Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Oncology Letters
      • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Biomedical Reports
      • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • Information for Authors
    • Information for Reviewers
    • Information for Librarians
    • Information for Advertisers
    • Conferences
  • Language Editing
Spandidos Publications Logo
  • About
    • About Spandidos
    • Aims and Scopes
    • Abstracting and Indexing
    • Editorial Policies
    • Reprints and Permissions
    • Job Opportunities
    • Terms and Conditions
    • Contact
  • Journals
    • All Journals
    • Biomedical Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Experimental and Therapeutic Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Epigenetics
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Functional Nutrition
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Molecular Medicine
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • International Journal of Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Medicine International
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular and Clinical Oncology
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Molecular Medicine Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Letters
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • Oncology Reports
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
    • World Academy of Sciences Journal
      • Information for Authors
      • Editorial Policies
      • Editorial Board
      • Aims and Scope
      • Abstracting and Indexing
      • Bibliographic Information
      • Archive
  • Articles
  • Information
    • For Authors
    • For Reviewers
    • For Librarians
    • For Advertisers
    • Conferences
  • Language Editing
Login Register Submit
  • This site uses cookies
  • You can change your cookie settings at any time by following the instructions in our Cookie Policy. To find out more, you may read our Privacy Policy.

    I agree
Search articles by DOI, keyword, author or affiliation
Search
Advanced Search
presentation
Experimental and Therapeutic Medicine
Join Editorial Board Propose a Special Issue
Print ISSN: 1792-0981 Online ISSN: 1792-1015
Journal Cover
May-2019 Volume 17 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

Journals

International Journal of Molecular Medicine

International Journal of Molecular Medicine

International Journal of Molecular Medicine is an international journal devoted to molecular mechanisms of human disease.

International Journal of Oncology

International Journal of Oncology

International Journal of Oncology is an international journal devoted to oncology research and cancer treatment.

Molecular Medicine Reports

Molecular Medicine Reports

Covers molecular medicine topics such as pharmacology, pathology, genetics, neuroscience, infectious diseases, molecular cardiology, and molecular surgery.

Oncology Reports

Oncology Reports

Oncology Reports is an international journal devoted to fundamental and applied research in Oncology.

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine

Experimental and Therapeutic Medicine is an international journal devoted to laboratory and clinical medicine.

Oncology Letters

Oncology Letters

Oncology Letters is an international journal devoted to Experimental and Clinical Oncology.

Biomedical Reports

Biomedical Reports

Explores a wide range of biological and medical fields, including pharmacology, genetics, microbiology, neuroscience, and molecular cardiology.

Molecular and Clinical Oncology

Molecular and Clinical Oncology

International journal addressing all aspects of oncology research, from tumorigenesis and oncogenes to chemotherapy and metastasis.

World Academy of Sciences Journal

World Academy of Sciences Journal

Multidisciplinary open-access journal spanning biochemistry, genetics, neuroscience, environmental health, and synthetic biology.

International Journal of Functional Nutrition

International Journal of Functional Nutrition

Open-access journal combining biochemistry, pharmacology, immunology, and genetics to advance health through functional nutrition.

International Journal of Epigenetics

International Journal of Epigenetics

Publishes open-access research on using epigenetics to advance understanding and treatment of human disease.

Medicine International

Medicine International

An International Open Access Journal Devoted to General Medicine.

Journal Cover
May-2019 Volume 17 Issue 5

Full Size Image

Sign up for eToc alerts
Recommend to Library

  • Article
  • Citations
    • Cite This Article
    • Download Citation
    • Create Citation Alert
    • Remove Citation Alert
    • Cited By
  • Similar Articles
    • Related Articles (in Spandidos Publications)
    • Similar Articles (Google Scholar)
    • Similar Articles (PubMed)
  • Download PDF
  • Download XML
  • View XML
Article

Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3

  • Authors:
    • Xiao‑Yan Lei
    • Xing‑Xing Chen
    • Yong‑Hong Sun
    • Ming‑Dong Gao
    • Xiao‑Xia Hu
    • Yan‑Hong Suo
  • View Affiliations / Copyright

    Affiliations: Department of Pediatrics, Gansu Province People's Hospital, Lanzhou, Gansu 730000, P.R. China
  • Pages: 4223-4229
    |
    Published online on: March 29, 2019
       https://doi.org/10.3892/etm.2019.7453
  • Expand metrics +
Metrics: Total Views: 0 (Spandidos Publications: | PMC Statistics: )
Metrics: Total PDF Downloads: 0 (Spandidos Publications: | PMC Statistics: )
Cited By (CrossRef): 0 citations Loading Articles...

This article is mentioned in:


Abstract

The gene for hepatitis B virus X protein (HBx) comprises the smallest open reading frame in the HBV genome, and the protein product can activate various cell signaling pathways and regulate apoptosis, among other effects. However, in different cell types and under different external conditions, its mechanism of action differs. In the present study, the effect of HBx on the viability and apoptosis of mouse podocyte clone 5 (MPC5) cells was investigated. The cells were transfected with the HBx gene using pEX plasmid, and real‑time quantitative PCR and western blot analysis were used to test the transfection efficiency and assess related protein expression. The highest expression of HBx occurred at 48 h after MPC5 cells were transfected with HBx. The expression of nephrin protein in the HBx transfection group was lower than that in blank and negative control groups. Following transfection of the HBx gene, podocyte viability was suppressed, while the rate of cell apoptosis was increased; moreover, the expression of signal transducer and activator of transcription 3 (STAT3) and phospho‑STAT3 was increased compared with in the control groups. The present study suggests that STAT3 activation may be involved in the pathogenic mechanism of renal injuries caused by HBV injection. Thus STAT3 is a potential molecular target in the treatment of HBV‑GN.

Introduction

Chronic hepatitis B is a worldwide epidemic disease, with China in particular representing a high hepatitis B virus (HBV) epidemic area. In 2006, an epidemiological survey of HBV in China revealed that the incidence of HBV surface antigen was 7.2% in individuals aged 1–59 years old among the general population, and that the incidence of HBV infection with glomerulonephritis was 6.8–20.0% (1). As such, HBV-associated glomerulonephritis (HBV-GN) is an important cause of chronic kidney disease (CKD) in China (2,3). While Combes et al (4) first reported on HBV-GN in 1971, the pathogenic mechanism is still yet to be fully elucidated. The deposits of immune complexes formed by HBV antigens and antibodies are the main causes of HBV-GN (5,6). However, some recent studies have demonstrated that HBV induced renal damage and may serve an important role in HBV-GN (7–9). The pathological presentation of HBV-GN is varied, and includes membranous nephropathy (MN), membranoproliferative glomerulonephritis, mesangial proliferative glomerulonephritis, minimal change disease and focal segmental glomerulosclerosis (FSGS), though most clinical manifestations are of those classified under nephrotic syndrome (10,11). As is well established, the glomerular endothelial cells, glomerular basal membrane and podocytes together constitute the glomerular filtration barrier, and podocyte damage is considered to be among the most critical factors resulting in proteinuria (12,13). This is due to podocytes, as a highly differentiated cell type with specific structure and biological function, being unrenewable following sustained damage (12,14). Previous research indicated that the number and density of podocytes decreased significantly in patients with HBV-MN, with this change accompanied by increases in urinary protein (15). Cell apoptosis, exfoliation and loss of proliferative capacity are considered the main mechanisms underlying podocyte reduction (15).

The hepatitis B virus X protein gene (HBx) comprises the smallest open reading frame in the HBV genome, and its product serves as the basic viral protein in the virus infection cycle (16). With advances in research, the X protein has been verified as a multifunctional protein, which can activate various cell signaling pathways and regulate apoptosis, among other effects (17). However, in different types of cell and under different external conditions, the regulation of these pathways by HBx is governed by differing mechanisms (18). Overexpression of HBx in extracorporeal podocytes limits the proliferative capacity of the cells through cell cycle regulation, and this mechanism may occur due to upregulation of cyclin B1 and p21 (19). However, the mechanisms underlying podocyte apoptosis induced by HBx are unclear. Therefore, the current study examined the effect of HBx on the viability and apoptosis of mouse podocyte clone 5 (MPC5) cells, and nephrin protein expression was detected in an HBx transfection group to investigate the possible mechanism involved.

Materials and methods

Cell culture

MPC5 cells were obtained from CHI Scientific, Inc. (Maynard, MA, USA). After frozen MPC5 cells were recovered, they were cultured in low sugar Dulbecco's modified Eagle's medium (DMEM; Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 10% heat-inactivated fetal calf serum (HyClone; GE Healthcare, Little Chalfont, UK). The MPC5 cells were cultured and expanded in this medium also containing 10 U/ml interferon-γ (PeproTech, Inc., Rocky Hill, NJ, USA) at 33°C and 5% CO2.

Podocyte transfection and grouping

MPC5 cells were inoculated on 6-well plates at 5×104 cells/cm density, with each group assigned three wells. When the cells reached 70% confluence, they were divided into different groups according to transfection treatment. The cells were transfected with pEX-HBx or pEX-neo plasmids (both Shanghai GenePharma, Co., Ltd., Shanghai, China) using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The cells were divided into three groups: A HBx transfection group (pEX-HBx group; treated with 2 µl Lipofectamine 2000 + 20 pmol HBx-plasmid), a negative control group (pEX-neo group; treated with 2 µl Lipofectamine 2000 + 20 pmol empty plasmid) and a blank control group (MPC5 group; treated with 2 µl Lipofectamine 2000 alone).

RNA isolation and real-time quantitative PCR (qPCR)

The transcript levels of the HBx gene were examined using qPCR. Following transfection of MPC5 cells for 12, 24, 48 and 72 h, the cells were digested with pancreatin (0.25%), washed with phosphate-buffered saline and collected. Total RNA was isolated from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and reverse transcribed to cDNA using a high-capacity cDNA archive kit (Takara Biotechnology, Co., Ltd., Dalian, China) according to the manufacturer's instructions. qPCR was performed using an Applied Biosystems 7300 real-time PCR system (Thermo Fisher Scientific, Inc.). The thermocycling conditions were as follows: 94°C for 4 min, followed by 40 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec as well as 82°C for 30 sec to collect fluorescence data. Primers were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China), the sequences of which are listed in Table I. Expression of the abelson murine leukemia viral oncogene homolog gene (ABL) was used as a control. The relative expression of HBx was calculated by the comparative 2−ΔΔCq method (20). In order to reduce the error, each group was assayed three times.

Table I.

Primer sequences and product size.

Table I.

Primer sequences and product size.

PrimerOligonucleotide sequence, 5′-3′Product size, bp
HBx sense TGCGGACGACCCTTCTCGGG195
HBx antisense GGGCAACATTCGGTGGGCGT
ABL sense TCCTCCAGCTGTTATCTGGAAGA118
ABL antisense TCCAACGAGCGGCTTCAC

[i] HBx, hepatitis B virus X protein; ABL, abelson murine leukemia viral oncogene homolog.

MTT assay

The MTT method was used to detect the viability of podocytes, using an MTT kit purchased from American Biomol (Farmingdale, NY, USA). MPC5 cells in the exponential phase of growth were trypsinized and seeded into 6-well plates at a density of 4×105 cells per well, with three wells per group. After 48 h of incubation at 33°C, MTT reagent (5 mg/ml, 20 µl) was added and the cells were incubated for another 4 h. Then, the supernatant was discarded, 150 µl dimethyl sulfoxide (DMSO) was added to each well, and the wells were agitated for 15 min. The optical density (OD) of each well at 570 nm (OD570) was read with an ELISA plate reader, and the cell viability rate was calculated according to the following formula: Viability rate=OD570treatment group/OD570control group ×100%. The experiment was repeated three times.

Flow cytometry

After transfection for 48 h, MPC5 cells in the exponential phase of growth were trypsinized, centrifuged at 112 × g for 10 min at 4°C, and the cell pellet suspended in cell culture medium. Then, 1×106 cells were resuspended in 200 µl of 1X Nexin buffer (Annexin V-FITC Apoptosis Detection Kit I; BD Biosciences, San Jose, CA, USA). A total of 50 µl of the suspension was transferred into a tube containing 5 µl propidium iodide and 5 µl Annexin V stain (BD Pharmingen; BD Biosciences), and incubated for 30 min at room temperature in the dark. following addition of 250 µl 1X Nexin buffer into each tube, apoptotic cells were detected by flow cytometry using a fluorescence-activated cell sorter (FACSCalibur cytometer) and CELL Quest™ software (version 3.3) (both from BD Biosciences).

Western blot analysis

The total protein of cells in each group was extracted with radioimmunoprecipitation assay buffer and measured using bicinchoninic assay reagents (Beyotime Institute of Biotechnology, Haimen, China). Then, 60 µg protein per lane was subjected to polyacrylamide gel electrophoresis in 6–12% gels, and the resulting bands were transferred to polyvinylidene difluoride membranes. The membranes were blocked at room temperature for 2 h in Tris-buffered saline with Tween-20 (TBST; 0.2% Tween-20) containing 5% skimmed milk, then incubated at 4°C overnight with primary antibodies (1:1,000) against HBx, nephrin, signal transducer and activator of transcription 3 (STAT3), phosphorylated (p)-STAT3 and GAPDH (Abcam, Cambridge, UK; cat nos. ab157480, ab58968, ab119352, ab76315 and ab8245, respectively). Following washing with TBST, the appropiate horseradish-peroxidase-labeled secondary antibody (1:5,000; cat no. A0208; Beyotime Institute of Biotechnology) was added and incubated for 2 h at room temperature, after which the membranes were washed three to five times with TBST. Finally, an electrochemiluminescence kit (Sigma-Aldrich; Merck KGaA) and gel imager were used to expose and visualize the proteins, and protein grayscale values were measured with Quantity One software (version 4.52; Bio-Rad Laboratories, Inc., Hercules, CA, USA), and the actual grayscale value of the target protein=the target protein average grayscale value/the GAPDH average grayscale value.

Statistical analysis

All experiments were repeated at least three times. GraphPad Prism 5 software (GraphPad Software, Inc., La Jolla, CA, USA) was used to generate charts and complete statistical analyses. The data are presented as the mean ± standard deviation, and t-tests were used to compare the data between two groups. The comparisons between multiple groups were made by one-way analysis of variance followed by post-hoc Tukey's tests. P<0.05 was considered to indicate statistical significance.

Results

HBx is over-expression in the pEX-HBx group

HBx mRNA in the pEX-HBx group was expressed at the highest level at 48 h after transfection. HBx mRNA expression was significantly higher compared with the MPC5 and pEX-neo groups (P<0.01; Table II). HBx expression was determined to be significantly higher in the pEX-HBx group compared with that in the pEX-neo and MPC5 groups, while there was no difference in expression between the pEX-neo and MPC5 groups (P>0.05; Table II). Using western blotting to examine the expression of HBx protein and verify the transfection efficiency, corresponding results were obtained as those for qPCR (Fig. 1A and B). Based on expression increase, the 48-h post-transfection podocytes were used for the follow-up experiments.

Figure 1.

Western blot analysis of HBx protein expression in MPC5 cells following transfection with pEX-HBx. (A) HBx protein expression after transfection for 12–72 h; (B) HBx expression in different groups after transfection for 48 h. HBx, hepatitis B virus X protein.

Table II.

Efficiency of HBx gene transfection in MPC5 cells.

Table II.

Efficiency of HBx gene transfection in MPC5 cells.

HBx expression at different time points, h

Group12244872
MPC50.48±0.140.51±0.120.54±0.120.44±0.10
pEX-neo0.53±0.130.65±0.110.64±0.200.58±0.21
pEX-HBx 0.64±0.11a,c 18.3±0.25b,d 593.42±0.56b,d 88.59±0.33b,d

{ label (or @symbol) needed for fn[@id='tfn2-etm-0-0-7453'] } Values are presented as mean ± standard deviation (n=3).

a P<0.05

b P<0.01 vs. MPC5 group

c P<0.05

d P<0.01 vs. pEX-neo group. HBx, hepatitis B virus X protein.

Nephrin expression is downregulated in HBx-transfected podocytes

As expected, the expression of nephrin protein in the pEX-HBx podocytes was lower than that in the pEX-neo and MPC5 groups (P<0.01 and P<0.01, respectively). Additionally, the western blot results demonstrated that there was no difference in nephrin protein expression between the pEX-neo and MPC5 groups (P>0.05; Fig. 2).

Figure 2.

Effects of HBx on the expression of nephrin protein. Values are presented as the mean ± standard deviation (n=3). (A) Western blot gel; (B) graphical representation of the results. **P<0.01. HBx, hepatitis B virus X protein.

Overexpression of the HBx gene suppresses podocyte viability

The viable cell rate of the pEX-HBx podocytes was 52.2±2.4%, which was the lowest rate observed compared with that of the MPC5 (67.2±3.0%) and pEX-neo (63.4±3.4%) groups (P<0.01 and P<0.01, respectively). No significant difference was identified between the rates of viable cells in the pEX-neo and MPC5 groups (P>0.05; Fig. 3).

Figure 3.

Podocyte viability rate comparison between the groups. Values are presented as the mean ± standard deviation (n=3). **P<0.01. HBx, hepatitis B virus X protein.

Overexpression of HBx increases podocyte apoptosis

The rate of cell apoptosis in the pEX-HBx group was significantly higher than that in the MPC5 and pEX-neo groups (P<0.01 and P<0.01, respectively); the ratio of apoptotic cells in each of the MPC5, pEX-neo and pEX-HBx groups was 3.46±0.17, 4.86±0.55 and 10.82±0.45, respectively. There was no difference between the MPC5 and pEX-neo groups (P>0.05; Fig. 4).

Figure 4.

Apoptotic rates of podocytes with or without HBx transfection. Values are presented as the mean ± standard deviation (n=3). (A) Flow cytometry results; (B) graphical representation of the results. **P<0.01. HBx, hepatitis B virus X protein. HBx, hepatitis B virus X protein; FITC, fluorescein isothiocyanate; PI, propidium iodide.

HBx stimulates STAT3 production in MPC5 cells

The expression of STAT3 and p-STAT3 was highest in the pEX-HBx group; no difference was observed in the expression levels between the MPC5 and pEX-neo groups (P>0.05; Fig. 5). p-STAT3/STAT3 ratios in the MPC5, pEX-neo and pEX-HBx groups were 1.160±0.017, 0.877±0.014 and 1.411±0.008, respectively (Table III). The proportion of STAT3 phosphorylation in the pEX-HBx group was significantly increased compared with that in the other two groups (P<0.01 and P<0.01, respectively; Fig. 5; Table III).

Figure 5.

Effects of HBx on the protein levels of STAT3 and p-STAT3. Values are presented as the mean ± standard deviation (n=3). (A) Western blot gel; (B) graphical representation of the results. **P<0.01. HBx, hepatitis B virus X protein; STAT3, signal transducer and activator of transcription 3; p-, phosphorylation.

Table III.

Effect of HBx on the protein expression of STAT3 and p-STAT3.

Table III.

Effect of HBx on the protein expression of STAT3 and p-STAT3.

GroupSTAT3p-STAT3p-STAT3/STAT3
MPC50.312±0.0120.362±0.0151.160±0.017
pEX-neo0.342±0.0180.301±0.0110.877±0.014
pEX-HBx 0.680±0.036a,b 0.960±0.015a,b 1.411±0.008a,b

{ label (or @symbol) needed for fn[@id='tfn7-etm-0-0-7453'] } Values are presented as mean ± standard deviation (n=3). Actual grayscale value of the target protein=the target protein average grayscale value/the GAPDH average grayscale value.

a P<0.01 vs. MPC5 group

b P<0.01 vs. pEX-neo group. HBx, hepatitis B virus X protein; STAT3, signal transducer and activator of transcription 3; p-, phosphorylation.

Discussion

HBV-GN is generally considered to be caused by immune complex deposition, as well as HBV replication and direct virus infection, accompanied by the renal and immune dysfunction caused by the infection, which is also considered a main pathogenic mechanism underlying HBV-GN (21). To date, little information has been established regarding the potential effects of HBx protein in terms of the damage and dysfunction observed in renal podocytes during chronic HBV infection. HBx is considered the most important determinant in viral pathogenesis (22,23); it is a necessary transcription factor for HBV replication, having an trans-activation effect, which can promote viral replication and induce apoptosis directly, and subsequently induce the occurrence of an inflammatory reaction and serve an important role in cell transformation and proliferation (24,25). Due to the widely trans-activation properties of the HBx gene and its effect on glomerular foot cells, mesangial cells and renal tubule epithelial cells (26–29), it is considered to have an important role in the pathogenesis of HBV-GN (28,29). A previous study by Zhang et al (15) demonstrated that podocyte number was significantly decreased in the glomeruli of children with HBV-GN, while HBx protein was visualized within the glomerulus in 71% children with HBV-GN, where the expression of HBx protein was localized mainly in the cytoplasm of podocytes, with lower expression in the nuclei of the podocytes (19). Therefore, in the present study it was examined whether HBx could affect the apoptosis and proliferation of renal podocytes and change the expression of nephrin.

In the current study, the highest level of HBx mRNA expression in podocytes occurred at 48 h post-HBx transfection. Thus, these cells at 48 h were selected to detect the viability of podocytes, and the data indicated that the viability of the HBx group was significantly lower than that of the blank control and negative control groups. This indicated that overexpression of HBx may supress podocyte viability, which is consistent with the report of Zhang et al (19). Nephrin is a main marker of foot cell damage; previous research has confirmed it serves an important role in recovering membrane integrity and in cytoskeletal remodelling (30). Furthermore, nephrin downregulation is considered a main mechanism involved in proteinuria (31). We therefore studied the relationship between nephrin and HBx protein, and observed that the expression of nephrin protein in the HBx transfection group was decreased to a greater extent than that in the negative and blank control groups, suggesting that the HBx gene may induce proteinuria through downregulation of nephrin protein.

Proteinuria is a common symptom of glomerular filtration membrane damage, and podocytes are highly differentiated epithelial cells that serve a key role in preventing the urinary leakage of plasma proteins; thus, podocyte injury or loss leads to proteinuria (12). To date, a number of studies have demonstrated that podocyte injury, loss and dysfunction serve an important role in diseases including FSGS and MN, among others (32–34). Therefore, maintenance of the integrity of podocyte structure and function, and protection of foot cells from injury have become potential therapeutic methods for the treatment of proteinuria. Apoptosis is a major method involved in podocyte decline (35,36), and the present study confirmed that HBx could increase the apoptosis of podocytes. Recently, studies have investigated the mechanisms underlying HBx-induced apoptosis of renal tubular cells (29,37), and He et al (28) suggested that HBx could reduce podocyte adhesion via downregulation of α3β1 integrin.

STATs are transcription factors located in the cytoplasm, where they can become activated by extracellular stimuli. Activated STATs, through regulation of gene expression, are able to regulate a series of biological processes, including cell proliferation, survival, apoptosis and differentiation, among others, and thus serve an important regulatory role in physiological and pathological reactions in cells (38–40). STAT3 is an important member of the STAT family; it is widely expressed in different tissue and cell types, and is responsible for transferring extracellular signals to the nucleus and for inducing the transcriptional expression of target genes, which involves tyrosine phosphorylation of STAT3, for instance at tyrosine 705 near the SH2 domain, to establish the activated form of STAT3 (p-STAT3) (41,42). The proportion of STAT3 phosphorylation in the pEX-HBx group was higher than that in the control groups), indicating HBx overexpression may activate the STAT3 protein. Although previous literature suggests that activation of STAT3 is associated with inhibition of apoptosis, particularly in cancers (43–45), in the present study, the activation of STAT3 was concomitant with podocyte apoptosis; a finding consistent with a study by He et al (29) in renal tubular epithelial cells. Therefore, it may be speculated that the apoptosis of podocytes in HBV-GN is associated with STAT3 activation, although the specific mechanism is unclear and requires further investigation; in future research, our group will conduct immunoprecipitation to screen protein interactions and provide further information about HBx in inducing HBV-GN via STAT signaling pathways.

In conclusion, these findings supported that HBx was involved in the pathogenic mechanism that HBV directly damages nephridial tissue. Additionally, find STAT3 related signal pathway and use specific inhibitors may be useful as new therapautics for the treatment of HBV-GN.

Acknowledgements

Not applicable.

Funding

The current study was funded by the National Natural Science Foundation of China (grant no. 81760133), the National Natural Science Foundation of Gansu Province (grant no. 1606RJ2A107) and the Science Foundation of Gansu Province People's Hospital (grant no. 17GSSY1-1).

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Authors' contributions

XYL and XXC designed the study, analyzed the data and wrote the manuscript. YHSun and MDG conducted the experiments. XXH and YHSuo assisted with the technical performance of experiments and contributed to the writing of the manuscript. All authors read and approved the final manuscript. XYL and XXC contributed equally to the present study as co-first authors. All authors read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Patient consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Glossary

Abbreviations

Abbreviations:

HBV

hepatitis B virus

HBx

hepatitis B virus X protein

HBV-GN

hepatitis B virus-associated glomerulonephritis

CKD

chronic kidney disease

MPC5

mouse podocyte clone 5

MN

membranous nephropathy

FSGS

focal segmental glomerulosclerosis

STAT3

signal transducer and activator of transcription 3

p-

phosphorylated

DMEM

Dulbecco's modified Eagle's medium

OD

optical density

TBST

Tris-buffered saline with Tween-20

References

1 

Liang X, Bi S, Yang W, Wang L, Cui G, Cui F, Zhang Y, Liu J, Gong X, Chen Y, et al: Epidemiological serosurvey of hepatitis hepatitis B in China-declining HBV prevalence due to hepatitis B vaccination. Vaccine. 27:6550–6557. 2009. View Article : Google Scholar : PubMed/NCBI

2 

Zhu P, Zhou FD and Zhao MH: The renal histopathology spectrum of elderly patients with kidney diseases: A study of 430 patients in a single chinese center. Medicine (Baltimore). 93:e2262014. View Article : Google Scholar : PubMed/NCBI

3 

Yang Y, Zhang Z, Zhuo L, Chen DP and Li WG: The spectrum of biopsy-proven glomerular disease in China: A systematic review. Chin Med J (Engl). 131:731–735. 2018. View Article : Google Scholar : PubMed/NCBI

4 

Combes B, Shorey J, Barrera A, Stastny P, Eigenbrodt EH, Hull AR and Carter NW: Glomerulonephritis with deposition of Australia antigen-antibody complexes in glomerular basement membrane. Lancet. 2:234–237. 1971. View Article : Google Scholar : PubMed/NCBI

5 

Lai WL, Yeh TH, Chen PM, Chan CK, Chiang WC, Chen YM, Wu KD and Tsai TJ: Membranous nephropathy: A review on the pathogenesis, diagnosis, and treatment. J Formos Med Assoc. 114:102–111. 2015. View Article : Google Scholar : PubMed/NCBI

6 

Dettmar AK and Oh J: Infection-related focal segmental glomerulosclerosis in children. Biomed Res Int. 2016:73519642016. View Article : Google Scholar : PubMed/NCBI

7 

Sakai K, Morito N, Usui J, Hagiwara M, Hiwatashi A, Fukuda K, Nanmoku T, Toda T, Matsui N, Nagata M and Yamagata K: Focal segmental glomerulosclerosis as a complication of hepatitis B virus infection. Nephrol Dial Transplant. 26:371–373. 2011. View Article : Google Scholar : PubMed/NCBI

8 

He P, Zhou G, Qu D, Zhang B, Wang Y and Li D: HBx inhibits proliferation and induces apoptosis via Fas/FasL upregulation in rat renal tubular epithelial cells. J Nephrol. 26:1033–1041. 2013. View Article : Google Scholar : PubMed/NCBI

9 

Hong L, Zhang J, Min J, Lu J, Li F, Li H, Guo S and Li Q: A role for MHBst167/HBx in hepatitis B virus-induced renal tubular cell apoptosis. Nephrol Dial Transplant. 25:2125–2133. 2010. View Article : Google Scholar : PubMed/NCBI

10 

Sun YH, Lei XY, Sai YP, Chen JH, Sun YC and Gao X: Relationship between genotypes and clinical manifestation, pathology, and cccDNA in Chinese children with hepatitis B virus-associated glomerulonephritis. World J Pediatr. 12:347–352. 2016. View Article : Google Scholar : PubMed/NCBI

11 

Souza LO, Perez RM, Carvalho-Filho RJ, Matos CA, Moutinho RS, Silva IS, Medina-Pestana JO, Silva AE and Ferraz ML: Unexpected distribution of hepatitis B genotypes in patients with kidney disease: Comparison with immunocompetent subjects. J Med Virol. 84:1548–1552. 2012. View Article : Google Scholar : PubMed/NCBI

12 

Pavenstadt H, Kriz W and Kretzler M: Cell biology of the glomerular podocyte. Physiol Rev. 83:253–307. 2003. View Article : Google Scholar : PubMed/NCBI

13 

Liu J, Zhang B, Chai Y, Xu Y, Xing C and Wang X: Fluvastatin attenuated the effect of expression of beta1 integrin in PAN-treated podocytes by inhibiting reactive oxygen species. Mol Cell Biochem. 398:207–215. 2015. View Article : Google Scholar : PubMed/NCBI

14 

Shankland SJ and Al'Douahji M: Cell cycle regulatory proteins in glomerular disease. Exp Nephrol. 7:207–211. 1999. View Article : Google Scholar : PubMed/NCBI

15 

Zhang Y, Zhou JH and Wang HT: Podocyte depletion in children with hepatitis B virus-associated membranous nephropathy. Zhonghua Er Ke Za Zhi. 45:344–348. 2007.(In Chinese). PubMed/NCBI

16 

Seeger V and Mason WS: Hepatitis B virus biology. Microbiol Mol Biol Rev. 64:51–68. 2000. View Article : Google Scholar : PubMed/NCBI

17 

Clippinger AJ, Gearhart TL and Bouchard MJ: Hepatitis B virus X protein modulates apoptosis in primary rat hepatocytes by regulating both NF-kappaB and the mitochondrial permeability transition pore. J Virol. 83:4718–4731. 2009. View Article : Google Scholar : PubMed/NCBI

18 

Moolla N, Kew M and Arbuthnot P: Regulator elements of hepatitis B virus transcription. J Viral Hepat. 9:323–331. 2002. View Article : Google Scholar : PubMed/NCBI

19 

Zhang Y, Chen Y, Yang F and Zhou J: HBx transfection limits proliferative capacity of podocytes through cell cycle regulation. Acta Biochim Biophys Sin (Shanghai). 46:1016–1023. 2014. View Article : Google Scholar : PubMed/NCBI

20 

Livak KJ and Schmittgen TD: Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 25:402–408. 2001. View Article : Google Scholar : PubMed/NCBI

21 

Ren J, Wang L, Chen Z, Ma ZM, Zhu HG, Yang DL, Li XY, Wang BI, Fei J, Wang ZG and Wen YM: Gene expression profile of transgenic mouse kidney reveals pathogenesis of hepatitis B virus associated nephropathy. J Med Virol. 78:551–560. 2006. View Article : Google Scholar : PubMed/NCBI

22 

Murakami S: Hepatitis B virus X protein: A multifunctional viral regulator. J Gastroenterol. 36:651–660. 2001. View Article : Google Scholar : PubMed/NCBI

23 

Bouchard MJ and Schneider RJ: The enigmatic X gene of hepatitis B virus. J Virol. 78:12725–12734. 2004. View Article : Google Scholar : PubMed/NCBI

24 

Xu J, Yun X, Jiang J, Wei Y, Wu Y, Zhang W, Liu Y, Wang W, Wen Y and Gu J: Hepatitis B virus X protein blunts senescence-like growth arrest of human hepatocellular carcinoma by reducing Notch1 cleavage. Hepatology. 52:142–154. 2010. View Article : Google Scholar : PubMed/NCBI

25 

Cui H, Li QL, Chen J, Na Q and Liu CX: Hepatitis B virus X protein modifies invasion, proliferation and the inflammatory response in an HTR-8/SVneo cell model. Oncol Rep. 34:2090–2098. 2015. View Article : Google Scholar : PubMed/NCBI

26 

Lu HZ and Zhou JH: Hepatitis B virus X protein up-regulates tumor necrosis factor-α expression in cultured mesangial cells via ERKs and NF-KB pathways. Asian Pac J Trop Biomed. 3:217–222. 2013. View Article : Google Scholar : PubMed/NCBI

27 

Lu H and Zhou J: HBV X gene transfection upregulates IL-1beta and IL-6 gene expression and induces rat glomerular mesangial cell proliferation. J Huazhong Univ Sci Technolog Med Sci. 28:247–250. 2008. View Article : Google Scholar : PubMed/NCBI

28 

He P, Liu D, Zhang B, Zhou G, Su X, Wang Y, Li D and Yang X: Hepatitis B virus X protein reduces podocyte adhesion via downregulation of α3β1 Integrin. Cell Physiol Biochem. 41:689–700. 2017. View Article : Google Scholar : PubMed/NCBI

29 

He P, Zhang D, Li H, Yang X, Li D, Zhai Y, Ma L and Feng G: Hepatitis B virus X protein modulates apoptosis in human renal proximal tubular epithelial cells by activating the JAK2/STAT3 signaling pathway. Int J Mol Med. 31:1017–1029. 2013. View Article : Google Scholar : PubMed/NCBI

30 

Ma Y, Yang Q, Zhong Z, Liang W, Zhang L, Yang Y and Ding G: Role of c-Abl and nephrin in podocyte cytoskeletal remodeling induced by angiotensin II. Cell Death Dis. 9:1852018. View Article : Google Scholar : PubMed/NCBI

31 

Kato T, Mizuno S and Kamimoto M: The decreases of nephrin and nuclear WTl in podocytes may cause albuminuria during the experimental sepsis in mice. Biomed Res. 31:363–369. 2010. View Article : Google Scholar : PubMed/NCBI

32 

Zhu C, Xuan X, Che R, Ding G, Zhao M, Bai M, Jia Z, Huang S and Zhang A: Dysfunction of the PGC-1α-mitochondria axis confers adriamycin-induced podocyte injury. Am J Physiol Renal Physiol. 306:F1410–F1417. 2014. View Article : Google Scholar : PubMed/NCBI

33 

Maezawa Y, Onay T, Scott RP, Keir LS, Dimke H, Li C, Eremina V, Maezawa Y, Jeansson M, Shan J, et al: Loss of the podocyte expressed transcription factor Tcf21/Pod1 results in podocyte differentiation defects and FSGS. J Am Soc Nephrol. 25:2459–2470. 2014. View Article : Google Scholar : PubMed/NCBI

34 

Nagata M: Podocyte injury and its consequences. Kidney Int. 89:1221–1230. 2016. View Article : Google Scholar : PubMed/NCBI

35 

Mundel P and Shankland SJ: Podocyte biology and response to injury. J Am Soc Nephrol. 13:3005–3015. 2002. View Article : Google Scholar : PubMed/NCBI

36 

Marshall CB and Shankland SJ: Cell cycle regulatory proteins in podocyte health and disease. Nephron Exp Nephrol. 106:e51–e59. 2007. View Article : Google Scholar : PubMed/NCBI

37 

Yang Y, Wang X, Zhang Y and Yuan W: Hepatitis B virus X protein and proinflammatory cytokines synergize to enhance TRAIL-induced apoptosis of renal tubular cells by upregulation of DR4. Int J Biochem Cell Biol. 97:62–72. 2018. View Article : Google Scholar : PubMed/NCBI

38 

Rawlings JS, Rosler IM and Harrison DA: The JAK/STAT signaling pathway. J Cell Sci. 117:1281–1283. 2004. View Article : Google Scholar : PubMed/NCBI

39 

Aittomäki S and Pesu M: Therapeutic targeting of the Jak/STAT pathway. Basic Clin Pharmacol Toxicol. 114:18–23. 2014. View Article : Google Scholar : PubMed/NCBI

40 

Cai B, Cai JP, Luo YL, Chen C and Zhang S: The specific roles of JAK/STAT signaling pathway in sepsis. Inflammation. 38:1599–1608. 2015. View Article : Google Scholar : PubMed/NCBI

41 

Ferguson SD, Srinivasan VM and Heimberger AB: The role of STAT3 in tumor-mediated immune suppression. J Neurooncol. 123:385–394. 2015. View Article : Google Scholar : PubMed/NCBI

42 

Demaria M, Misale S, Giorgi C, Miano V, Camporeale A, Campisi J, Pinton P and Poli V: STAT3 can serve as a hit in the process of malignant transformation of primary cells. Cell Death Differ. 19:1390–1397. 2012. View Article : Google Scholar : PubMed/NCBI

43 

Huang G, Huang X, Liu M, Hua Y, Deng B, Jin W, Yan W, Tan Z, Wu Y, Liu B and Zhou Y: Secoisolariciresinol diglucoside prevents the oxidative stress-induced apoptosis of myocardial cells through activation of the JAK2/STAT3 signaling pathway. Int J Mol Med. 41:3570–3576. 2018.PubMed/NCBI

44 

Liu K, Gao H, Wang Q, Wang L, Zhang B, Han Z, Chen X, Han M and Gao M: Hispidulin suppresses cell growth and metastasis by targeting PIM1 through JAK2/STAT3 signaling in colorectal cancer. Cancer Sci. 109:1369–1381. 2018. View Article : Google Scholar : PubMed/NCBI

45 

Hu GQ, Du X, Li YJ, Gao XQ, Chen BQ and Yu L: Inhibition of cerebral ischemia/reperfusion injury-induced apoptosis: Nicotilforin and JAK2/STAT3 pathway. Neural Regen Res. 12:96–102. 2017. View Article : Google Scholar : PubMed/NCBI

Related Articles

  • Abstract
  • View
  • Download
  • Twitter
Copy and paste a formatted citation
Spandidos Publications style
Lei XY, Chen XX, Sun YH, Gao MD, Hu XX and Suo YH: Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3. Exp Ther Med 17: 4223-4229, 2019.
APA
Lei, X., Chen, X., Sun, Y., Gao, M., Hu, X., & Suo, Y. (2019). Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3. Experimental and Therapeutic Medicine, 17, 4223-4229. https://doi.org/10.3892/etm.2019.7453
MLA
Lei, X., Chen, X., Sun, Y., Gao, M., Hu, X., Suo, Y."Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3". Experimental and Therapeutic Medicine 17.5 (2019): 4223-4229.
Chicago
Lei, X., Chen, X., Sun, Y., Gao, M., Hu, X., Suo, Y."Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3". Experimental and Therapeutic Medicine 17, no. 5 (2019): 4223-4229. https://doi.org/10.3892/etm.2019.7453
Copy and paste a formatted citation
x
Spandidos Publications style
Lei XY, Chen XX, Sun YH, Gao MD, Hu XX and Suo YH: Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3. Exp Ther Med 17: 4223-4229, 2019.
APA
Lei, X., Chen, X., Sun, Y., Gao, M., Hu, X., & Suo, Y. (2019). Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3. Experimental and Therapeutic Medicine, 17, 4223-4229. https://doi.org/10.3892/etm.2019.7453
MLA
Lei, X., Chen, X., Sun, Y., Gao, M., Hu, X., Suo, Y."Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3". Experimental and Therapeutic Medicine 17.5 (2019): 4223-4229.
Chicago
Lei, X., Chen, X., Sun, Y., Gao, M., Hu, X., Suo, Y."Hepatitis B virus X protein decreases nephrin expression and induces podocyte apoptosis via activating STAT3". Experimental and Therapeutic Medicine 17, no. 5 (2019): 4223-4229. https://doi.org/10.3892/etm.2019.7453
Follow us
  • Twitter
  • LinkedIn
  • Facebook
About
  • Spandidos Publications
  • Careers
  • Cookie Policy
  • Privacy Policy
How can we help?
  • Help
  • Live Chat
  • Contact
  • Email to our Support Team