831.38±0.45
Observation2514.13±0.45110.36±15.489.87±3.237.59±2.89231.28±70.191.32±0.212.66±0.624.59±0.921.58±1.03
t value 0.6232.6220.640.3893.8465.6294.1573.657−0.597
P-value 0.5970.1170.5880.7350.0610.030.0530.0670.611

[i] RBC, red blood cell; Hb, hemoglobin; WBC, white blood cell; NEU, neutrophil; PLT, platelet; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; TC, total cholesterol; TG, triglyceride.

Analysis of IL-1β-511C/T gene polymorphism in two groups

IL-1β-511C/T genotype distribution and allele frequency were significantly different between the observation and the control groups (P<0.05) (Table V). CT and TT genotype frequencies in the observation group were all higher than those in the control group. The frequency of T allele in the observation was remarkably higher than that in the control group, but the frequency of C allele was obviously lower than that in the control group.

Table V.

Comparison of IL-1β-511C/T genotype and allele frequency between the two groups.

Table V.

Comparison of IL-1β-511C/T genotype and allele frequency between the two groups.

Genotype frequency, n (%)Allele frequency, n (%)


GroupsCCCTTTC T
Control (n=200)143 (71.50)37 (18.50)20 (10.00)323 (80.75) 77 (19.25)
Observation (n=251)134 (53.39)80 (31.87)37 (14.70)348 (69.30) 154 (30.68)
χ2 15.598 15.259
P-value <0.001 <0.001

[i] IL, interleukin.

Results of multivariate logistic regression analysis

The correlations of diabetes mellitus, arrhythmia and HDL-C with MI complicated with IS were analyzed via logistic regression analysis. It was found that arrhythmia and HDL-C were related to MI complicated with IS (P<0.05) (Table VI). The effect of IL-1β-511C/T gene polymorphism on MI complicated with IS was analyzed. Results of logistic regression analysis (Table VII) showed that in patients with arrhythmia, the risk of disease in carriers of IL-1β-511T gene (n=117) was 1.7–1.8 times that in non-carriers (n=59) [odds ratio (OR) = 1.742 and 1.839, P<0.05]. In patients with abnormal HDL-C, the risk of disease in carriers of IL-1β-511T gene (n=132) was 2.0–2.2 times that in non-carriers (n=51) (OR =2.011 and 2.249, P<0.05). Besides, the risk of MI complicated with IS in carriers of CC genotype had no significant difference in patients with arrhythmia and abnormal HDL-C (P>0.05).

Table VI.

Logistic regression analysis of risk factors of MI complicated with IS.

Table VI.

Logistic regression analysis of risk factors of MI complicated with IS.

FactorOR(95% CI)P-value
Diabetes mellitus1.0380.997–1.0310.192
Arrhythmia0.1470.027–0.3370.026
HDL-C1.2311.067–2.3580.031

[i] MI, myocardial infarction; OR, odds ratio; HDL-C, high-density lipoprotein cholesterol; CI, confidence interval.

Table VII.

Logistic regression analysis of IL-1β-511 locus.

Table VII.

Logistic regression analysis of IL-1β-511 locus.

ArrhythmiaHDL-C


IL-1β-511 genotypenOR95% CIP-valuenOR95% CIP-value
CC591.2130.519–2.3040.651510.8740.484–1.8520.752
CT801.7421.036–2.0290.029892.0111.062–2.3530.009
TT371.8391.098–2.2490.017432.2491.634–2.548<0.001

[i] IL, interleukin; HDL-C, high-density lipoprotein cholesterol; OR, odds ratio; CI, confidence interval.

Discussion

As a common complication of MI, IS has different pathogenesis and complex and diversified symptoms, bringing difficulties to clinical prediction (18). The main reason for MI complicated with IS is cardiogenic cerebral embolism, which occurs more easily in patients accompanied with atrial arrhythmia or intracardiac mural thrombus. Besides, hypotension, reflex cerebral arterial spasm, and simultaneous thrombosis in cerebral artery and coronary artery are also important causes of MI complicated with IS (19).

IL can act on multiple systems in the body, which possesses extensive biological effects and can mediate inflammatory reactions and participate in immune regulation, lipid metabolism and other physiological processes (20). In the IL-1 family, IL-1α and IL-1β, through inhibiting the endothelial cell proliferation, can induce the expression of adhesion molecules, lead to aggregation of monocytes and lymphocytes, promote thrombosis, and accelerate the formation of atherosclerosis (21). IL plays an important role in IS. Studies have manifested that there are polymorphisms in the IL-1α-889-C/T and IL-1β-511C/T loci, which have been found to be able to affect the activity of IL-1, and change the occurrence and development of hypertension and coronary heart disease, by affecting the inflammatory response (22). In this study, results revealed that both IL-1β-511C/T genotype distribution and allele frequency were significantly different between the observation and the control groups (P<0.05). The frequencies of CT genotype and TT genotype in the observation were higher than those in the control group, and the frequency of T allele in the observation was significantly higher than that in the control group (P<0.05), which were consistent with results obtained previously (23). According to results of logistic regression analysis, arrhythmia and HDL-C were associated with MI complicated with IS. In patients with arrhythmia, the risk of disease in carriers with IL-1β-511T gene was 1.7–1.8 times that in non-carriers (OR = 1.742 and 1.839, P<0.05). In patients with abnormal HDL-C, the risk of disease in carriers with IL-1β-511T gene was 2.0–2.2 times that in non-carriers (OR =2.011 and 2.249, P<0.05). Besides, the risk of MI complicated with IS in carriers with CC genotype had no significant difference in patients with arrhythmia and abnormal HDL-C (P>0.05). The above results indicate that the MI complicated with IS is related to the increase of IL-1β-511 T allele frequency. IL-1β-511 T may indirectly affect the occurrence of IS through affecting arrhythmia and HDL-C content. However, some studies also argued that there is no correlation between IL-1β-511C/T polymorphism and IS (24), which may be related to the sample size, regional differences and dynamic development of disease. In addition, the precipitating factors of MI may be different from those of stroke caused by other factors, thus leading to differences in results.

In conclusion, results of this study suggest that the IL-1β-511C/T gene polymorphism may be involved in the occurrence and development of MI complicated with IS. However, clinical cases in only one region were observed in this experimental study, which had certain limitations, so studies involving more regions are needed to confirm the conclusion. Moreover, this study broadens thoughts for the research on MI complicated with IS at the level of gene polymorphism, and provides more possibilities for the prediction and treatment of MI complicated with IS.

Acknowledgements

Not applicable.

Funding

No funding was received.

Availability of data and materials

The datasets used and/or analyzed during the present study are available from the corresponding author on reasonable request.

Authors' contributions

LC and FL wrote this manuscript and collected specimen. LL and LY were responsible for PCR. ZW, JZ and QM contributed to enzyme digestion reaction and genotype analysis. All authors read and approved the final study.

Ethics approval and consent to participate

The study was approved by the Ethics Committee of People's Hospital of Zhangqiu District (Jinan, China). Patients who participated in this research had complete clinical data. Signed informed consents were obtained from the patients or the guardians.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Thygesen K, Alpert JS, Jaffe AS, Simoons ML, Chaitman BR, White HD, Thygesen K, Alpert JS, White HD, Jaffe AS, et al; Writing Group on the Joint ESC/ACCF/AHA/WHF Task Force for the Universal Definition of Myocardial Infarction; ESC Committee for Practice Guidelines (CPG), . Third universal definition of myocardial infarction. Eur Heart J. 33:2551–2567. 2012. View Article : Google Scholar : PubMed/NCBI

2 

Yang CJ, Chen PC, Lin CS, Tsai CL and Tsai SH: Thrombolytic therapy-associated acute myocardial infarction in patients with acute ischemic stroke: A treatment dilemma. Am J Emerg Med. 35:804.e1–804.e3. 2017. View Article : Google Scholar

3 

Ariza-Sole A, Alegre O, Elola FJ, Fernandez C, Formiga F, Martinez-Selles M, Bernal JL, Segura JV, Iniguez A, Bertomeu V, et al: Management of myocardial infarction in the elderly. Insights from Spanish Minimum Basic Data Set. Eur Heart J Acute Cardiovasc Care. July 1–2017.(Epub ahead of print). View Article : Google Scholar

4 

Kuster GW, Baruzzi AC, Pacheco EP, Domingues RB, Pieruccetti M, Giacon LM, Garcia JC, Furlan V and Massaro AR: Early reperfusion therapy in acute ischemic stroke after recent myocardial infarction. Arq Neuropsiquiatr. 74:690–691. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Widimsky P, Coram R and Abou-Chebl A: Reperfusion therapy of acute ischaemic stroke and acute myocardial infarction: Similarities and differences. Eur Heart J. 35:147–155. 2014. View Article : Google Scholar : PubMed/NCBI

6 

Zerna C, Hegedus J and Hill MD: Evolving treatments for acute ischemic stroke. Circ Res. 118:1425–1442. 2016. View Article : Google Scholar : PubMed/NCBI

7 

Fan J and Watanabe T: Inflammatory reactions in the pathogenesis of atherosclerosis. J Atheroscler Thromb. 10:63–71. 2003. View Article : Google Scholar : PubMed/NCBI

8 

Dewberry R, Holden H, Crossman D and Francis S: Interleukin-1 receptor antagonist expression in human endothelial cells and atherosclerosis. Arterioscler Thromb Vasc Biol. 20:2394–2400. 2000. View Article : Google Scholar : PubMed/NCBI

9 

Akita K, Isoda K, Sato-Okabayashi Y, Kadoguchi T, Kitamura K, Ohtomo F, Shimada K and Daida H: An interleukin-6 receptor antibody suppresses atherosclerosis in atherogenic mice. Front Cardiovasc Med. 4:842017. View Article : Google Scholar : PubMed/NCBI

10 

Boutin H, LeFeuvre RA, Horai R, Asano M, Iwakura Y and Rothwell NJ: Role of IL-1α and IL-1β in ischemic brain damage. J Neurosci. 21:5528–5534. 2001. View Article : Google Scholar : PubMed/NCBI

11 

Sordillo PP, Sordillo LA and Helson L: Bifunctional role of pro-inflammatory cytokines after traumatic brain injury. Brain Inj. 30:1043–1053. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Katakami N, Kaneto H, Osonoi T, Kawai K, Ishibashi F, Imamura K, Maegawa H, Kashiwagi A, Watada H, Kawamori R, et al: Transforming growth factor beta1 T868C gene polymorphism is associated with cerebral infarction in Japanese patients with type 2 diabetes. Diabetes Res Clin Pract. 94:e57–60. 2011. View Article : Google Scholar : PubMed/NCBI

13 

Fan N, Wang J, Deng Y, Zhu J, Mei J, Chen Y and Yang H: Association between genetic polymorphisms of interleukins and cerebral infarction risk: a meta-analysis. Biosci Rep. 36:e004042016.doi: 10.1042/BSR20160226. PubMed/NCBI

14 

Mariotti M, Castiglioni S, Bernardini D and Maier JA: Interleukin 1 alpha is a marker of endothelial cellular senescent. Immun Ageing. 3:42006. View Article : Google Scholar : PubMed/NCBI

15 

Slowik A, Borratynska A, Turaj W, Pera J, Dziedzic T, Wloch D, Szczudlik A, Betlej M, Krzyszkowski T and Czepko R: Interleukin 1beta-511 C/T polymorphism and risk of aneurysmal subarachnoid haemorrhage. J Neurol Neurosurg Psychiatry. 77:279–280. 2006. View Article : Google Scholar : PubMed/NCBI

16 

Um JY, Moon KS, Lee KM, Yun JM, Cho KH, Moon BS and Kim HM: Association of interleukin-1 alpha gene polymorphism with cerebral infarction. Brain Res Mol Brain Res. 115:50–54. 2003. View Article : Google Scholar : PubMed/NCBI

17 

Li N, He Z, Xu J, Liu F, Deng S and Zhang H: Association of PDE4D and IL-1 gene polymorphism with ischemic stroke in a Han Chinese population. Brain Res Bull. 81:38–42. 2010. View Article : Google Scholar : PubMed/NCBI

18 

Ulvenstam A, Kajermo U, Modica A, Jernberg T, Söderström L and Mooe T: Incidence, trends, and predictors of ischemic stroke 1 year after an acute myocardial infarction. Stroke. 45:3263–3268. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Hosomi N, Yoshimoto T, Kanaya Y, Neshige S, Hara N, Himeno T, Kono R, Takeshima S, Takamatsu K, Ota T, et al: Brain natriuretic peptide and particular left ventricle segment asynergy associated with cardioembolic stroke from old myocardial infarction. J Stroke Cerebrovasc Dis. 25:1165–1171. 2016. View Article : Google Scholar : PubMed/NCBI

20 

Lust JA, Lacy MQ, Zeldenrust SR, Dispenzieri A, Gertz MA, Witzig TE, Kumar S, Hayman SR, Russell SJ, Buadi FK, et al: Induction of a chronic disease state in patients with smoldering or indolent multiple myeloma by targeting interleukin 1{beta}-induced interleukin 6 production and the myeloma proliferative component. Mayo Clin Proc. 84:114–122. 2009. View Article : Google Scholar : PubMed/NCBI

21 

Dominici R, Cattaneo M, Malferrari G, Archi D, Mariani C, Grimaldi LM and Biunno I: Cloning and functional analysis of the allelic polymorphism in the transcription regulatory region of interleukin-1 alpha. Immunogenetics. 54:82–86. 2002. View Article : Google Scholar : PubMed/NCBI

22 

Vohnout B, Di Castelnuovo A, Trotta R, D'Orazi A, Panniteri G, Montali A, Donati MB, Arca M and Iacoviello L: Interleukin-1 gene cluster polymorphisms and risk of coronary artery disease. Haematologica. 88:54–60. 2003.PubMed/NCBI

23 

Shiotani A, Sakakibara T, Nomura M, Yamanaka Y, Nishi R, Imamura H, Tarumi K, Kamada T, Hata J and Haruma K: Aspirin-induced peptic ulcer and genetic polymorphisms. J Gastroenterol Hepatol. 25 Suppl 1:S31–S34. 2010. View Article : Google Scholar : PubMed/NCBI

24 

Dziedzic T, Slowik A, Pera J and Szczudlik A: Lack of association between interleukin-1 β polymorphism (−511) and ischaemic stroke. J Neurol Neurosurg Psychiatry. 75:170–171. 2004.PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Chen L, Lu F, Wang Z, Liu L, Yin L, Zhang J and Meng Q: Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke. Exp Ther Med 16: 5166-5170, 2018.
APA
Chen, L., Lu, F., Wang, Z., Liu, L., Yin, L., Zhang, J., & Meng, Q. (2018). Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke. Experimental and Therapeutic Medicine, 16, 5166-5170. https://doi.org/10.3892/etm.2018.6842
MLA
Chen, L., Lu, F., Wang, Z., Liu, L., Yin, L., Zhang, J., Meng, Q."Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke". Experimental and Therapeutic Medicine 16.6 (2018): 5166-5170.
Chicago
Chen, L., Lu, F., Wang, Z., Liu, L., Yin, L., Zhang, J., Meng, Q."Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke". Experimental and Therapeutic Medicine 16, no. 6 (2018): 5166-5170. https://doi.org/10.3892/etm.2018.6842
Copy and paste a formatted citation
x
Spandidos Publications style
Chen L, Lu F, Wang Z, Liu L, Yin L, Zhang J and Meng Q: Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke. Exp Ther Med 16: 5166-5170, 2018.
APA
Chen, L., Lu, F., Wang, Z., Liu, L., Yin, L., Zhang, J., & Meng, Q. (2018). Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke. Experimental and Therapeutic Medicine, 16, 5166-5170. https://doi.org/10.3892/etm.2018.6842
MLA
Chen, L., Lu, F., Wang, Z., Liu, L., Yin, L., Zhang, J., Meng, Q."Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke". Experimental and Therapeutic Medicine 16.6 (2018): 5166-5170.
Chicago
Chen, L., Lu, F., Wang, Z., Liu, L., Yin, L., Zhang, J., Meng, Q."Influence of interleukin-1β gene polymorphism on the risk of myocardial infarction complicated with ischemic stroke". Experimental and Therapeutic Medicine 16, no. 6 (2018): 5166-5170. https://doi.org/10.3892/etm.2018.6842
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team