Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
January-2019 Volume 17 Issue 1

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model

  • Authors:
    • Rongli Xie
    • Jinlong Wang
    • Yi Yao
    • Mengzhi Qi
    • Shunwei Huang
    • Zhifeng Zhao
    • Ying Chen
    • Zhitao Yang
    • Huiqiu Sheng
    • Jian Fei
    • Enqiang Mao
    • Erzhen Chen
  • View Affiliations / Copyright

    Affiliations: Department of General Surgery, Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China, Emergency Center of The Affiliated Hospital of Xuzhou Medical University, Xuzhou, Jiangsu 221004, P.R. China, Department of Emergency, Ruijin Hospital Affiliated to Shanghai Jiao Tong University School of Medicine, Shanghai 200025, P.R. China
  • Pages: 437-443
    |
    Published online on: November 6, 2018
       https://doi.org/10.3892/etm.2018.6934
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Acute pancreatitis is an acute abdominal disease, with 10‑20% of the cases deteriorating rapidly, accompanied by persistent organ failure and further development into severe acute pancreatitis (SAP). The aim of the present study was to investigate the mechanism of fluid resuscitation via the rectum in the early stages of SAP and the role of aquaporins (AQPs). An SAP model was constructed by injection of 5% sterile sodium taurocholate into the biliopancreatic duct of Sprague Dawley rats, and the mean arterial pressure (MAP) was continuously monitored via femoral artery catheterization. At 30 min after the construction of the SAP model, the rats in the fluid resuscitation groups were resuscitated with normal saline at a rate of 4 ml/kg/h through the venous or the rectal route. The AQP and Na+‑K+‑ATPase levels, and the correlation of the MAP and colon AQPs at the early stages of SAP were analyzed. The results demonstrated that the mRNA level of AQP‑3 and AQP‑4 in the distal colon decreased significantly in the group subjected to fluid resuscitation via the rectum, while no significant differences were identified in the Na+‑K+‑ATPase levels of the colon in that group. Furthermore, a negative correlation was identified between the expression of AQPs and the MAP (P<0.01). Thus, fluid resuscitation via the rectum appears to ameliorate hemodynamic disorders through adjusting the expression of AQP‑3 and AQP‑4 in the distal colon in an experimental SAP model.

Introduction

Acute pancreatitis (AP) is an acute abdominal disease caused by pancreatic enzyme activation through a variety of triggers, followed by a pancreatic local inflammatory response as the major clinical feature. In an estimate of 10–20% of patients with AP, the condition deteriorates rapidly and develops into persistent organ failure, further evolving into severe acute pancreatitis (SAP) (1,2). In the early phases of the disease, the gastrointestinal tract is one of the major targets, with an overwhelming release of inflammatory cytokines and exudation of fluids, leading to a sharp decline of the effective circulatory blood volume, thereby affecting the permeability of the colonic mucosal epithelium and water metabolism. Clinical studies have reported that the mortality rate of SAP within 14 days was as high as 50% and that effective early intervention had a significant impact on the prognosis of SAP (3,4). Chen et al (5) demonstrated that fluid resuscitation via the rectum improved organ function and decreased the serum levels of inflammatory factors.

Aquaporins (AQPs) are integral membrane proteins that belong to the major intrinsic protein family. AQPs constitute channels in the cell membrane, which control the transportation of water and restrict the movement of ions or other micromolecules in and out of the cells (6,7). AQPs, including AQP-1, −3, −7, −8 and −11, are abundantly expressed in the human colon tissue, and have a vital role in digestive disturbances, including diarrhea and constipation (8–11). A recent study (12) proved that the expression of AQPs in colon tissues increased significantly in SAP, but in a diverse manner. The aim of the present study was to investigate the potential beneficial effect of fluid resuscitation via the rectum in the early stages of SAP and the underlying mechanisms, including the role of AQPs.

Materials and methods

Chemicals and reagents

Sodium taurocholate (purity, ≥97%) was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). PrimeScript RT Master Mix and SYBR Premix Ex Taq were purchased from Takara Bio Inc. (Otsu, Japan). Rabbit anti-rat Na+-K+-ATPase (cat. no. SC-28800) was purchased from Santa Cruz Biotechnology Inc. (Dallas, TX, USA).

Animals

Male Sprague Dawley (SD) rats (age, 8–10 weeks; weight, 300±10 g) were purchased from the Shanghai Laboratory Animal Center (Chinese Academy of Science, Shanghai, China). The rats were provided rodent chow and tap water ad libitum for at least 1 week and were allowed to acclimatize to the laboratory environment. The rats were anesthetized via an intraperitoneal injection of 3% pentobarbital sodium (50 mg/kg body weight), and an additional injection of 1/5 of the initial dose was given every hour throughout the entire experiment. Clinical signs, including the mean arterial pressure (MAP), were continuously monitored with a multi-channel physiological recorder (Powerlab 15T; ADInstruments, Bella Vista, NSW, Australia). The rats were sacrificed by CO2 inhalation in accordance with the institutional criteria for euthanasia.

SAP model establishment and fluid resuscitation

The SAP model was established as previously described (5). The rats were fasted overnight with free access to water prior to the experiment, and were randomly divided into four groups as follows: The SHAM, no fluid resuscitation (NFR), intravenous fluid resuscitation (IVFR) and fluid resuscitation via the rectum (FRVR) groups. SAP was induced by injection of 5% sterile sodium taurocholate (final dose, 0.1 ml/100 g) into the biliopancreatic duct of the SD rats, and the MAP was continuously monitored via femoral artery catheterization throughout the experiment. At 30 min after the induction of SAP, the rats in the IVFR and FRVR groups were resuscitated with normal saline at a rate of 4 ml/kg/h through the venous or the rectal route (5), while the rats in the NFR group were not administered any fluid therapy. In the rats of the SHAM group, catheterization and laparotomy were performed, and the duodenum and pancreas were flipped instead of inducing SAP. At 12 h after the beginning of fluid resuscitation, the rats were sacrificed by CO2 inhalation, except for model rats that were sacrificed at 4, 8, 12 and 24 h for the determination of Na+-K+-ATPase.

Detection of AQP-3, AQP-4 and AQP-8 mRNA levels by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis

Total RNA was extracted from colon tissues using TRIzol reagent (Thermo Fisher Scientific, Inc.). Complementary DNA was synthesized by RT according to the protocol of PrimeScript RT Master Mix and then subjected to qPCR using β-actin as an internal control. The primer sequences were as follows (5′-3′): AQP-3 forward, CCCCTTGTGATGCCTCTC and reverse, CCCTAGCTGGCAGAGTTC; AQP-4 forward, CAGAACCAAGGCGTAGACCG and reverse, TCCCTGGAAATGACTGAGAAA; AQP-8 forward, GCCGATGTGTAGTATGGACCTA and reverse, ACCCAATGAAGATGAAGAGAGC; β-actin forward, GCGCTCGTCGTCGACAACGG and reverse, GTGTGGTGCCAAATCTTCTCC. The PCR was performed according to the manufacturer's protocol using an Applied Biosystems 7500 Real-Time PCR System (Thermo Fisher Scientific, Inc.). The thermocycling protocol was as follows: Denaturation for 30 sec at 95°C and 40 cycles of 5 sec at 95°C and 34 sec at 60°C. The relative changes in gene expression were calculated as 2−ΔΔCq (13).

ELISA detection of Na+-K+-ATPase

The concentration of Na+-K+-ATPase was determined using ELISA kits according to the manufacturer's protocol (cat. no. SC-28800; Santa Cruz Biotechnology Inc.).

Sample staining

Histopathological examination was performed using the hematoxylin and eosin (H&E) staining method. Fresh tissue specimens were immersed in 4% paraformaldehyde for 12 h at room temperature. Samples were dehydrated in room temperature through a serial alcohol gradient (50%, 3×1 h; 70%, 1 h; 80%, 1 h; 90%, 1 h; 100%, 2×1 h), followed by immersing in xylene (2×20 min) at room temperature and embedded in paraffin wax blocks (52–56°C; 3×2 h). Paraffin-embedded tissue sections (4 µm) were prepared and dewaxed in xylene (3× 10 min at room temperature), rehydrated through decreasing concentrations of ethanol (100%, 2×10 min; 90%, 5 min; 80%, 5 min; 70%, 5 min), and washed with PBS. Samples were stained using the H&E staining kit according to the manufacturer's protocol (Sangon Biotech Co., Ltd., Shanghai, China) at room temperature for 10 min and 30 sec, respectively. Samples were observed under a light microscope (magnification, ×100).

Statistical analysis

Values are expressed as the mean ± standard error of the mean and compared using Student's t-tests or one-way analysis of variance with Student-Newman-Keuls post hoc test. Pearson correlation analysis was performed to assess the correlation between the MAP and the mRNA levels of AQPs. P<0.05 was considered to indicate a statistically significant difference. Analysis was performed using SPSS version 19 (IBM Corp., Armonk, NY, USA) and Prism (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA).

Results

Pathological changes of the colon

After the establishment of SAP, the integrity of the proximal colonic mucosa was continuously damaged and inflammatory cell infiltration was observed in the submucosa. Compared with the SHAM group, the structure of the epithelial cells was disturbed and the colonic villi were destroyed in the NFR group (Fig. 1A and B). Following IVFR, the condition of the lesions improved significantly (Fig. 1C), with only mild edema observed in the proximal colon, whereas the inflammatory cell infiltration had subsided. The pathological changes in the distal colon were almost identical to those in the proximal colon (Fig. 1E, F). Similarly, between distal and proximal colon, fluid resuscitation via the rectum also effectively reduced the inflammatory response (Fig. 1D and H).

Figure 1.

Pathological changes in the colon. (a) SHAM, (b) NFR, (c) IVFR and (d) FRVR groups in the proximal colon. The group of (e) SHAM, (f) NFR, (g) IVFR and (h) FRVR in the distal colon. Histopathological examination was performed using the hematoxylin and eosin staining method (magnification, ×100). NFR, no fluid resuscitation; IVFR, intravenous fluid resuscitation; FRVR, fluid resuscitation via the rectum.

Changes in the mRNA levels of colonic AQPs with fluid resuscitation in SAP

The expression of AQP-3, AQP-4 and AQP-8 mRNA in the proximal and distal colon was significantly higher compared with that in the SHAM group (Fig. 2). In the proximal colon, the mRNA levels of AQP-3 and AQP-8 in the IVFR and FRVR groups were significantly lower compared with those in the NFR group, while they were still higher compared with those in the SHAM group. Following fluid resuscitation, a different response was observed regarding the changes in the levels of AQP-4. The expression of AQP-4 mRNA in the IVFR group was higher compared with that in the NFR group, but was decreased in the FRVR group.

Figure 2.

Changes in the mRNA levels of colonic AQPs with fluid resuscitation in severe acute pancreatitis. (A) AQP-3, (B) AQP-4 and (C) AQP-8 in (a) the proximal and (b) distal colon. *P<0.05 vs. SHAM group, #P<0.05 vs. NFR group, &P<0.05 vs. IVFR group. NFR, no fluid resuscitation; IVFR, intravenous fluid resuscitation; FRVR, fluid resuscitation via the rectum; AQP, aquaporin.

The results obtained in the distal colon were different from those in the proximal colon. Following fluid resuscitation, although the expression of AQP-8 mRNA was higher compared with that in the SHAM group, there was no significant difference between the NFR group and the resuscitation groups. Furthermore, FRVR effectively reduced the levels of AQP-3 and AQP-4, while IVFR did not. Of note, the expression of AQP-4 mRNA was lower compared with that in the SHAM group.

Changes in colon Na+-K+-ATPase at the early stages of SAP

Na+-K+-ATPase is an important ion channel on the cell membrane. It is used to transport sodium and potassium ions through an inverse concentration gradient to help the transmembrane diffusion of water. Thus, the expression of Na+-K+-ATPase was investigated in the colon tissues of SAP rats (Fig. 3). In the SHAM group, the expression levels of Na+-K+-ATPase in the proximal and distal colon were similar. Furthermore, compared with the SHAM group, the expression of Na+-K+-ATPase in the SAP model maintained for 12 h (S12h group) was significantly higher (P<0.05). In the S24h group, the results were different between the proximal and distal colon: The proximal colon exhibited a significant increase of Na+-K+-ATPase compared with that in the S12h group, but a significant decrease in the distal colon. Following fluid resuscitation, the Na+-K+-ATPase expression in the proximal colon of the IVFR group was significantly reduced compared with that in the SHAM and NFR groups (P<0.05; Fig. 3C) while there is no difference between the FRVR and NFR groups. However, no significant differences were observed in the Na+-K+-ATPase levels in the distal colon among the four groups (P>0.05; Fig. 3D).

Figure 3.

Changes in colon Na+-K+-ATPase at the early stages of SAP. (A and B) Na+-K+-ATPase levels in the (A) proximal and (B) distal colon of the SAP model group over 24 h. *P<0.05 vs. SHAM group; #P<0.05 vs. S4h group; &P<0.05 vs. S8h group. (C and D) Na+-K+-ATPase levels in the (C) proximal and (D) distal colon of the different experimental groups. *P<0.05 vs. SHAM group; #P<0.05 vs. NFR group. SAP, severe acute pancreatitis; S4h, SAP model maintained for 4 h; NFR, no fluid resuscitation; IVFR, intravenous fluid resuscitation; FRVR, fluid resuscitation via the rectum.

Correlation of MAP with colon AQP expression at the early stages (12 h following onset) of SAP (3/group)

A negative correlation was observed between AQP expression and the MAP (Fig. 4). In addition, AQP expression in the proximal colon was more significantly correlated with the MAP compared with that in the distal colon of SAP rats. In proximal colon tissues, the correlation analysis between the mRNA levels of AQP-3, −4 and −8 and the MAP provided r values of −0.9124, −0.9335 and −0.9345, respectively (Fig. 4A-C). In distal colon tissues, the r values were −0.8228, −0.8847 and −0.8831, respectively (Fig. 4D-F).

Figure 4.

Correlation of MAP with colonic AQP expression at an early stage (12 h following onset) of severe acute pancreatitis. MAP was continuously monitored via femoral artery catheterization. In the proximal colon tissues, the r of (A) AQP3, (B) AQP4 and (C) AQP8 was −0.9124, −0.9335 and −0.9345, respectively (P<0.0001). In the distal colon tissues, the r of (D) AQP3, (E) AQP4 and (F) AQP8 was −0.8228 (P=0.0010), −0.8847 (P=0.0001) and −0.8831 (P=0.0001), respectively. MAP, mean arterial pressure; AQP, aquaporin.

Discussion

SAP is an inflammation of the pancreas that is associated with a significant amount of morbidity and mortality. According to clinical experience, there are two mortality rate peaks over the course of SAP, with most deaths occurring in the early stages of the acute response, which is considered to be the primary factor for the rapidly aggravated early systemic disease leading to death. Hence, effective correction of systemic circulation and microcirculation disorders shortens the time of tissue hypoxia and control of sustained systemic inflammatory response syndrome is key to the treatment of the acute response (14,15). The most effective treatment is fluid resuscitation, which is recognized as the primary measure in the current guidelines (2,16). Chen et al (5), demonstrated that FRVR is a potential supplementary method for fluid management at the early stages of SAP. Following treatment with FRVR, the MAP and organ function improved, suggesting that the colon may readily absorb a large volume of water under conditions of shock. Hence, the aim of the present study was to investigate the mechanisms underlying water absorption through the colon during SAP.

AQPs are widely distributed in the cell membranes of human tissues and visceral organs, and participate in almost all pathophysiological processes of a variety of diseases (6,17). A number of studies revealed that AQP-3, −4 and −8 are implicated in water uptake and transport in the colon. AQPs may participate in the adjustment of intestinal mucosal permeability and the rate of water absorption. Abnormalities of AQPs are known to be associated with Crohn's disease, ulcerative colitis, slow transit constipation and cholera (18–24). A previous study (12) and the results of the present study demonstrated that the expression of AQPs in colon tissues during SAP increased significantly, but in a diverse manner, and a negative correlation between AQP expression and the MAP was determined. Thus, it may be hypothesized that a negative feedback mechanism exists, which improves the intestinal water intake ability in order to restore the blood volume. This may be the mechanism through which FRVR exerts a therapeutic effect in SAP.

Compared with the jejunum and ileum, AQP-3 is abundantly expressed in the colon. Silberstein et al (25), initially discovered that AQP-3 was specifically expressed in epithelial microvilli of the colon, indicating that it may be involved in water absorption. In addition, suppression of AQP-3 function may lead to diarrhea by increasing the fecal water content. Furthermore, the purgative action of magnesium sulfate changes the osmotic pressure and downregulates AQP-3 expression in mucosal epithelial cells of the colon, resulting from activation of adenylate cyclase by increasing the intracellular magnesium ion concentration (20,26). In the present study, normal rat colon tissues expressed low levels of AQP-3. With fluid resuscitation therapy, the level of colonic AQP-3 decreased in the proximal colon and distal colon.

A previous study indicated that AQP-4 is mainly expressed in the ascending colon in humans (24). In rats, AQP-4 was reported to be predominantly expressed in the epithelial cells of the proximal colon (21,27). Wang et al (22), studied AQP-4 gene knockout mice and identified that the expression of AQP-4 was positively correlated with the water permeability of the colon. In addition, high expression of AQP-4 accelerated water absorption through the colon, which may be a key event in slow transit constipation. AQP-4 was identified to be downregulated in a mouse model of allergic diarrhea, which was explained by a dysfunction of colonic absorption (21). In the present study, following treatment with invasive fluid resuscitation, the mRNA expression of AQP-4 was elevated; however, the expression was significantly decreased in the FRVR group, particularly in the distal colon.

AQP-8 is expressed in the colon and pancreas in humans. In rats, this protein was identified to be abundantly expressed in body parts including the duodenum, jejunum, rectum and liver (28–31). In the present study, the AQP-8 mRNA expression was altered not only in the IVFR group, but also in the FRVR group: Similar to AQP-3 and AQP-4, the expression of AQP-8 was increased in the NFR group. In the proximal colon, the expression decreased significantly in IVFR group and FRVR group, as expected. However, there was no significant change in distal colon following the fluid resuscitation.

In the early stages of SAP, the expression of AQPs was negatively correlated with the MAP, suggesting that, due to the significant loss of body fluids, hemodynamic abnormalities may increase the expression of colon AQPs. The upregulation of these proteins may constitute a negative feedback mechanism, enhancing the ability of the colon to absorb water in order to restore the effective circulatory volume. In the present study, the expression of AQP-3 and AQP-4 in the distal colon was only downregulated following rectal fluid resuscitation, whereas intravenous rehydration exerted a less prominent or no effect, suggesting that rectal administration of fluids to improve the colon hypoperfusion and restore the blood volume reduces the expression of AQPs in the distal colon. This result indicates that rectal fluid resuscitation may achieve active regulation of water absorption, while during invasive intravenous fluid resuscitation, the body only passively accepts the water. No significant change in distal colon AQP-8 was detected after fluid resuscitation, suggesting that AQP-8 exerted no effect on the regulation of distal colonic water absorption.

Various biological mechanisms participate in water absorption and transport. The present study also examined the association between Na+-K+-ATPase and SAP (pathological and recovery process). Na+-K+-ATPase is a vital ion channel, which facilitates the movement of water molecules across the cell membrane. Na+-K+-ATPase uses ATP for the intracellular and extracellular transport of sodium and potassium ions against a concentration gradient. The expression of Na+-K+-ATPase was analyzed in the present study. In the proximal and distal colon of the SHAM group, Na+-K+-ATPase was expressed at similar levels. During the pathological progression of SAP, the Na+-K+-ATPase increased with time, but fluid resuscitation had little or no effect on its expression, particularly in the distal colon except, for the IVFR group and the proximal colon.

SAP is a systemic inflammatory disease originating in the pancreas but involving multiple organs, and features a high mortality rate and multiple complications. Conventional treatment includes intravenous fluid therapy to improve the effective circulatory blood volume. However, a recent study (5) by our group indicated that fluid resuscitation via the rectum may decrease the occurrence of complications and, therefore, significantly improve the prognosis of affected patients. In the present study, it was demonstrated that fluid resuscitation via the rectum effectively reduced the inflammatory response in a rat model of SAP. Furthermore, the underlying mechanism was identified to be associated with AQPs rather than with Na+-K+-ATPase. This provides convincing evidence for the efficacy of fluid resuscitation via the rectum in the treatment of SAP and furthermore, AQPs may be a potential target in SAP research.

Acknowledgements

Not applicable.

Funding

The present study was supported by the National Natural Science Foundation of China (grant nos. 81670581, 81671901 and 81600501).

Availability of data and materials

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

RX, JW, YC and JF designed the research. JW, YC, YY, MQ, SH and ZZ performed the research. RX, YC, ZY, HS, EM and EC analyzed the data. RX and YC prepared the manuscript. All of the authors listed have approved the final version of the manuscript submitted for publication.

Ethical approval and consent to participate

The Institutional Animal Care and Use Committee (IACUC) of Ruijin Hospital affiliated to Shanghai Jiao Tong University School of Medicine (Shanghai, China) approved the study protocol and the animal surgical procedures. All experimental procedures were performed according to the Guide for the Care and Use of Laboratory Animals developed by the Ruijin Hospital affiliated to Shanghai Jiao Tong University School of Medicine (Shanghai, China).

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Tenner S, Baillie J, DeWitt J and Vege SS: American College of Gastroenterology: American college of gastroenterology guideline: Management of acute pancreatitis. Am J Gastroenterol. 108:1400–1415. 2013. View Article : Google Scholar : PubMed/NCBI

2 

Banks PA, Bollen TL, Dervenis C, Gooszen HG, Johnson CD, Sarr MG, Tsiotos GG and Vege SS: Acute Pancreatitis Classification Working Group: Classification of acute pancreatitis-2012: Revision of the Atlanta classification and definitions by international consensus. Gut. 62:102–111. 2013. View Article : Google Scholar : PubMed/NCBI

3 

Carnovale A, Rabitti PG, Manes G, Esposito P, Pacelli L and Uomo G: Mortality in acute pancreatitis: Is it an early or a late event? JOP. 6:438–444. 2005.PubMed/NCBI

4 

Jacob AO, Stewart P and Jacob O: Early surgical intervention in severe acute pancreatitis: Central Australian experience. ANZ J Surg. 86:805–810. 2016. View Article : Google Scholar : PubMed/NCBI

5 

Chen Y, Ma L, Song X, Fei J, Chen E and Mao E: Beneficial effects of fluid resuscitation via the rectum on hemodynamic disorders and multiple organ injuries in an experimental severe acute pancreatitis model. Pancreatology. 15:626–634. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Agre P: The aquaporin water channels. Proc Am Thorac Soc. 3:5–13. 2006. View Article : Google Scholar : PubMed/NCBI

7 

King LS and Agre P: Pathophysiology of the aquaporin water channels. Annu Rev Physiol. 58:619–648. 1996. View Article : Google Scholar : PubMed/NCBI

8 

Koyama N, Ishibashi K, Kuwahara M, Inase N, Ichioka M, Sasaki S and Marumo F: Cloning and functional expression of human aquaporin8 cDNA and analysis of its gene. Genomics. 54:169–172. 1998. View Article : Google Scholar : PubMed/NCBI

9 

Hasegawa H, Lian SC, Finkbeiner WE and Verkman AS: Extrarenal tissue distribution of CHIP28 water channels by in situ hybridization and antibody staining. Am J Physiol. 266:C893–C903. 1994. View Article : Google Scholar : PubMed/NCBI

10 

Zahn A, Moehle C, Langmann T, Ehehalt R, Autschbach F, Stremmel W and Schmitz G: Aquaporin-8 expression is reduced in ileum and induced in colon of patients with ulcerative colitis. World J Gastroenterol. 13:1687–1695. 2007. View Article : Google Scholar : PubMed/NCBI

11 

Tsujikawa T, Itoh A, Fukunaga T, Satoh J, Yasuoka T and Fujiyama Y: Alteration of aquaporin mRNA expression after small bowel resection in the rat residual ileum and colon. J Gastroenterol Hepatol. 18:803–808. 2003. View Article : Google Scholar : PubMed/NCBI

12 

Chen Y, Xie R and Wang J: Expression and role of aquaporin in the colon of acute necrotizing pancreatitis rats. Chin J Pancreatol. 17:162–167. 2017.(In Chinese).

13 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

14 

Guo Q, Li A, Xia Q, Liu X, Tian B, Mai G, Huang Z, Chen G, Tang W, Jin X, et al: The role of organ failure and infection in necrotizing pancreatitis: A prospective study. Ann Surg. 259:1201–1207. 2014. View Article : Google Scholar : PubMed/NCBI

15 

Trikudanathan G, Navaneethan U and Vege SS: Current controversies in fluid resuscitation in acute pancreatitis: A systematic review. Pancreas. 41:827–834. 2012. View Article : Google Scholar : PubMed/NCBI

16 

Zhou ZG, Chen YD, Sun W and Chen Z: Pancreatic microcirculatory impairment in experimental acute pancreatitis in rats. World J Gastroenterol. 8:933–936. 2002. View Article : Google Scholar : PubMed/NCBI

17 

Agre P and Kozono D: Aquaporin water channels: Molecular mechanisms for human diseases. FEBS Lett. 555:72–78. 2003. View Article : Google Scholar : PubMed/NCBI

18 

Zheng YF, Liu CF, Lai WF, Xiang Q, Li ZF, Wang H and Lin N: The laxative effect of emodin is attributable to increased aquaporin 3 expression in the colon of mice and HT-29 cells. Fitoterapia. 96:25–32. 2014. View Article : Google Scholar : PubMed/NCBI

19 

Kon R, Ikarashi N, Nagoya C, Takayama T, Kusunoki Y, Ishii M, Ueda H, Ochiai W, Machida Y, Sugita K and Sugiyama K: Rheinanthrone, a metabolite of sennoside A, triggers macrophage activation to decrease aquaporin-3 expression in the colon, causing the laxative effect of rhubarb extract. J Ethnopharmacol. 152:190–200. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Ikarashi N: The elucidation of the function and the expression control mechanism of aquaporin-3 in the colon. Yakugaku Zasshi. 133:955–961. 2013.(In Japanese). View Article : Google Scholar : PubMed/NCBI

21 

Yamamoto T, Kuramoto H and Kadowaki M: Downregulation in aquaporin 4 and aquaporin 8 expression of the colon associated with the induction of allergic diarrhea in a mouse model of food allergy. Life Sci. 81:115–120. 2007. View Article : Google Scholar : PubMed/NCBI

22 

Wang KS, Ma T, Filiz F, Verkman AS and Bastidas JA: Colon water transport in transgenic mice lacking aquaporin-4 water channels. Am J Physiol Gastrointest Liver Physiol. 279:G463–G470. 2000. View Article : Google Scholar : PubMed/NCBI

23 

Zhi H and Yuan WT: Expression of aquaporin 3, 4, and 8 in colonic mucosa of rat models with slow transit constipation. Zhonghua Wei Chang Wai Ke Za Zhi. 14:459–461. 2011.(In Chinese). PubMed/NCBI

24 

Wang XJ, Yuan WT, Song JM and Zhang ZY: Expression and significance of aquaporin 4 in the colonic mucosa of patients with slow transit constipation. Zhonghua Wei Chang Wai Ke Za Zhi. 13:445–447. 2010.(In Chinese). PubMed/NCBI

25 

Silberstein C, Kierbel A, Amodeo G, Zotta E, Bigi F, Berkowski D and Ibarra C: Functional characterization and localization of AQP3 in the human colon. Braz J Med Biol Res. 32:1303–1313. 1999. View Article : Google Scholar : PubMed/NCBI

26 

Ikarashi N, Kon R, Iizasa T, Suzuki N, Hiruma R, Suenaga K, Toda T, Ishii M, Hoshino M, Ochiai W and Sugiyama K: Inhibition of aquaporin-3 water channel in the colon induces diarrhea. Biol Pharm Bull. 35:957–962. 2012. View Article : Google Scholar : PubMed/NCBI

27 

Zhang WS, Li F and Bao JQ: Regulatory effect of anthraquinone derivatives from rhubarb on aquaporin 4 expression in colon of rats and in LoVo cell line. Zhongguo Zhong Xi Yi Jie He Za Zhi. 28:818–823. 2008.(In Chinese). PubMed/NCBI

28 

Matsuzaki T, Tajika Y, Ablimit A, Aoki T, Hagiwara H and Takata K: Aquaporins in the digestive system. Med Electron Microsc. 37:71–80. 2004. View Article : Google Scholar : PubMed/NCBI

29 

Koyama Y, Yamamoto T, Tani T, Nihei K, Kondo D, Funaki H, Yaoita E, Kawasaki K, Sato N, Hatakeyama K and Kihara I: Expression and localization of aquaporins in rat gastrointestinal tract. Am J Physiol. 276:C621–C627. 1999. View Article : Google Scholar : PubMed/NCBI

30 

Hoque AT, Yamano S, Liu X, Swaim WD, Goldsmith CM, Delporte C and Baum BJ: Expression of the aquaporin 8 water channel in a rat salivary epithelial cell. J Cell Physiol. 191:336–341. 2002. View Article : Google Scholar : PubMed/NCBI

31 

Wang JQ, Zhang L, Tao XG, Wei L, Liu B, Huang LL and Chen YG: Tetramethylpyrazine upregulates the aquaporin 8 expression of hepatocellular mitochondria in septic rats. J Surg Res. 185:286–293. 2013. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Xie R, Wang J, Yao Y, Qi M, Huang S, Zhao Z, Chen Y, Yang Z, Sheng H, Fei J, Fei J, et al: Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model. Exp Ther Med 17: 437-443, 2019.
APA
Xie, R., Wang, J., Yao, Y., Qi, M., Huang, S., Zhao, Z. ... Chen, E. (2019). Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model. Experimental and Therapeutic Medicine, 17, 437-443. https://doi.org/10.3892/etm.2018.6934
MLA
Xie, R., Wang, J., Yao, Y., Qi, M., Huang, S., Zhao, Z., Chen, Y., Yang, Z., Sheng, H., Fei, J., Mao, E., Chen, E."Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model". Experimental and Therapeutic Medicine 17.1 (2019): 437-443.
Chicago
Xie, R., Wang, J., Yao, Y., Qi, M., Huang, S., Zhao, Z., Chen, Y., Yang, Z., Sheng, H., Fei, J., Mao, E., Chen, E."Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model". Experimental and Therapeutic Medicine 17, no. 1 (2019): 437-443. https://doi.org/10.3892/etm.2018.6934
Copy and paste a formatted citation
x
Spandidos Publications style
Xie R, Wang J, Yao Y, Qi M, Huang S, Zhao Z, Chen Y, Yang Z, Sheng H, Fei J, Fei J, et al: Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model. Exp Ther Med 17: 437-443, 2019.
APA
Xie, R., Wang, J., Yao, Y., Qi, M., Huang, S., Zhao, Z. ... Chen, E. (2019). Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model. Experimental and Therapeutic Medicine, 17, 437-443. https://doi.org/10.3892/etm.2018.6934
MLA
Xie, R., Wang, J., Yao, Y., Qi, M., Huang, S., Zhao, Z., Chen, Y., Yang, Z., Sheng, H., Fei, J., Mao, E., Chen, E."Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model". Experimental and Therapeutic Medicine 17.1 (2019): 437-443.
Chicago
Xie, R., Wang, J., Yao, Y., Qi, M., Huang, S., Zhao, Z., Chen, Y., Yang, Z., Sheng, H., Fei, J., Mao, E., Chen, E."Fluid resuscitation via the rectum ameliorates hemodynamic disorders through adjusting aquaporin expression in an experimental severe acute pancreatitis model". Experimental and Therapeutic Medicine 17, no. 1 (2019): 437-443. https://doi.org/10.3892/etm.2018.6934
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team