Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
April-2019 Volume 17 Issue 4

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors

  • Authors:
    • Faliang Dai
    • Shizhen Dong
    • Zhenhua Rong
    • Qingxia Xuan
    • Pan Chen
    • Menglu Chen
    • Yonggang Fan
    • Qiang Gao
  • View Affiliations / Copyright

    Affiliations: Department of Gastroenterology and Hepatology, Beijing Rehabilitation Hospital, Capital Medical University, Beijing 100144, P.R. China, Department of Clinical Laboratory Diagnosis, The First Affiliated Hospital and Clinical Medical College, Henan University of Science and Technology, Luoyang, Henan 471023, P.R. China, Department of Minimally Invasive Interventional Oncology, Caoxian People's Hospital, Heze, Shandong 274400, P.R. China, Department of Gastroenterology and Hepatology, The First Affiliated Hospital and Clinical Medical College, Henan University of Science and Technology, Luoyang, Henan 471023, P.R. China, Department of Surgery, The First Affiliated Hospital and Clinical Medical College, Henan University of Science and Technology, Luoyang, Henan 471023, P.R. China
  • Pages: 3181-3188
    |
    Published online on: February 26, 2019
       https://doi.org/10.3892/etm.2019.7317
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

Inflammatory bowel disease (IBD) is a risk factor in colon cancer. Endoplasmic reticulum (ER) stress is associated with IBD and cancer. In the current study an azoxymethane (AOM) and dextran sulfate sodium (DSS)‑induced mouse colonic tumor model was established to analyze the expression of ER stress chaperone molecules. Female C57BL/6 mice were intraperitoneally injected with 12 mg/kg AOM. On the 7th day following AOM injection, mice were treated with 1% DSS supplemented to the drinking water for 7 days, then followed by 14 days of normal drinking water. The cycle of 7 days DSS plus 14 days normal water was repeated twice and colonic tumors were evaluated for their number and size. Mice in the control group were injected with saline and received normal drinking water for the course of the experiment. mRNA levels of cytokines, inositol‑requiring enzyme (IRE)1α and 1β, their downstream targets X‑box binding protein (XBP)1u, XBP1s and mucin (MUC) 2 and interleukin (IL)‑6, IL‑8 and tumor necrosis factor (TNF)‑α were detected by reverse transcription‑quantitative polymerase chain reaction. IRE1α, IRE1β and MUC2 protein expression was evaluated by immunohistochemistry, and IRE1α and IRE1β levels were further assessed by western blot analysis. It was observed that tumors developed in the distal colon of mice treated with AOM/DSS. IL‑6, IL‑8 and TNF‑α mRNA levels were significantly increased in mice of the tumor group compared with mice of the control group. There were no significant differences in IRE1α mRNA and protein expression between the two groups and XBP1s mRNA levels were increased in the tumor compared with the control group. IRE1β and MUC2 mRNA levels were significantly decreased in the tumor compared with the control group (decreased by 42 and 30%, respectively). IRE1β and MUC2 proteins were predominately expressed in colonic epithelial cells and expression was decreased in the tumor compared with the control group. In conclusion, the downregulation of IRE1β and MUC2 may reduce the ability of colon tissues to resist inflammation, thus promoting the occurrence and development of colonic tumors.

Introduction

Colorectal cancer (CRC) is the third most common type of cancer and the fourth-leading cause of cancer-associated mortality worldwide (1). Genetic and epigenetic genomic alterations, leading to gene amplification, the activation of oncogenes and the loss of tumor suppressor genes, are involved in the tumorigenesis of CRC (2). Risk factors associated with CRC include environmental and dietary mutagens, intestinal microorganisms and pathogens, and chronic intestinal inflammation (3). The connection between inflammation and tumorigenesis is well established. The processes of colitis-associated cancer (CAC) and non-inflammatory CRC feature common events, including the development of localized hyperplasia, polyps, adenoma and ultimately, carcinoma (4). CAC is the CRC subtype preceded by inflammatory bowel disease (IBD), Crohn's disease or ulcerative colitis (UC) (5). UC is associated with a cumulative risk of CAC of ≤20% within 30 years of disease onset (5,6). Azoxymethane (AOM) is a mutagenic agent that induces multiple colonic tumors following a single injection in chronic colitis mouse models within short periods (7). This mouse model of CAC is valuable for the understanding of the mechanisms of inflammation in tumorigenesis (8).

Endoplasmic reticulum (ER) stress is associated with both the pathogenesis of intestinal inflammation and tumorigenesis (9–11). The ER is crucial for the folding of secretory and membrane proteins, lipid biosynthesis, the regulation of intracellular Ca2+ and redox signaling. During ER stress, the disturbance of ER homeostasis due to oxidative stress, energy deprivation, altered metabolic status or inflammatory stimuli causes ER calcium depletion and the accumulation of unfolded and misfolded proteins in the ER lumen (12). In mammalian cells, there are three types of ER stress sensors: Protein-kinase-RNA-like-ER kinase, activating transcription factor 6 and inositol-requiring enzyme (IRE) 1. These transmembrane ER proteins regulate the unfolded protein response to address ER stress (13,14). IRE1 is the most evolutionally conserved among the three ER stress response sensors (15). There are two IRE1 paralogs, α and β, present in mammals (16). IRE1α is a ubiquitously expressed kinase and site-specific RNA endonuclease (17,18), that processes the mRNA encoding X-box binding protein (XBP) 1 to maintain ER homeostasis (19). IRE1α excises a 26-nucleotide-intron sequence from the unspliced XBP1u mRNA to produce spliced XBP-1s mRNA, resulting in the activation of XBP1 protein expression. The XBP1 protein is a transcription factor involved in tumor growth and survival (10,20). Although IRE1β is a paralog of IRE1α (21), its expression is restricted to the epithelium of the gastrointestinal and respiratory tracts (16,22), while IRE1α is expressed in a variety of tissues (23). IRE1α and IRE1β protect mice from dextran sulfate sodium (DSS)-induced colitis (16,24); however, these two IRE1 proteins have different functions in ER stress and varying substrate specificities (25). For example, IRE1β has a decreased XBP1u mRNA RNase activity compared with IRE1α (22) and IRE1β degrades 28S rRNA more efficiently than IRE1α (26). IRE1β overexpression in HeLa cells results in the cleavage of 28S rRNA, leading to cell apoptosis (27). IRE1β, but not IRE1α, regulates the secretory protein mucin (MUC) 2 in intestinal goblet cells (26,28). MUC2 is a putatively vital molecule in the innate immune defense of the colon; a lack of the MUC2 gene results in spontaneous colitis and colon cancer in mice (29–32).

The current study induced colonic tumor formation in mice using AOM and dextran sulfate sodium (DSS). It was observed that IRE1β and MUC2 expression was downregulated in the tumors. This indicated that the inhibition of the IRE1β-MUC2 signaling pathway may promote the occurrence and development of colonic tumors.

Materials and methods

Mice

Female C57BL/6 (B6) mice (Vital River Laboratory Animal Technology Co., Ltd., Beijing, China) were maintained in the animal experimental center of The First Affiliated Hospital of Henan University of Science and Technology. Mice were housed with a controlled temperature of 20–22°C, 50% humidity and a 12-h light/dark cycle; they were fed with rodent chow from Beijing HFK Bioscience Co., Ltd. (Beijing, China). The Animal Care and Use Committee of The First Affiliated Hospital of Henan University of Science and Technology (Luoyang, China) approved all the animal procedures in this study.

Colitis-mediated colon tumors were induced using a modified protocol previously described by Neufert et al (7). A total of 20 mice (age, 7–8 weeks; weight, 19–23 g) were randomly allocated into the control and tumor groups (n=10/group). Mice in the tumor group received an intraperitoneal injection of 1 mg/ml AOM (12 mg/kg; molecular weight (MW), 74.08 Da; cat. no. MFCD00126912; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and control mice received saline (12 ml/kg saline). In primary experiments, the high mortality of mice was associated with direct administration following intraperitoneal injection, so on the 7th day after intraperitoneal injection of AOM, mice in the tumor group received 1.0% DSS (MW 36–50 kDa; cat. no. 160110; MP Biomedicals, LLC, Santa Ana, CA, USA) for 7 days to induce colitis. The 1% DSS solution was prepared by dissolving fine-grain DSS powder (1 g) in 100 ml drinking water. DSS solution was freshly prepared prior to administration. Water bottles containing DSS were replaced at 5 days with fresh DSS solution for the remaining 3 days. On day 8, the DSS solution was replaced with normal drinking water for 14 days; mice in the control group did not receive DSS. The cycle of 7 days DSS/14 days normal drinking water was repeated three times. Control mice were provided with normal drinking water throughout the experiment. Mice in both groups had free access to food and water. The mice were monitored once every two days for total of 69 days to record body weight, stool consistency, rectal bleeding and ulceration.

Mice were euthanized at the end of the third cycle. The entire colon was excised and measured. Colons were cut open and laid flat, lumen-side up. The number and size of colonic tumors was assessed. Colon tissues and tumor tissues were frozen at −80°C for subsequent reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analyses. RNAlater Stabilization reagent (Qiagen GmbH, Hilden, Germany) was used to prevent mRNA degradation according to the manufacturers' instructions. Further samples from the colon and tumor tissue were fixed with 10% neutral-formalin for 24 h at room temperature and embedded in paraffin 62°C for 3 h. Sections were stained by hematoxylin and eosin (H&E) and immunohistochemistry (IHC) as described below. The severity of colitis was evaluated based on the disease activity index (DAI) using a previously described method (Table I) (33).

Table I.

Disease activity index score.

Table I.

Disease activity index score.

Assigned score

Characteristic01234
Body mass decrease (%)01–55–1010–15>15
Stool appearanceNormal–Loose–Diarrhea
Rectal bleedingNormal–Hemoccult positive–Gross bleeding

[i] The disease activity index=(body mass decrease + stool character + rectal bleeding)/3.

Histopathology examination

Tissue slices (4-µm) were prepared from distal colon tissue samples and stained with H&E for histological examination. Staining was performed at room temperature and 1% Hematoxylin (stained for 1–10 min) and 0.5% Eosin (stained for 2–5 min) were used. Pathology and level of inflammation were scored in a blinded fashion using a previously described scoring system (34) to quantify: The extent of neutrophil and lymphocyte infiltration (0–3 points); Paneth and goblet cell degranulation (0–2 points); epithelium reactivity, including crypt distortion (0–3 points); and inflammatory foci (0–3 points).

IHC was conducted with sections mounted on poly-L-lysine-coated slides using a modified biotin-peroxidase complex method as previously described (35). Briefly, tissue sections were incubated overnight at 4°C with rabbit polyclonal antibodies against IRE1α (dilution, 1:150; cat. no. sc-20790; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), IRE1β (dilution, 1:100; cat. no. GTX87426; GeneTex, Inc., Irvine, CA, USA) and MUC2 (dilution, 1:100; cat. no. ab76774; Abcam, Cambridge, UK). Antigen-antibody complexes were detected with a biotinylated goat anti-rabbit antibody (dilution, 1:300; cat. no. SA1020; Boster Biological Technology Co., Ltd., Wuhan, China) conjugated with streptavidin-horseradish peroxidase (HRP) for 30 min at 37°C. At room temperature and visualized by reacting with the 3,3-diaminobenzidine reagent kit (Solarbio Science & Technology Co., Ltd., Beijing, China; cat. no. DA1010) at room temperature for 5 min. Sections were counterstained with 1% hematoxylin for 1–10 min at room temperature. Negative control sections were obtained by omitting the primary antibody or by using an unspecific antibody. Images at a magnification of ×400 were captured using a Nikon Ds-Fi2 500w light microscope, (Nikon Corporation, Tokyo, Japan). IHC staining was used to semi-quantitatively determine protein levels as previously described (35): A total of 10 fields were randomly selected on each slide and 100 cells per field were counted and scored for IRE1α, IRE1β and MUC2 staining. The semi-quantitative scores were obtained from the staining intensity (none, 0; weak, 1; moderate, 2; strong, 3) multiplied by the percentage of positively stained cells (≤5%, 0; 6–25%, 1; 26–50%, 2; 51–75%, 3; and >75%, 4).

RT-qPCR analysis

Total RNA from the colon tissue samples was extracted using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. cDNA was synthesized using PrimeScript-RT Master mix (Takara Bio, Inc., Otsu, Japan) with the following temperature protocol: 37°C for 15 min, 85°C for 5 sec and 4°C for 10 min. qPCR was performed as described previously, using undiluted cDNA templates (35). Primer sequences (Table II) were designed with Primer 3.0 (36) and synthesized by Sangon Biotech Co., Ltd. (Zhengzhou, China). qPCR was performed using a CFX96 Real-Time PCR system (Bio-Rad Laboratories, Inc., Hercules, CA, USA) and SYBR green (Takara Bio, Inc.) was used to detect PCR products. The reaction followed an initial step at 95°C for 30 sec, followed by 40 cycles of 95°C for 5 sec, 58°C for 30 sec and 72°C for 30 sec. For annealing temperatures >60°C, a two-step method was used (37). Each sample was assayed in triplicate. Amplification efficiency was >97%. A melting curve analysis was performed for the PCR products of each target gene and β-actin to evaluate primer specificity. The relative abundance of target gene mRNA level was evaluated using 2−ΔΔCq method, normalized to β-actin (38). mRNA expression levels were presented as relative fold by comparing the quantity of mRNA between different groups. When Cq >35, the gene was considered to not be expressed.

Table II.

Reverse transcription-quantitative polymerase chain reaction primers.

Table II.

Reverse transcription-quantitative polymerase chain reaction primers.

Primer (5′-3′)

GeneForwardReverse
IL-6 AACGATGATGCACTTGCAGA TGGTACTCCAGAAGACCAGAGG
TNF-α CCACCACGCTCTTCTGTCTACT TGCTACGACGTGGGCTACA
IL-8 CTAGGCATCTTCGTCCGTCC TTGGGCCAACAGTAGCCTTC
XBP1u GGTCTGCTGAGTCCGCAGCACTC AGGCTTGGTGTATACATGG
XBP1s GGTCTGCTGAGTCCGCAGCAGG AGGCTTGGTGTATACATGG
IRE1α GCATCACCAAGTGGAAGTATC ACCATTGAGGGAGAGGCATAG
IRE1β CACAACCTATCGCCGCTACT CATCCTGGTGCCATGTGTAA
MUC2 CTGACCAAGAGCGAACACAA CATGACTGGAAGCAACTGGA
β-actin GGCTGTATTCCCCTCCATCG CCAGTTGGTAACAATGCCATGT

[i] IL, interleukin; TNF, tumor necrosis factor; IRE, inositol-requiring enzyme; XBP, X-box binding protein; MUC, mucin.

Western blotting

Protein lysates were prepared from the extracted tissues in radioimmunoprecipitation assay lysis buffer (cat. no. R0020; Solarbio Science & Technology Co., Ltd.) on ice by homogenization with a grinder. The supernatant was obtained by centrifugation (15 min; 10,800 × g; 4°C. The bicinchoninic acid (cat. no. PC0020; Solarbio Science & Technology Co., Ltd.) method was used to determine protein concentration. Protein (30 µg) from each sample was denatured, resolved on 10% SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). Rabbit polyclonal antibodies against IRE1α (dilution, 1:1,000; cat. no. 14C10; Cell Signaling Technology, Inc., Danvers, MA, USA) and IRE1β (dilution, 1:300; cat. no. ab135795; Abcam) and mouse monoclonal antibodies against GAPDH (dilution, 1:1,000; cat. no. CW0100A; CWBIO Technology Co. Ltd, Beijing, China) were incubated with the membranes at 4°C overnight, followed by HRP-conjugated anti-rabbit (dilution, 1:1,000; cat. no. BA1054) or anti-mouse IgG (dilution, 1:3,000; cat. no. BA1050; both Boster Biological Technology Co. Ltd.) for 1 h at room temperature, and enhanced chemiluminescence reagent (Pierce; Thermo Fisher Scientific, Inc.) according to the manufacturers' protocols. GAPDH was used to normalize protein expression. A ChemiDoc XRS (Bio-Rad Laboratories, Inc.) was used to capture images, which were quantified using ImageJ software v1.48 (National Institutes of Health, Bethesda, MD, USA).

Statistical analysis

All data are presented as the mean ± standard deviation. Experiments were repeated at least three times. All statistical analyses were performed using SPSS 20.0 (IBM Corp., Armonk, NY, USA). Student's t-test or Mann-Whitney U test were used to determined significant differences between groups. Wilcoxon signed-rank test was used for non-parametric data. P<0.05 was considered to indicate a statistically significant difference.

Results

Treatment with AOM/DSS induces tumors in mouse colons

According to Thaker et al (39) and preliminary experiments, the most consistent results were observed using female mice; hence, only female mice were utilized in the current study. No signs of inflammation or colonic tumors were observed in the control group. Mice in the tumor group exhibited no sign of illness following AOM treatment and reduced appetite and drank less starting on day 6 of the 1% DSS treatment. By day 7, all mice of the tumor group presented with bloody stools and declining body weight; symptoms lasted until day 4 after 1% DSS treatment. The weight loss of the mice in the tumor group was the lowest with −5.5% during the first cycle. In the following two cycles, mice exhibited similar symptoms, but less severe. Body weights of mice in the tumor group increased, although slower compared with the control mice; particularly during DSS treatment. At the endpoint, there was a significant difference in body weight between the tumor and the control group (P<0.05; Fig. 1) and DAI scores in the tumor group were significantly higher compared with the control group (P<0.05; Table III). No mortality was observed in either group. The colon length in the tumor group was significantly decreased compared with the control group (P<0.05; Table III). A total of 36 (average number of tumors per mouse, 3.6; range, 2–5) colonic tumors were observed in mice of the tumor group. The mean tumor diameter was 3.1 mm (range, 1–4 mm). Histological examination revealed that the mucosa of the colons from the tumor group were disordered and the crypt structure was destroyed compared with the control group: Colonic epithelial cells were atypical, with decreased differentiation, increased cell size and large nuclei; the nucleus-to-cytoplasm ratio of the cells was increased, the number of goblet cells was decreased and the number of inflammatory cells was increased (Fig. 2A and B).

Figure 1.

Changes in body weight of the mice over the course of the experiment. At day 1, mice in the tumor group received an intraperitoneal injection of azoxymethane. On 7th day mice in the tumor group received drinking water containing 1% dextran sulfate sodium for 7 days, followed by normal drinking water for 14 days. This 7/14 day cycle was repeated three times. Mice in the control group were injected with saline and received normal drinking water for the duration of the experiment. *P<0.05 vs. control group.

Figure 2.

IHC staining suggests that AOM/DSS treatment affects IRE1α, IRE1β and MUC2 expression in tissues. Following a one-off treatment with AOM and three cycles of DSS, tumor tissues from mice in the tumor group (n=10) and colon tissues from mice in the untreated control group (n=10) assessed by IHC. Hematoxylin and eosin staining of (A) control and (B) tumor tissues identifying typical tumor characteristics, including disordered mucosa, destroyed crypt structure, less differentiated cells, a larger cell and nuclei size, and an increased nucleus-to-cytoplasm ratio. IRE1α protein was stained using IHC in (C) control and (D) tumor tissues and expression in the cytoplasm of colon submucosa cells was observed. IHC visualized IRE1β protein in (E) control and (F) tumor tissues and identified cytoplasmic expression in colonic mucosa epithelial cells. MUC2 protein expression was visualized using IHC in goblet cells of (G) control and (H) tumor tissues. All images were obtained using a Nikon Ds-Fi2 500w [Ds-Fi2; light microscope (magnification, ×200)]; scale bar, 50 µm. IHC, immunohistochemistry; AOM, azoxymethane; DSS, dextran sulfate sodium; IRE, inositol-requiring enzyme; MUC, mucin.

Table III.

Disease activity index scores and colon length.

Table III.

Disease activity index scores and colon length.

GroupNDAIColon length (cm)
Control1008.7±0.6
Tumor103.3a 6.4±0.6a

a P<0.05 vs. control group. DAI, disease activity index.

mRNA expression differs between the control and tumor groups

mRNA expression of IL-6, IL-8 and TNF-α was determined in colonic tissues from the two groups. IL-6, IL-8 and TNF-α mRNA expression was significantly increased in the tumor compared with the control group (17.6-, 32.3- and 5.9-fold, respectively; P<0.05; Fig. 3).

Figure 3.

AOM/DSS treatment increases mRNA levels of inflammatory cytokines in mice. Following a one-off treatment with AOM and three cycles of DSS, IL-6, IL-8 and TNF-α mRNA expression levels were determined in mice of the tumor and the untreated control group (n=10/group) using reverse transcription-quantitative polymerase chain reaction assays. *P<0.05 vs. control group. AOM, azoxymethane; DSS, dextran sulfate sodium; IL, interleukin; TNF, tumor necrosis factor.

IRE1α and XBP1u mRNA expression levels were not significantly different between the tumor and the control group (P>0.05; Fig. 4). XBP1s mRNA levels were significantly increased in the tumor compared with the control group (~2-fold; P<0.05; Fig. 4) and IRE1β and MUC2 mRNA levels in the tumor group were significantly decreased compared with the control group (42 and 30%, respectively; P<0.05; Fig. 4).

Figure 4.

AOM/DSS treatment affects mRNA levels of XBP1s, IRE1β and MUC2 in colon tissues of mice. Following a one-off treatment with AOM and three cycles of DSS, mRNA expression of IRE1α, XBP1u, XBP1s, IRE1β and MUC2 were determined in tissues from mice in the untreated control and tumor groups (n=10/group) at the end point of the experiment using reverse transcription-quantitative polymerase chain reaction assays. *P<0.05 vs. control group. AOM, azoxymethane; DSS, dextran sulfate sodium; IRE, inositol-requiring enzyme; XBP, X-box binding protein; MUC, mucin.

IRE1β and MUC2 protein expression is downregulated in tumor tissues

As determined by IHC staining, there was no significant difference in IRE1α protein expression between the tumor and control group (P>0.05; Table IV). IRE1α was primarily expressed in the cytoplasm of colonic submucosa cells. A low level of IRE1α expression was observed in the cytoplasm of colonic epithelial cells, particularly in brush border cells (Fig. 2C and D). IRE1β protein expression in the tumor group was significantly decreased compared with the control group (P<0.05; Table IV). IRE1β protein was predominately expressed in the cytoplasm of colonic mucosa epithelial cells (Fig. 2E and F). Similar to IRE1β, the expression of MUC2 protein in the tumor group was significantly lower than in the control group (P<0.05; Table IV). MUC2 protein was primarily expressed in the cytoplasm of colonic mucosa epithelial cells, particularly in goblet cells in the normal mucosa (Fig. 2G and H).

Table IV.

IRE1α, IRE1β and MUC2 protein expression in colonic tissues determined by immunohistochemistry analysis.

Table IV.

IRE1α, IRE1β and MUC2 protein expression in colonic tissues determined by immunohistochemistry analysis.

GroupNIRE1αIRE1βMUC2
Control101.50±0.235.26±0.384.77±0.47
Tumor101.63±0.18 2.53±0.23a 1.83±0.41a

a P<0.05 vs. control group. IRE, inositol-requiring enzyme; MUC, mucin.

The results of western blot analysis revealed no significant difference in the expression of IRE1α protein between the groups (Fig. 5A). IRE1β protein expression was significantly decreased in the tumor compared with the control group (P<0.05; Fig. 5B).

Figure 5.

IRE1α and IRE1β protein expression is decreased in mice receiving AOM/DSS treatment. Following a one-off treatment with AOM and three cycles of DSS, tumor tissues from mice in the tumor group (n=10) and colon tissues from mice in the untreated control group (n=10) were collected. (A) IRE1α and (B) IRE1β protein expression was assessed by western blotting. The reduction of IRE1α expression was not significant, but the expression of IRE1β decreased significantly. *P<0.05 vs. control group. AOM, azoxymethane; DSS, dextran sulfate sodium; IRE, inositol-requiring enzyme.

Discussion

IRE1α serves a protective role against ER stress and colitis (24,40). The IRE1-XBP1 signaling pathway serves a pivotal role in cell survival under conditions of ER stress and is associated with tumorigenesis of various cancer types (41–44). In the current study, mRNA expression of IRE1α, XBP1u and XBP1s and IRE1α protein expression were compared in tumor and normal tissues. XBP1 mRNA, a signaling molecule in the IRE1α-XBP1 signaling pathway, is processed by IRE1α (19). XBP1s mRNA expression was significantly increased in tumor compared with control tissues. This suggested that the activity of the IRE1α-XBP1 pathway was increased, indicating that the ER stress response may be associated with tumorigenesis. The present study further observed that IRE1α mRNA levels were not increased in tumor tissues compared with the control, while XBP1s mRNA levels were. Under ER stress, IRE1α is activated through trans-autophosphorylation and dimerization, or oligomerization (45). It was speculated that activated IRE1α levels may be increased, while gene expression levels remained unchanged. Thus, the determination of phosphorylated-IRE1α levels requires future assessment.

IRE1α is a transmembrane RNAse that initiates the splicing of XBP1u to XBP1s. The latter encodes a transcription activator; its activity induces the expression of ER chaperones (46). IRE1α promotes cell survival-associated signal transduction and the transmission of apoptotic signals (47). It has been demonstrated that the IRE1-XBP1 signaling pathway is associated to the pathogenesis of IBD (48,49) and human cancer (50), leading to the consideration of the IRE1-XBP1 signaling pathway as a potential target for cancer therapy (51). A recent study suggested that IRE1α promotes cell survival by splicing XBP1 mRNA and promoting regulated IRE1-dependent decay (RIDD). During the RIDD process, IRE1 promotes the degradation of mRNAs that predominately encode ER-targeting proteins (52), which may be the mechanism for the involvement of the IRE1α-XBP1 signaling pathway in the pathogenesis of inflammation-mediated CRC. It was previously reported that IRE1α and XBP1 protein expression levels were unchanged in human CRC tissue compared with adjacent normal tissue (44). Therefore, the role of the IRE1-XBP1 signaling pathway in the pathogenesis of colonic tumors may be discrepant between humans and mice.

IRE1β, a homolog of IRE1α, protects from colitis and IRE1β−/− mice are more sensitive to experimentally induced colitis (16). In contrast to IRE1α, IRE1β affects different substrates, regulating the mRNA that encodes ER proteins to maintain ER homeostasis in highly differentiated secretory cells (28). Divergent effects of IRE1α and IRE1β on the cell fate may be implicated by their varying roles in tumorigenesis (25,46). Therefore, the current study analyzed IRE1β expression in tumor tissues. The results suggested that IRE1β mRNA and protein levels were decreased in the tumor compared with the control tissues. Although Tsuru et al (28) reported that IRE1β is specifically expressed in the ER of goblet cells, present IHC results revealed that IRE1β positive staining was observed in goblet and absorptive cells, indicating that IRE1β may affect multiple cells types. IRE1β acts to protect the intestine from inflammation (52). IRE1β expression in the epithelium of the gastrointestinal tract is consistent with promoting resistance to DSS-induced colitis at the epithelial cell level (16). When DSS is ingested, the gastrointestinal tract epithelial cells are the first to be exposed to the treatment (16). Toxicity likely has a primary role in the development of inflammation among colonic epithelia. DSS acts on the epithelial cell barrier, leading to reduced IRE1β expression in epithelial cells and weakening the protection against colonic inflammation (16). As IRE1β is a protective factor in colitis that can induce apoptosis (23) it is expected that a decrease in IRE1β expression is associated with tumorigenesis, as apoptosis is putatively associated with tumor occurrence (53). IRE1β has been reported to regulate the expression of microsomal triacylglycerol transfer protein, a regulator of lipid absorption in the colonic epithelium (54); however, it is unclear whether this function of IRE1β affects tumorigenesis. In an in vitro study, Dai et al (55) reported that IRE1β mRNA expression increases in undifferentiated and decreases in differentiated Caco-2 cells. IRE1β has been revealed to be involved in cell apoptosis (27). In a previous study, it was reported that IRE1β and MUC2 expression are downregulated in human colonic tissues (44). These results indicated that IRE1β serves an important role in the pathogenesis of colitis and tumors.

MUC2 is the major component of the intestinal mucus gel barrier, which serves an important role in the protection of intestinal function (31). Furthermore, MUC2 is putative to protecting the intestine against colitis and colorectal cancer (30). It has been demonstrated that MUC2-deficient mice spontaneously develop colon cancer (32). Consistent with this, the results of the current study revealed that MUC2 mRNA and protein levels were significantly decreased in tumor compared with normal tissue. It has been reported that IRE1β is involved in the ER homeostasis of colon goblet cells and the synthesis and secretion of MUC2 (28). IRE1β is believed to control the levels of translatable cytosolic MUC2 mRNA to maintain MUC production (28). An in vitro study has revealed that IRE1β regulates secretory proteins in cells via degrading mRNA in the ER (26). In addition, IRE1β is essential for airway epithelial MUC production (22). These data suggest that IRE1β may regulate MUC2 expression and the downregulation of IRE1β and MUC2 may reduce the protection of the colon to promote occurrence and development of tumors.

The current findings suggested that the ER stress-associated IRE1α-XBP1 signaling pathway was activated during the occurrence and development of CRC, and potentially contributed to these processes. The decreased expression of two protective molecules, IRE1β and MUC2, promoted the occurrence and development of inflammation and ultimately tumors in the colonic epithelium. The mechanism of these processes requires further analysis to identify potential therapeutic targets for the treatment or prevention of colitis-associated CRC.

Acknowledgements

The authors would like to thank Dr Lei Gao, Dr Tengfei Guo and Dr Dandan Feng from the Department of Gastroenterology and Hepatology, The First Affiliated Hospital, Henan University of Science and Technology (Luoyang, China) for providing reagents and materials, and for technical support.

Funding

The present study was supported by the National Natural Science Foundation of China (grant no. 81370487) and The Scientific Research Fund of Beijing Rehabilitation Hospital, Capital Medical University (grant no. 2017-004).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

FD performed the majority of experiments, analyzed the data and drafted the manuscript. SD, QX, PC and MC provided technical support, purchased reagents and analyzed the data. ZR and YF analyzed the data and provided their guidance for the study and manuscript writing. QG provided funding, designed the current study, analyzed the data and wrote the manuscript.

Ethics approval and consent to participate

The Animal Care and Use Committee of The First Affiliated Hospital of Henan University of Science and Technology approved all the animal procedures in this study.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

1 

Rabeneck L, Horton S, Zauber AG and Earle C: Colorectal cancer. JAMA J Am Med Assoc. 270:23022015.

2 

Arvelo F, Sojo F and Cotte C: Biology of colorectal cancer. Ecancermedicalscience. 9:5202015. View Article : Google Scholar : PubMed/NCBI

3 

Raskov H, Pommergaard HC, Burcharth J and Rosenberg J: Colorectal carcinogenesis-update and perspectives. World J Gastroenterol. 20:18151–18164. 2014. View Article : Google Scholar : PubMed/NCBI

4 

Grivennikov SI: Inflammation and colorectal cancer: Colitis-associated neoplasia. Semin Immunopathol. 35:229–244. 2013. View Article : Google Scholar : PubMed/NCBI

5 

Terzic J, Grivennikov S, Karin E and Karin M: Inflammation and colon cancer. Gastroenterology. 138:2101–2114.e5. 2010. View Article : Google Scholar : PubMed/NCBI

6 

Bye WA, Nguyen TM, Parker CE, Jairath V and East JE: Strategies for detecting colon cancer in patients with inflammatory bowel disease. Cochrane Database Syst Rev. 9:CD0002792017.PubMed/NCBI

7 

Neufert C, Becker C and Neurath MF: An inducible mouse model of colon carcinogenesis for the analysis of sporadic and inflammation-driven tumor progression. Nat Protoc. 2:1998–2004. 2007. View Article : Google Scholar : PubMed/NCBI

8 

Kanneganti M, Mino-Kenudson M and Mizoguchi E: Animal models of colitis-associated carcinogenesis. J Biomed Biotechnol. 2011:3426372011. View Article : Google Scholar : PubMed/NCBI

9 

Luo K and Cao SS: Endoplasmic reticulum stress in intestinal epithelial cell function and inflammatory bowel disease. Gastroenterol Res Pract. 2015:3287912015. View Article : Google Scholar : PubMed/NCBI

10 

Dicks N, Gutierrez K, Michalak M, Bordignon V and Agellon LB: Endoplasmic reticulum stress, genome damage, and cancer. Front Oncol. 5:112015. View Article : Google Scholar : PubMed/NCBI

11 

Cao SS, Luo KL and Shi L: Endoplasmic reticulum stress interacts with inflammation in human diseases. J Cell Physiol. 231:288–294. 2016. View Article : Google Scholar : PubMed/NCBI

12 

Parmar VM and Schröder M: Sensing endoplasmic reticulum stress. Adv Exp Med Biol. 738:153–168. 2012. View Article : Google Scholar : PubMed/NCBI

13 

Gardner BM, Pincus D, Gotthardt K, Gallagher CM and Walter P: Endoplasmic reticulum stress sensing in the unfolded protein response. Cold Spring Harb Perspect Biol. 5:a0131692013. View Article : Google Scholar : PubMed/NCBI

14 

McMillan DR, Gething MJ and Sambrook J: The cellular response to unfolded proteins: Intercompartmental signaling. Curr Opin Biotechnol. 5:540–545. 1994. View Article : Google Scholar : PubMed/NCBI

15 

Cox JS, Shamu CE and Walter P: Transcriptional induction of genes encoding endoplasmic reticulum resident proteins requires a transmembrane protein kinase. Cell. 73:1197–1206. 1993. View Article : Google Scholar : PubMed/NCBI

16 

Bertolotti A, Wang X, Novoa I, Jungreis R, Schlessinger K, Cho JH, West AB and Ron D: Increased sensitivity to dextran sodium sulfate colitis in IRE1beta-deficient mice. J Clin Invest. 107:585–593. 2001. View Article : Google Scholar : PubMed/NCBI

17 

Manie SN, Lebeau J and Chevet E: Cellular mechanisms of endoplasmic reticulum stress signaling in health and disease. 3. Orchestrating the unfolded protein response in oncogenesis: An update. Am J Physiol Cell Physiol. 307:C901–C907. 2014. View Article : Google Scholar : PubMed/NCBI

18 

Papandreou I, Denko NC, Olson M, Van Melckebeke H, Lust S, Tam A, Solow-Cordero DE, Bouley DM, Offner F, Niwa M and Koong AC: Identification of an Ire1alpha endonuclease specific inhibitor with cytotoxic activity against human multiple myeloma. Blood. 117:1311–1314. 2011. View Article : Google Scholar : PubMed/NCBI

19 

Yoshida H, Matsui T, Yamamoto A, Okada T and Mori K: XBP1 mRNA is induced by ATF6 and spliced by IRE1 in response to ER stress to produce a highly active transcription factor. Cell. 107:881–891. 2001. View Article : Google Scholar : PubMed/NCBI

20 

Koong AC, Chauhan V and Romero-Ramirez L: Targeting XBP-1 as a novel anti-cancer strategy. Cancer Biol Ther. 5:756–759. 2006. View Article : Google Scholar : PubMed/NCBI

21 

Welihinda AA, Tirasophon W and Kaufman RJ: The cellular response to protein misfolding in the endoplasmic reticulum. Gene Expr. 7:293–300. 1999.PubMed/NCBI

22 

Martino MB, Jones L, Brighton B, Ehre C, Abdulah L, Davis CW, Ron D, O'Neal WK and Ribeiro CM: The ER stress transducer IRE1beta is required for airway epithelial mucin production. Mucosal Immunol. 6:639–654. 2013. View Article : Google Scholar : PubMed/NCBI

23 

Chen Ya and Brandizzi F: IRE1: ER stress sensor and cell fate executor. Trends Cell Biol. 23:547–555. 2013. View Article : Google Scholar : PubMed/NCBI

24 

Zhang HS, Chen Y, Fan L, Xi QL, Wu GH, Li XX, Yuan TL, He SQ, Yu Y, Shao ML, et al: The endoplasmic reticulum stress sensor IRE1α in intestinal epithelial cells is essential for protecting against colitis. J Biol Chem. 290:15327–15336. 2015. View Article : Google Scholar : PubMed/NCBI

25 

Oikawa D, Kitamura A, Kinjo M and Iwawaki T: Direct association of unfolded proteins with mammalian ER stress sensor, IRE1β. PLoS One. 7:e512902012. View Article : Google Scholar : PubMed/NCBI

26 

Nakamura D, Tsuru A, Ikegami K, Imagawa Y, Fujimoto N and Kohno K: Mammalian ER stress sensor IRE1β specifically down-regulates the synthesis of secretory pathway proteins. FEBS Lett. 585:133–138. 2011. View Article : Google Scholar : PubMed/NCBI

27 

Iwawaki T, Hosoda A, Okuda T, Kamigori Y, Nomura-Furuwatari C, Kimata Y, Tsuru A and Kohno K: Translational control by the ER transmembrane kinase/ribonuclease IRE1 under ER stress. Nat Cell Biol. 3:158–164. 2001. View Article : Google Scholar : PubMed/NCBI

28 

Tsuru A, Fujimoto N, Takahashi S, Saito M, Nakamura D, Iwano M, Iwawaki T, Kadokura H, Ron D and Kohno K: Negative feedback by IRE1β optimizes mucin production in goblet cells. Proc Natl Acad Sci USA. 110:2864–2869. 2013. View Article : Google Scholar : PubMed/NCBI

29 

Johansson ME, Phillipson M, Petersson J, Velcich A, Holm L and Hansson GC: The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci USA. 105:15064–15069. 2008. View Article : Google Scholar : PubMed/NCBI

30 

Kawashima H: Roles of the gel-forming MUC2 mucin and its O-glycosylation in the protection against colitis and colorectal cancer. Biol Pharm Bull. 35:1637–1641. 2012. View Article : Google Scholar : PubMed/NCBI

31 

Van der Sluis M, De Koning BA, De Bruijn AC, Velcich A, Meijerink JP, Van Goudoever JB, Büller HA, Dekker J, Van Seuningen I, Renes IB and Einerhand AW: Muc2-deficient mice spontaneously develop colitis, indicating that MUC2 is critical for colonic protection. Gastroenterology. 131:117–129. 2006. View Article : Google Scholar : PubMed/NCBI

32 

Velcich A, Yang W, Heyer J, Fragale A, Nicholas C, Viani S, Kucherlapati R, Lipkin M, Yang K and Augenlicht L: Colorectal cancer in mice genetically deficient in the mucin Muc2. Science. 295:1726–1729. 2002. View Article : Google Scholar : PubMed/NCBI

33 

Jackson LN, Zhou Y, Qiu S, Wang Q and Evers BM: Alternative medicine products as a novel treatment strategy for inflammatory bowel disease. Am J Chin Med. 36:953–965. 2008. View Article : Google Scholar : PubMed/NCBI

34 

Esworthy RS, Kim BW, Larson GP, Yip ML, Smith DD, Li M and Chu FF: Colitis locus on chromosome 2 impacting the severity of early-onset disease in mice deficient in GPX1 and GPX2. Inflamm Bowel Dis. 17:1373–1386. 2011. View Article : Google Scholar : PubMed/NCBI

35 

Li H, Zhou Y, Zheng Y, Guo H, Gao L, Chen P, Feng D, Wu L, Yang M, Qi Y, et al: The gastric mucosa from patients infected with CagA+ or VacA+ Helicobacter pylori has a lower level of dual oxidase-2 expression than uninfected or infected with CagA-/VacA-H. pylori. Dig Dis Sci. 61:2328–2337. 2016. View Article : Google Scholar : PubMed/NCBI

36 

Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M and Rozen SG: Primer3-new capabilities and interfaces. Nucleic Acids Res. 40:e1152012. View Article : Google Scholar : PubMed/NCBI

37 

Wong ML and Medrano JF: Real-time PCR for mRNA quantitation. Biotechniques. 39:75–85. 2005. View Article : Google Scholar : PubMed/NCBI

38 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

39 

Thaker AI, Shaker A, Rao MS and Ciorba MA: Modeling colitis-associated cancer with azoxymethane (AOM) and dextran sulfate sodium (DSS). J Vis Exp:. (pii): 41002012.PubMed/NCBI

40 

Tabas I and Ron D: Integrating the mechanisms of apoptosis induced by endoplasmic reticulum stress. Nat Cell Biol. 13:184–190. 2011. View Article : Google Scholar : PubMed/NCBI

41 

Chen C and Zhang X: IRE1alpha-XBP1 pathway promotes melanoma progression by regulating IL-6/STAT3 signaling. J Transl Med. 15:422017. View Article : Google Scholar : PubMed/NCBI

42 

Fujimoto T, Onda M, Nagai H, Nagahata T, Ogawa K and Emi M: Upregulation and overexpression of human X-box binding protein 1 (hXBP-1) gene in primary breast cancers. Breast Cancer. 10:301–306. 2003. View Article : Google Scholar : PubMed/NCBI

43 

Fujimoto T, Yoshimatsu K, Watanabe K, Yokomizo H, Otani T, Matsumoto A, Osawa G, Onda M and Ogawa K: Overexpression of human X-box binding protein 1 (XBP-1) in colorectal adenomas and adenocarcinomas. Anticancer Res. 27:127–131. 2007.PubMed/NCBI

44 

Jiang Y, Zhou Y, Zheng Y, Guo H, Gao L, Chen P, Feng D, Qi R, Li X, Chang Y, et al: Expression of inositol-requiring enzyme 1β is downregulated in colorectal cancer. Oncol Lett. 13:1109–1118. 2017. View Article : Google Scholar : PubMed/NCBI

45 

Hetz C, Martinon F, Rodriguez D and Glimcher LH: The unfolded protein response: Integrating stress signals through the stress sensor IRE1α. Physiol Rev. 91:1219–1243. 2011. View Article : Google Scholar : PubMed/NCBI

46 

Lin JH, Li H, Yasumura D, Cohen HR, Zhang C, Panning B, Shokat KM, Lavail MM and Walter P: IRE1 signaling affects cell fate during the unfolded protein response. Science. 318:944–949. 2007. View Article : Google Scholar : PubMed/NCBI

47 

Lencer WI, DeLuca H, Grey MJ and Cho JA: Innate immunity at mucosal surfaces: The IRE1-RIDD-RIG-I pathway. Trends Immunol. 36:401–409. 2015. View Article : Google Scholar : PubMed/NCBI

48 

Kaser A, Adolph TE and Blumberg RS: The unfolded protein response and gastrointestinal disease. Semin Immunopathol. 35:307–319. 2013. View Article : Google Scholar : PubMed/NCBI

49 

Kaser A, Lee AH, Franke A, Glickman JN, Zeissig S, Tilg H, Nieuwenhuis EE, Higgins DE, Schreiber S, Glimcher LH and Blumberg RS: XBP1 links ER stress to intestinal inflammation and confers genetic risk for human inflammatory bowel disease. Cell. 134:743–756. 2008. View Article : Google Scholar : PubMed/NCBI

50 

Romero-Ramirez L, Cao H, Regalado MP, Kambham N, Siemann D, Kim JJ, Le QT and Koong AC: X box-binding protein 1 regulates angiogenesis in human pancreatic adenocarcinomas. Transl Oncol. 2:31–38. 2009. View Article : Google Scholar : PubMed/NCBI

51 

Yadav RK, Chae SW, Kim HR and Chae HJ: Endoplasmic reticulum stress and cancer. J Cancer Prev. 19:75–88. 2014. View Article : Google Scholar : PubMed/NCBI

52 

Coelho DS and Domingos PM: Physiological roles of regulated Ire1 dependent decay. Front Genet. 5:762014. View Article : Google Scholar : PubMed/NCBI

53 

Moradi Marjaneh R, Hassanian SM, Ghobadi N, Ferns GA, Karimi A, Jazayeri MH, Nasiri M, Avan A and Khazaei M: Targeting the death receptor signaling pathway as a potential therapeutic target in the treatment of colorectal cancer. J Cell Physiol. 233:6538–6549. 2018. View Article : Google Scholar : PubMed/NCBI

54 

Iqbal J, Dai K, Seimon T, Jungreis R, Oyadomari M, Kuriakose G, Ron D, Tabas I and Hussain MM: IRE1beta inhibits chylomicron production by selectively degrading MTP mRNA. Cell Metab. 7:445–455. 2008. View Article : Google Scholar : PubMed/NCBI

55 

Dai K, Khatun I and Hussain MM: NR2F1 and IRE1beta suppress microsomal triglyceride transfer protein expression and lipoprotein assembly in undifferentiated intestinal epithelial cells. Arterioscler Thromb Vasc Biol. 30:568–574. 2010. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Dai F, Dong S, Rong Z, Xuan Q, Chen P, Chen M, Fan Y and Gao Q: Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors. Exp Ther Med 17: 3181-3188, 2019.
APA
Dai, F., Dong, S., Rong, Z., Xuan, Q., Chen, P., Chen, M. ... Gao, Q. (2019). Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors. Experimental and Therapeutic Medicine, 17, 3181-3188. https://doi.org/10.3892/etm.2019.7317
MLA
Dai, F., Dong, S., Rong, Z., Xuan, Q., Chen, P., Chen, M., Fan, Y., Gao, Q."Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors". Experimental and Therapeutic Medicine 17.4 (2019): 3181-3188.
Chicago
Dai, F., Dong, S., Rong, Z., Xuan, Q., Chen, P., Chen, M., Fan, Y., Gao, Q."Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors". Experimental and Therapeutic Medicine 17, no. 4 (2019): 3181-3188. https://doi.org/10.3892/etm.2019.7317
Copy and paste a formatted citation
x
Spandidos Publications style
Dai F, Dong S, Rong Z, Xuan Q, Chen P, Chen M, Fan Y and Gao Q: Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors. Exp Ther Med 17: 3181-3188, 2019.
APA
Dai, F., Dong, S., Rong, Z., Xuan, Q., Chen, P., Chen, M. ... Gao, Q. (2019). Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors. Experimental and Therapeutic Medicine, 17, 3181-3188. https://doi.org/10.3892/etm.2019.7317
MLA
Dai, F., Dong, S., Rong, Z., Xuan, Q., Chen, P., Chen, M., Fan, Y., Gao, Q."Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors". Experimental and Therapeutic Medicine 17.4 (2019): 3181-3188.
Chicago
Dai, F., Dong, S., Rong, Z., Xuan, Q., Chen, P., Chen, M., Fan, Y., Gao, Q."Expression of inositol‑requiring enzyme 1β is downregulated in azoxymethane/dextran sulfate sodium‑induced mouse colonic tumors". Experimental and Therapeutic Medicine 17, no. 4 (2019): 3181-3188. https://doi.org/10.3892/etm.2019.7317
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team